pre-miRNA Information
pre-miRNA hsa-mir-744   
Genomic Coordinates chr17: 12081899 - 12081996
Synonyms MIRN744, hsa-mir-744, MIR744
Description Homo sapiens miR-744 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-744-5p
Sequence 11| UGCGGGGCUAGGGCUAACAGCA |32
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN23015028 1 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs557969425 1 dbSNP
rs748252260 4 dbSNP
rs1470408501 7 dbSNP
rs1178657616 10 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6B8SM miR-744-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol ACTN4   
Synonyms ACTININ-4, FSGS, FSGS1
Description actinin alpha 4
Transcript NM_004924   
Expression
Putative miRNA Targets on ACTN4
3'UTR of ACTN4
(miRNA target sites are highlighted)
>ACTN4|NM_004924|3'UTR
   1 GGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCT
  81 GTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGTGGGTGGGCAGGGAGGGGCTGGGGCAGGCTCTCTCCTCTC
 161 TCTCTTTGTGGGTTGGCCAGGAGGTTCCCCCGACCAGGTTGGGGAGACTTGGGGCCAGCGCTTCTGGTCTGGTAAATATG
 241 TATGATGTGTTGTGCTTTTTTAACCAAGGAGGGGCCAGTGGATTCCCACAGCACAACCGGTCCCTTCCATGCCCTGGGAT
 321 GCCTCACCACACCCAGGTCTCTTCCTTTGCTCTGAGGTCCCTTCAAGGCCTCCCCAATCCAGGCCAAAGCCCCATGTGCC
 401 TTGTCCAGGAACTGCCTGGGCCATGCGAGGGGCCAGCAGAGGGCGCCACCACCACCTGACGGCTGGGGACCCACCCAGCC
 481 CCTCTCCCCTCTCTGCTCCAGACTCACTTGCCATTGCCAGGAGATGGCCCCAACAAGCACCCCGCTTTTGCAGCAGAGGA
 561 GCTGAGTTGGCAGACCGGGCCCCCCTGAACCGCACCCCATCCCACCAGCCCCGGCCTTGCTTTGTCTGGCCTCACGTGTC
 641 TCAGATTTTCTAAGAACCAAAAAAAAAAAAGGAAAAAAAACACAAAACAACAAAAACCAAAAAAAAAAAAAATCACAAAA
 721 ACAAAAAAACTATAAAAAAGAAAGAATTAAAAACTTTCAGAGAATTACTATTTACTTTATTAACTTACGGATTTATTATA
 801 TAAATATATATTCACCTAGCAACATATCTCTGCCGTCTCTCCTGCTCTCATAATGAAGACATAGCCGATTCTCTGCCCGG
 881 GCCCCTTGCTGATGCTCCTCCGGGTCTGCGTCGGGCGTGGGTCTCTGGGGACCCTCCAGAGGTGGAGGTGGGCTGATGGC
 961 CTGGCTGCCTGGTGGTTGATGGTTTTGCTCCCCCTACCTTTTTTTTTTGAGTTTATTCTGATTGATTTTTTTTCTTGGTT
1041 TCTGGATAAACCACCCTCTGGGGACAGGATAATAAAACATGTAATATTTTTAAGAAGGATAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acgacaaUCGGGAUCGGGGCGu 5'
                 ||||| :|||::|| 
Target 5' tcccaccAGCCCCGGCCTTGCt 3'
600 - 621 131.00 -21.00
2
miRNA  3' acgaCAAUCG---GGAUCGGGGCGu 5'
              |||:||   || :||||| | 
Target 5' ctgaGTTGGCAGACCGGGCCCCCCt 3'
562 - 586 130.00 -18.80
3
miRNA  3' acGACAAUCGGGAUCGGGGcgu 5'
            :| |  |||| :|||||   
Target 5' gaTTCTCTGCCCGGGCCCCttg 3'
867 - 888 120.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
735155 1588 ClinVar
777472 1710 ClinVar
COSN31503277 29 COSMIC
COSN30512911 30 COSMIC
COSN26964988 45 COSMIC
COSN20079619 122 COSMIC
COSN32058488 146 COSMIC
COSN20046618 192 COSMIC
COSN30658842 262 COSMIC
COSN23015380 355 COSMIC
COSN26552429 404 COSMIC
COSN32061598 671 COSMIC
COSN23916158 673 COSMIC
COSN32061169 713 COSMIC
COSN31480059 723 COSMIC
COSN24585574 997 COSMIC
COSN26637239 1025 COSMIC
COSN26465322 1045 COSMIC
COSN30165631 1052 COSMIC
COSN30542833 1103 COSMIC
COSN31480155 1113 COSMIC
COSN31480151 1246 COSMIC
COSN20093589 1248 COSMIC
COSN30540015 1375 COSMIC
COSN24407239 1406 COSMIC
COSM4534920 1446 COSMIC
COSN20691705 1461 COSMIC
COSM6004196 1525 COSMIC
COSM4534901 1534 COSMIC
COSM5471005 1564 COSMIC
COSM9395754 1569 COSMIC
COSN24306569 1632 COSMIC
COSN28862538 1632 COSMIC
COSN19747685 1659 COSMIC
COSM4077845 1687 COSMIC
COSM7517690 1699 COSMIC
COSM3222917 1709 COSMIC
COSM8888333 1710 COSMIC
COSM9872340 1718 COSMIC
COSM3822985 1719 COSMIC
COSM4140610 1724 COSMIC
COSM8284911 1729 COSMIC
COSM3222918 1730 COSMIC
COSM7618055 1733 COSMIC
COSM309844 1735 COSMIC
COSM5958069 1744 COSMIC
COSM4581006 1751 COSMIC
COSM3766333 1757 COSMIC
COSM4131789 1763 COSMIC
COSM9657542 1766 COSMIC
COSN28674971 1920 COSMIC
COSN20828594 1980 COSMIC
COSN7126489 2021 COSMIC
COSN26180894 2141 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751335043 4 dbSNP
rs1386787017 6 dbSNP
rs1304487238 8 dbSNP
rs757107648 10 dbSNP
rs780805765 13 dbSNP
rs745465563 16 dbSNP
rs754946729 20 dbSNP
rs755767012 22 dbSNP
rs779575418 24 dbSNP
rs1357339716 25 dbSNP
rs1413300473 26 dbSNP
rs748769629 28 dbSNP
rs772612410 29 dbSNP
rs773633620 30 dbSNP
rs202116126 32 dbSNP
rs543917023 34 dbSNP
rs771485181 36 dbSNP
rs1196095445 39 dbSNP
rs779036502 39 dbSNP
rs1013821750 43 dbSNP
rs1186526090 43 dbSNP
rs1187297764 47 dbSNP
rs1367513275 48 dbSNP
rs777152795 54 dbSNP
rs765589609 58 dbSNP
rs1358129736 61 dbSNP
rs747892490 65 dbSNP
rs1298689639 68 dbSNP
rs1025617690 76 dbSNP
rs775615261 78 dbSNP
rs771962927 80 dbSNP
rs1255540137 82 dbSNP
rs1316739884 82 dbSNP
rs777443891 82 dbSNP
rs747188587 83 dbSNP
rs762981054 83 dbSNP
rs1318123560 94 dbSNP
rs1283999600 96 dbSNP
rs1311813670 97 dbSNP
rs764084202 98 dbSNP
rs751505380 104 dbSNP
rs757199842 109 dbSNP
rs1353019687 113 dbSNP
rs1398211974 113 dbSNP
rs1162477351 114 dbSNP
rs767232713 114 dbSNP
rs771173130 114 dbSNP
rs547981430 117 dbSNP
rs566145294 118 dbSNP
rs1262950681 120 dbSNP
rs1482594601 121 dbSNP
rs536709887 122 dbSNP
rs1239202085 123 dbSNP
rs1184149237 125 dbSNP
rs759660145 126 dbSNP
rs776642550 126 dbSNP
rs949061608 126 dbSNP
rs1199931958 127 dbSNP
rs1200234022 130 dbSNP
rs1463719867 131 dbSNP
rs750247842 136 dbSNP
rs1307762167 137 dbSNP
rs1206530578 138 dbSNP
rs1254726743 139 dbSNP
rs1288660376 140 dbSNP
rs55808893 146 dbSNP
rs755713615 148 dbSNP
rs925409382 149 dbSNP
rs958106031 149 dbSNP
rs1285088225 153 dbSNP
rs1240059043 154 dbSNP
rs1378129480 154 dbSNP
rs1438468899 155 dbSNP
rs1375403578 156 dbSNP
rs1447571608 156 dbSNP
rs974574445 156 dbSNP
rs1158740213 159 dbSNP
rs1346882690 161 dbSNP
rs1407241176 161 dbSNP
rs921750921 163 dbSNP
rs933131073 164 dbSNP
rs1051699127 165 dbSNP
rs907750211 165 dbSNP
rs779624869 167 dbSNP
rs1402712194 171 dbSNP
rs1454400806 172 dbSNP
rs1329517327 173 dbSNP
rs1376448258 178 dbSNP
rs753358822 179 dbSNP
rs761837588 181 dbSNP
rs1309323529 182 dbSNP
rs1218941161 183 dbSNP
rs1310922977 185 dbSNP
rs554806297 185 dbSNP
rs940372769 186 dbSNP
rs1257120181 187 dbSNP
rs1352206718 188 dbSNP
rs1462903467 189 dbSNP
rs754513197 190 dbSNP
rs570011301 192 dbSNP
rs537081617 193 dbSNP
rs1457087873 194 dbSNP
rs1273084629 195 dbSNP
rs1177272713 196 dbSNP
rs1409578264 197 dbSNP
rs1431350467 198 dbSNP
rs898950982 200 dbSNP
rs1322092809 201 dbSNP
rs1001274286 202 dbSNP
rs1055326511 204 dbSNP
rs1470797484 205 dbSNP
rs747464402 208 dbSNP
rs181865771 209 dbSNP
rs1447843288 210 dbSNP
rs1299941698 212 dbSNP
rs1025226460 218 dbSNP
rs1287827103 220 dbSNP
rs781658234 221 dbSNP
rs1478817246 224 dbSNP
rs1269123320 226 dbSNP
rs1235446923 233 dbSNP
rs1386312192 233 dbSNP
rs1216432224 236 dbSNP
rs746260275 237 dbSNP
rs770025188 240 dbSNP
rs1288532670 242 dbSNP
rs1032290348 244 dbSNP
rs1257895675 246 dbSNP
rs1316890038 248 dbSNP
rs1204839057 256 dbSNP
rs1234280214 258 dbSNP
rs1487197575 260 dbSNP
rs1190131333 264 dbSNP
rs1269444205 277 dbSNP
rs1481413673 278 dbSNP
rs775638313 279 dbSNP
rs1422714082 283 dbSNP
rs763072133 286 dbSNP
rs1399228190 289 dbSNP
rs1338159778 293 dbSNP
rs577488414 296 dbSNP
rs544908250 299 dbSNP
rs981125478 300 dbSNP
rs954576978 301 dbSNP
rs1159389400 302 dbSNP
rs1382187979 309 dbSNP
rs1192504789 310 dbSNP
rs35588423 310 dbSNP
rs116093917 318 dbSNP
rs1265834074 324 dbSNP
rs1187422528 337 dbSNP
rs1236200280 338 dbSNP
rs1483238039 338 dbSNP
rs1158607094 339 dbSNP
rs8112979 349 dbSNP
rs745745930 360 dbSNP
rs1257437389 366 dbSNP
rs1217037275 369 dbSNP
rs1320217240 372 dbSNP
rs1297483059 373 dbSNP
rs1382548771 378 dbSNP
rs940597691 379 dbSNP
rs1450683086 381 dbSNP
rs1301001403 384 dbSNP
rs1454457824 385 dbSNP
rs973123758 389 dbSNP
rs1169300107 390 dbSNP
rs1463756542 394 dbSNP
rs1425299172 396 dbSNP
rs1423595460 397 dbSNP
rs1382774691 399 dbSNP
rs920242553 401 dbSNP
rs1184124509 404 dbSNP
rs1462104786 415 dbSNP
rs1237680425 417 dbSNP
rs936969185 425 dbSNP
rs533178839 427 dbSNP
rs1252075088 445 dbSNP
rs1227963245 446 dbSNP
rs895526235 446 dbSNP
rs949616203 449 dbSNP
rs1248121731 453 dbSNP
rs1046991196 456 dbSNP
rs560845751 461 dbSNP
rs1278958667 462 dbSNP
rs755979185 463 dbSNP
rs1298378800 464 dbSNP
rs117199570 466 dbSNP
rs543406206 473 dbSNP
rs1167292475 474 dbSNP
rs1313560597 477 dbSNP
rs1032532128 479 dbSNP
rs1176895034 480 dbSNP
rs1441615920 488 dbSNP
rs879463051 488 dbSNP
rs1209474491 489 dbSNP
rs996100633 489 dbSNP
rs564893795 490 dbSNP
rs1360128015 492 dbSNP
rs372527421 492 dbSNP
rs1308443732 494 dbSNP
rs1237402598 495 dbSNP
rs1240139187 496 dbSNP
rs1437855286 500 dbSNP
rs1385902149 502 dbSNP
rs954957025 506 dbSNP
rs1176659104 507 dbSNP
rs1360518984 509 dbSNP
rs14091 510 dbSNP
rs1157401007 513 dbSNP
rs1209042070 519 dbSNP
rs1172750355 520 dbSNP
rs1471405355 520 dbSNP
rs1198191562 522 dbSNP
rs548118854 522 dbSNP
rs1015160355 523 dbSNP
rs566253447 523 dbSNP
rs530258779 525 dbSNP
rs1439494626 526 dbSNP
rs548648036 526 dbSNP
rs1490449391 529 dbSNP
rs866237477 531 dbSNP
rs1457419965 534 dbSNP
rs920474253 537 dbSNP
rs936990535 539 dbSNP
rs1347935695 540 dbSNP
rs1398742067 542 dbSNP
rs1277940066 544 dbSNP
rs74584773 545 dbSNP
rs1216724216 546 dbSNP
rs917038052 547 dbSNP
rs186792035 552 dbSNP
rs1046581913 556 dbSNP
rs949825195 556 dbSNP
rs1220175831 560 dbSNP
rs770253393 563 dbSNP
rs1340305389 567 dbSNP
rs1490813276 575 dbSNP
rs191237993 577 dbSNP
rs1418152141 578 dbSNP
rs935484310 581 dbSNP
rs1053973072 582 dbSNP
rs570518830 585 dbSNP
rs1399193238 586 dbSNP
rs1431798777 590 dbSNP
rs538534458 592 dbSNP
rs553824510 593 dbSNP
rs1405060761 594 dbSNP
rs1028943442 597 dbSNP
rs1307500482 600 dbSNP
rs1164260929 602 dbSNP
rs1191174323 609 dbSNP
rs890576100 609 dbSNP
rs1262304914 610 dbSNP
rs761698176 613 dbSNP
rs572186555 614 dbSNP
rs1009380880 616 dbSNP
rs1346315267 617 dbSNP
rs1316866673 619 dbSNP
rs1276755965 623 dbSNP
rs374190850 629 dbSNP
rs868789894 631 dbSNP
rs1014988450 636 dbSNP
rs10034 637 dbSNP
rs1203985576 638 dbSNP
rs1408391507 639 dbSNP
rs1247305508 642 dbSNP
rs1479129361 644 dbSNP
rs973192137 645 dbSNP
rs1165982047 648 dbSNP
rs1189649664 651 dbSNP
rs1429050380 652 dbSNP
rs1188707721 655 dbSNP
rs936537796 655 dbSNP
rs1478380056 657 dbSNP
rs201057110 658 dbSNP
rs1027610760 659 dbSNP
rs1255758847 659 dbSNP
rs1337522682 659 dbSNP
rs1398462181 659 dbSNP
rs1457073690 659 dbSNP
rs1491373394 659 dbSNP
rs74176458 659 dbSNP
rs1331115490 660 dbSNP
rs1491101804 660 dbSNP
rs1410688034 663 dbSNP
rs1396988909 664 dbSNP
rs958602686 665 dbSNP
rs1442757312 667 dbSNP
rs1398828587 669 dbSNP
rs1409885849 670 dbSNP
rs1323665259 671 dbSNP
rs1438532485 671 dbSNP
rs1206194045 672 dbSNP
rs1351049770 672 dbSNP
rs1220685640 673 dbSNP
rs1289640800 673 dbSNP
rs1316345073 673 dbSNP
rs1362267014 673 dbSNP
rs866599301 673 dbSNP
rs1239588481 674 dbSNP
rs1374781436 675 dbSNP
rs1433888735 677 dbSNP
rs1282193065 678 dbSNP
rs1340722510 679 dbSNP
rs576029011 680 dbSNP
rs916881931 681 dbSNP
rs1164153151 682 dbSNP
rs1220305851 682 dbSNP
rs1367441298 682 dbSNP
rs1137116 683 dbSNP
rs1276051291 684 dbSNP
rs1491460967 684 dbSNP
rs971063253 684 dbSNP
rs1491359483 685 dbSNP
rs1228746862 686 dbSNP
rs1010691720 689 dbSNP
rs1197792672 689 dbSNP
rs1042134274 690 dbSNP
rs1216523949 691 dbSNP
rs1290712719 692 dbSNP
rs377014257 697 dbSNP
rs1286492518 698 dbSNP
rs1491016440 698 dbSNP
rs1343338422 699 dbSNP
rs1367251418 699 dbSNP
rs1374289874 699 dbSNP
rs74176459 699 dbSNP
rs878970245 699 dbSNP
rs1453347925 700 dbSNP
rs1424099934 708 dbSNP
rs935505298 709 dbSNP
rs1268493277 711 dbSNP
rs1481174690 711 dbSNP
rs143818437 713 dbSNP
rs1488739079 714 dbSNP
rs1053879657 715 dbSNP
rs1196372233 717 dbSNP
rs915529630 719 dbSNP
rs1216664249 720 dbSNP
rs1244331751 720 dbSNP
rs1283739173 723 dbSNP
rs1311698331 723 dbSNP
rs1359860103 723 dbSNP
rs201758431 723 dbSNP
rs890473478 723 dbSNP
rs932224337 723 dbSNP
rs1290542367 724 dbSNP
rs1358076144 727 dbSNP
rs543546312 727 dbSNP
rs563858750 730 dbSNP
rs1164303748 731 dbSNP
rs1415361217 732 dbSNP
rs1422028511 732 dbSNP
rs1187622764 733 dbSNP
rs1241386190 734 dbSNP
rs1257653732 734 dbSNP
rs1461966425 734 dbSNP
rs1483188122 734 dbSNP
rs1226493623 735 dbSNP
rs1036855812 736 dbSNP
rs1215117979 737 dbSNP
rs1297369479 737 dbSNP
rs148908950 737 dbSNP
rs1301982337 738 dbSNP
rs1312331183 738 dbSNP
rs1330283089 741 dbSNP
rs1356679096 741 dbSNP
rs1406438316 741 dbSNP
rs897905002 741 dbSNP
rs753606467 743 dbSNP
rs1027474961 744 dbSNP
rs1012856657 745 dbSNP
rs1383892159 745 dbSNP
rs958633968 745 dbSNP
rs1194299959 748 dbSNP
rs1481717899 749 dbSNP
rs1252877838 752 dbSNP
rs1204929270 753 dbSNP
rs1296120315 753 dbSNP
rs1358726405 754 dbSNP
rs1325594174 755 dbSNP
rs1382897391 758 dbSNP
rs953044773 760 dbSNP
rs768747977 763 dbSNP
rs1024196524 764 dbSNP
rs1299135522 765 dbSNP
rs984444025 765 dbSNP
rs1285930858 768 dbSNP
rs1364313821 769 dbSNP
rs1424414742 769 dbSNP
rs759092967 771 dbSNP
rs971479178 771 dbSNP
rs924395714 776 dbSNP
rs1421158611 777 dbSNP
rs957111552 777 dbSNP
rs1354126796 778 dbSNP
rs1177629015 781 dbSNP
rs989637033 783 dbSNP
rs1291120505 784 dbSNP
rs774242236 789 dbSNP
rs1218992390 790 dbSNP
rs1260122882 792 dbSNP
rs1360008600 792 dbSNP
rs1259686661 793 dbSNP
rs1236219779 795 dbSNP
rs1318420421 797 dbSNP
rs1307240541 800 dbSNP
rs1446735723 801 dbSNP
rs747938382 807 dbSNP
rs1305296731 809 dbSNP
rs1239765171 810 dbSNP
rs1443309954 812 dbSNP
rs1384843717 813 dbSNP
rs1162390715 817 dbSNP
rs1156938379 818 dbSNP
rs908952655 821 dbSNP
rs139090612 825 dbSNP
rs1455399861 825 dbSNP
rs1051135194 826 dbSNP
rs912115569 827 dbSNP
rs971846787 828 dbSNP
rs532185985 830 dbSNP
rs944741990 831 dbSNP
rs541743616 832 dbSNP
rs897938881 835 dbSNP
rs772909923 836 dbSNP
rs1222556272 840 dbSNP
rs1049150087 845 dbSNP
rs1383761085 848 dbSNP
rs1055713748 850 dbSNP
rs1396428122 850 dbSNP
rs1285638535 851 dbSNP
rs894409309 851 dbSNP
rs1224471776 855 dbSNP
rs1326418191 857 dbSNP
rs1335929787 858 dbSNP
rs948024889 861 dbSNP
rs1338692932 863 dbSNP
rs531086227 866 dbSNP
rs1314474633 867 dbSNP
rs1377690882 868 dbSNP
rs1012720237 869 dbSNP
rs1336111886 869 dbSNP
rs1178412627 870 dbSNP
rs1431683371 870 dbSNP
rs1478223644 871 dbSNP
rs549211840 875 dbSNP
rs1259235474 876 dbSNP
rs999611343 878 dbSNP
rs1261846126 879 dbSNP
rs776121559 880 dbSNP
rs1281095688 881 dbSNP
rs1460374420 885 dbSNP
rs145963849 886 dbSNP
rs998962308 887 dbSNP
rs548464517 889 dbSNP
rs1031323093 890 dbSNP
rs1029228488 893 dbSNP
rs752965512 895 dbSNP
rs575520510 902 dbSNP
rs148628317 903 dbSNP
rs1179003976 904 dbSNP
rs1314512879 907 dbSNP
rs984391495 910 dbSNP
rs1015901561 911 dbSNP
rs183086073 913 dbSNP
rs372094916 914 dbSNP
rs758967912 916 dbSNP
rs986311015 917 dbSNP
rs11551402 918 dbSNP
rs778196775 918 dbSNP
rs912162465 922 dbSNP
rs1182518188 929 dbSNP
rs938510358 932 dbSNP
rs1442254521 933 dbSNP
rs1244375802 935 dbSNP
rs3208236 936 dbSNP
rs1187855347 937 dbSNP
rs1331898077 938 dbSNP
rs944962497 938 dbSNP
rs570049345 939 dbSNP
rs991763195 941 dbSNP
rs1304954978 942 dbSNP
rs1244340174 943 dbSNP
rs1335409966 945 dbSNP
rs1234148986 947 dbSNP
rs1315769927 947 dbSNP
rs1277004238 951 dbSNP
rs1441776237 954 dbSNP
rs796177222 962 dbSNP
rs1321795282 966 dbSNP
rs1203406170 968 dbSNP
rs11551401 972 dbSNP
rs1259311523 973 dbSNP
rs1371152343 973 dbSNP
rs1162858670 977 dbSNP
rs1422624416 981 dbSNP
rs1386582482 983 dbSNP
rs1459476483 983 dbSNP
rs1163310991 986 dbSNP
rs1193630770 988 dbSNP
rs1053576301 989 dbSNP
rs141337575 990 dbSNP
rs1483592330 990 dbSNP
rs1433419814 991 dbSNP
rs1220940751 993 dbSNP
rs1362154416 993 dbSNP
rs1200505352 997 dbSNP
rs1202093647 999 dbSNP
rs1302251165 999 dbSNP
rs1348891265 999 dbSNP
rs1350918184 999 dbSNP
rs894524366 1002 dbSNP
rs1045561613 1009 dbSNP
rs948600089 1009 dbSNP
rs1480016105 1010 dbSNP
rs1171087941 1011 dbSNP
rs1402459153 1012 dbSNP
rs1460348532 1013 dbSNP
rs1472689196 1013 dbSNP
rs1197682656 1016 dbSNP
rs1296524530 1016 dbSNP
rs1395807392 1018 dbSNP
rs151276707 1019 dbSNP
rs751645663 1019 dbSNP
rs866126347 1023 dbSNP
rs1305241397 1025 dbSNP
rs1011165060 1026 dbSNP
rs1031527911 1026 dbSNP
rs377467940 1026 dbSNP
rs78227667 1026 dbSNP
rs892819567 1026 dbSNP
rs1028033932 1031 dbSNP
rs953786374 1034 dbSNP
rs986731570 1036 dbSNP
rs1223349621 1040 dbSNP
rs1457485809 1045 dbSNP
rs1404861100 1047 dbSNP
rs1174805665 1048 dbSNP
rs570506891 1056 dbSNP
rs184938400 1057 dbSNP
rs1019091946 1058 dbSNP
rs1225794148 1059 dbSNP
rs1250301354 1066 dbSNP
rs947306213 1068 dbSNP
rs1043709606 1072 dbSNP
rs925279951 1073 dbSNP
rs1261486155 1075 dbSNP
rs1205747177 1079 dbSNP
rs1211089292 1079 dbSNP
rs1301665372 1080 dbSNP
rs972355699 1081 dbSNP
rs1359749849 1083 dbSNP
rs919475226 1084 dbSNP
rs1435179005 1085 dbSNP
rs930632993 1088 dbSNP
rs1334298190 1092 dbSNP
rs1490083971 1094 dbSNP
rs984787705 1095 dbSNP
rs1360133625 1098 dbSNP
rs1425416502 1098 dbSNP
rs781225545 1104 dbSNP
rs1426690836 1106 dbSNP
rs547657871 1106 dbSNP
rs1408756574 1109 dbSNP
rs79072548 1112 dbSNP
rs753250986 1113 dbSNP
rs1444102167 1114 dbSNP
rs1458510652 1115 dbSNP
rs1046000863 1116 dbSNP
rs1185685266 1116 dbSNP
rs1483671352 1116 dbSNP
rs189647876 1117 dbSNP
rs117152229 1118 dbSNP
rs1052976532 1120 dbSNP
rs1305761440 1120 dbSNP
rs376839226 1121 dbSNP
rs1404501513 1123 dbSNP
rs889341635 1124 dbSNP
rs1312221593 1126 dbSNP
rs1397467940 1127 dbSNP
rs1379405540 1133 dbSNP
rs751748368 1133 dbSNP
rs893018917 1133 dbSNP
rs1016505449 1135 dbSNP
rs961686713 1142 dbSNP
rs1011228703 1144 dbSNP
rs111970087 1148 dbSNP
rs1027930634 1151 dbSNP
rs1364476002 1156 dbSNP
rs1165519137 1159 dbSNP
rs1381046594 1160 dbSNP
rs1424654035 1161 dbSNP
rs889555719 1166 dbSNP
rs1479544736 1167 dbSNP
rs576315249 1167 dbSNP
rs1295559703 1174 dbSNP
rs1253624377 1177 dbSNP
rs1007994674 1182 dbSNP
rs1358615027 1191 dbSNP
rs993593682 1194 dbSNP
rs1246345085 1195 dbSNP
rs1322008090 1197 dbSNP
rs1288947052 1201 dbSNP
rs757427122 1204 dbSNP
rs966244070 1206 dbSNP
rs994032751 1207 dbSNP
rs1216832346 1212 dbSNP
rs769867090 1219 dbSNP
rs960074564 1221 dbSNP
rs1060186 1224 dbSNP
rs558732554 1232 dbSNP
rs915897312 1233 dbSNP
rs970440645 1233 dbSNP
rs1425470901 1236 dbSNP
rs981563439 1237 dbSNP
rs968587703 1245 dbSNP
rs1211503488 1246 dbSNP
rs978666552 1246 dbSNP
rs1488523143 1250 dbSNP
rs924560365 1251 dbSNP
rs539077868 1253 dbSNP
rs1185513058 1255 dbSNP
rs78979577 1257 dbSNP
rs1424300300 1258 dbSNP
rs1330751740 1259 dbSNP
rs745969749 1260 dbSNP
rs756314001 1261 dbSNP
rs1052883212 1262 dbSNP
rs1304071324 1263 dbSNP
rs914517011 1269 dbSNP
rs947285460 1271 dbSNP
rs1287141452 1273 dbSNP
rs142933812 1280 dbSNP
rs747837065 1281 dbSNP
rs1479994646 1282 dbSNP
rs923351280 1284 dbSNP
rs1200948462 1285 dbSNP
rs1260487554 1289 dbSNP
rs1202827621 1290 dbSNP
rs182281414 1293 dbSNP
rs902358711 1297 dbSNP
rs1050514149 1298 dbSNP
rs896894226 1302 dbSNP
rs574984555 1304 dbSNP
rs1312314473 1313 dbSNP
rs779498347 1317 dbSNP
rs889275996 1318 dbSNP
rs993700626 1322 dbSNP
rs1026472518 1328 dbSNP
rs952298370 1328 dbSNP
rs1006497834 1333 dbSNP
rs1381336484 1334 dbSNP
rs778966918 1335 dbSNP
rs542516997 1336 dbSNP
rs1174082800 1338 dbSNP
rs1240210119 1342 dbSNP
rs1372429512 1343 dbSNP
rs1186192355 1345 dbSNP
rs1285954900 1346 dbSNP
rs1023611567 1351 dbSNP
rs1248034100 1355 dbSNP
rs576013103 1357 dbSNP
rs1459663493 1358 dbSNP
rs1281228824 1360 dbSNP
rs1037899361 1364 dbSNP
rs898111699 1369 dbSNP
rs970092920 1370 dbSNP
rs1282858270 1371 dbSNP
rs373304896 1372 dbSNP
rs1231170739 1374 dbSNP
rs1227429847 1376 dbSNP
rs750194622 1378 dbSNP
rs1360923842 1380 dbSNP
rs760504662 1381 dbSNP
rs1285148059 1383 dbSNP
rs563718915 1385 dbSNP
rs1336014065 1386 dbSNP
rs1217674579 1387 dbSNP
rs1235562832 1389 dbSNP
rs956302968 1391 dbSNP
rs993152543 1392 dbSNP
rs988625891 1395 dbSNP
rs376315428 1398 dbSNP
rs1162352252 1403 dbSNP
rs1158141838 1404 dbSNP
rs753493063 1405 dbSNP
rs748167427 1406 dbSNP
rs1332578984 1407 dbSNP
rs1358895858 1412 dbSNP
rs914421143 1413 dbSNP
rs778223713 1414 dbSNP
rs1384558248 1416 dbSNP
rs752288834 1421 dbSNP
rs776128342 1422 dbSNP
rs771883392 1424 dbSNP
rs1351273068 1428 dbSNP
rs1225443131 1429 dbSNP
rs1276445692 1432 dbSNP
rs1441594194 1433 dbSNP
rs1204068301 1437 dbSNP
rs1245137335 1438 dbSNP
rs1249501281 1440 dbSNP
rs1049635746 1442 dbSNP
rs1364505655 1443 dbSNP
rs968535522 1445 dbSNP
rs763212160 1449 dbSNP
rs911096944 1449 dbSNP
rs1171292116 1452 dbSNP
rs73933053 1453 dbSNP
rs1422890109 1455 dbSNP
rs1371056173 1457 dbSNP
rs1470473769 1457 dbSNP
rs1179104529 1458 dbSNP
rs1041106641 1461 dbSNP
rs374081485 1462 dbSNP
rs777439971 1464 dbSNP
rs375931149 1467 dbSNP
rs764457209 1467 dbSNP
rs1327578232 1475 dbSNP
rs770110753 1476 dbSNP
rs1443784931 1478 dbSNP
rs1469262188 1479 dbSNP
rs73554721 1489 dbSNP
rs374418573 1490 dbSNP
rs528582318 1491 dbSNP
rs768953197 1492 dbSNP
rs1268787632 1494 dbSNP
rs1219938061 1497 dbSNP
rs1264850887 1498 dbSNP
rs1316266058 1500 dbSNP
rs1006353394 1501 dbSNP
rs1198190953 1502 dbSNP
rs1286271529 1503 dbSNP
rs1168571081 1504 dbSNP
rs774363910 1508 dbSNP
rs1439566470 1509 dbSNP
rs761927347 1510 dbSNP
rs759994202 1511 dbSNP
rs1246623920 1512 dbSNP
rs371359575 1513 dbSNP
rs1401697328 1518 dbSNP
rs771968234 1518 dbSNP
rs1385984387 1521 dbSNP
rs1202002310 1522 dbSNP
rs1421992676 1523 dbSNP
rs906099398 1528 dbSNP
rs149152357 1532 dbSNP
rs1036089865 1535 dbSNP
rs546651043 1536 dbSNP
rs1321083287 1539 dbSNP
rs367554415 1540 dbSNP
rs776493815 1542 dbSNP
rs568447393 1543 dbSNP
rs1405530684 1544 dbSNP
rs1285136242 1545 dbSNP
rs1338095343 1546 dbSNP
rs1226421645 1547 dbSNP
rs759074677 1548 dbSNP
rs1463765394 1549 dbSNP
rs751871974 1556 dbSNP
rs1208130274 1557 dbSNP
rs764968513 1558 dbSNP
rs1490650059 1559 dbSNP
rs536118420 1560 dbSNP
rs752235488 1561 dbSNP
rs1209524626 1565 dbSNP
rs933385818 1568 dbSNP
rs758046516 1570 dbSNP
rs1477662855 1571 dbSNP
rs910661386 1574 dbSNP
rs746602421 1576 dbSNP
rs548505409 1581 dbSNP
rs1369600815 1585 dbSNP
rs760358432 1586 dbSNP
rs187740309 1588 dbSNP
rs1364349322 1589 dbSNP
rs1424777612 1590 dbSNP
rs1304804857 1591 dbSNP
rs1358560846 1593 dbSNP
rs537271090 1594 dbSNP
rs376104611 1595 dbSNP
rs1328393340 1596 dbSNP
rs1457408777 1596 dbSNP
rs1242947619 1597 dbSNP
rs755132279 1598 dbSNP
rs766188629 1598 dbSNP
rs1314660946 1600 dbSNP
rs1360207824 1606 dbSNP
rs1186386846 1607 dbSNP
rs1224823913 1608 dbSNP
rs968530970 1610 dbSNP
rs929551284 1611 dbSNP
rs1485861876 1612 dbSNP
rs1056767075 1618 dbSNP
rs1461019490 1622 dbSNP
rs1198409124 1627 dbSNP
rs1206088324 1627 dbSNP
rs1264350349 1630 dbSNP
rs558800611 1631 dbSNP
rs368347215 1632 dbSNP
rs1384222832 1635 dbSNP
rs1444648007 1637 dbSNP
rs943935161 1638 dbSNP
rs753369619 1640 dbSNP
rs1279265634 1644 dbSNP
rs141208726 1644 dbSNP
rs374826439 1644 dbSNP
rs748134757 1644 dbSNP
rs760679253 1644 dbSNP
rs1299119772 1646 dbSNP
rs752624900 1646 dbSNP
rs773294799 1646 dbSNP
rs746854847 1648 dbSNP
rs758273908 1649 dbSNP
rs1453016378 1650 dbSNP
rs1435425892 1651 dbSNP
rs770935208 1652 dbSNP
rs1377951298 1653 dbSNP
rs368567172 1654 dbSNP
rs759428194 1657 dbSNP
rs1336248451 1658 dbSNP
rs201216690 1659 dbSNP
rs1248249060 1660 dbSNP
rs200491899 1661 dbSNP
rs777583571 1661 dbSNP
rs376997506 1662 dbSNP
rs1392154970 1663 dbSNP
rs368072860 1664 dbSNP
rs542153508 1665 dbSNP
rs1411876638 1667 dbSNP
rs766957695 1668 dbSNP
rs746827460 1669 dbSNP
rs1203444074 1671 dbSNP
rs1491248516 1672 dbSNP
rs1491130833 1673 dbSNP
rs754119613 1674 dbSNP
rs1377207369 1675 dbSNP
rs1482021831 1675 dbSNP
rs1464705897 1677 dbSNP
rs1184869733 1680 dbSNP
rs755439724 1682 dbSNP
rs977082861 1684 dbSNP
rs1418021451 1686 dbSNP
rs779096128 1688 dbSNP
rs748311659 1692 dbSNP
rs1003551664 1693 dbSNP
rs758624252 1695 dbSNP
rs777794945 1702 dbSNP
rs866828435 1703 dbSNP
rs1385985704 1707 dbSNP
rs563664489 1709 dbSNP
rs139997883 1710 dbSNP
rs757448677 1710 dbSNP
rs986125473 1713 dbSNP
rs139019209 1714 dbSNP
rs545955455 1715 dbSNP
rs372638469 1718 dbSNP
rs530113729 1719 dbSNP
rs200498126 1728 dbSNP
rs375958081 1729 dbSNP
rs199558821 1730 dbSNP
rs766789915 1731 dbSNP
rs374233814 1735 dbSNP
rs760050915 1736 dbSNP
rs1480002668 1740 dbSNP
rs753093200 1742 dbSNP
rs778021078 1743 dbSNP
rs144919021 1744 dbSNP
rs769333210 1745 dbSNP
rs1198413855 1746 dbSNP
rs1487890320 1748 dbSNP
rs368414227 1750 dbSNP
rs143345899 1751 dbSNP
rs779945430 1753 dbSNP
rs376818649 1754 dbSNP
rs749143632 1755 dbSNP
rs781432828 1756 dbSNP
rs200530826 1757 dbSNP
rs147535776 1758 dbSNP
rs1159232608 1759 dbSNP
rs745940870 1759 dbSNP
rs761216984 1761 dbSNP
rs769915982 1762 dbSNP
rs771554535 1763 dbSNP
rs371427990 1766 dbSNP
rs759997563 1768 dbSNP
rs765759569 1769 dbSNP
rs775443939 1771 dbSNP
rs1306609111 1772 dbSNP
rs753042240 1773 dbSNP
rs763350796 1775 dbSNP
rs1352650101 1776 dbSNP
rs764220707 1778 dbSNP
rs547082558 1779 dbSNP
rs757423138 1780 dbSNP
rs1481269706 1781 dbSNP
rs947765437 1782 dbSNP
rs138507073 1783 dbSNP
rs58170011 1784 dbSNP
rs199742436 1787 dbSNP
rs1029981285 1788 dbSNP
rs1458644268 1789 dbSNP
rs1161380306 1791 dbSNP
rs750487913 1793 dbSNP
rs756097316 1796 dbSNP
rs1363731352 1799 dbSNP
rs1424105644 1800 dbSNP
rs529335785 1803 dbSNP
rs1368026122 1811 dbSNP
rs749088387 1812 dbSNP
rs1270019006 1813 dbSNP
rs906047003 1816 dbSNP
rs1456965495 1818 dbSNP
rs548166472 1820 dbSNP
rs1158139483 1826 dbSNP
rs749734107 1827 dbSNP
rs778587766 1827 dbSNP
rs1386229408 1830 dbSNP
rs747771093 1833 dbSNP
rs1356554838 1834 dbSNP
rs771654094 1835 dbSNP
rs1264701132 1836 dbSNP
rs769068520 1841 dbSNP
rs775964034 1842 dbSNP
rs772730978 1843 dbSNP
rs1488634088 1844 dbSNP
rs1338659184 1846 dbSNP
rs569931453 1847 dbSNP
rs1017563129 1851 dbSNP
rs34566588 1869 dbSNP
rs1214116327 1875 dbSNP
rs4801859 1876 dbSNP
rs1331700410 1878 dbSNP
rs892040257 1881 dbSNP
rs973454204 1887 dbSNP
rs1233226646 1888 dbSNP
rs919386992 1890 dbSNP
rs950927833 1894 dbSNP
rs764454783 1896 dbSNP
rs1220482347 1902 dbSNP
rs1043021565 1905 dbSNP
rs904644770 1910 dbSNP
rs1447987284 1914 dbSNP
rs1458971907 1915 dbSNP
rs111915924 1918 dbSNP
rs1465541517 1919 dbSNP
rs570667912 1920 dbSNP
rs917459066 1921 dbSNP
rs1454334265 1923 dbSNP
rs1240934855 1926 dbSNP
rs762048341 1934 dbSNP
rs1044045376 1940 dbSNP
rs965589350 1944 dbSNP
rs1465961277 1948 dbSNP
rs376653887 1951 dbSNP
rs1249081990 1954 dbSNP
rs997994655 1955 dbSNP
rs925617051 1956 dbSNP
rs1025599195 1960 dbSNP
rs935686182 1961 dbSNP
rs1053262682 1962 dbSNP
rs1183687099 1966 dbSNP
rs1341569539 1967 dbSNP
rs767614642 1968 dbSNP
rs951273003 1969 dbSNP
rs998399793 1970 dbSNP
rs1437597335 1971 dbSNP
rs1422399180 1975 dbSNP
rs983810159 1980 dbSNP
rs750718225 1981 dbSNP
rs1304542629 1982 dbSNP
rs889662691 1984 dbSNP
rs534294919 1988 dbSNP
rs969060443 1994 dbSNP
rs1016842450 1995 dbSNP
rs553077547 1996 dbSNP
rs183507066 1997 dbSNP
rs1451020376 2000 dbSNP
rs535464324 2001 dbSNP
rs1385018827 2003 dbSNP
rs1243846982 2004 dbSNP
rs1057227211 2009 dbSNP
rs1351667979 2014 dbSNP
rs950841954 2016 dbSNP
rs993381089 2024 dbSNP
rs1272655344 2025 dbSNP
rs753119700 2028 dbSNP
rs1342882708 2030 dbSNP
rs970263244 2035 dbSNP
rs556558487 2036 dbSNP
rs575507116 2037 dbSNP
rs1242827757 2043 dbSNP
rs1446940043 2045 dbSNP
rs1204824438 2046 dbSNP
rs1244471275 2047 dbSNP
rs980342621 2050 dbSNP
rs926231401 2052 dbSNP
rs1396509545 2053 dbSNP
rs904549901 2054 dbSNP
rs1006852132 2055 dbSNP
rs1370601125 2060 dbSNP
rs1189086978 2066 dbSNP
rs935640416 2068 dbSNP
rs1211151453 2074 dbSNP
rs1470924545 2078 dbSNP
rs570241468 2081 dbSNP
rs1207828729 2089 dbSNP
rs1438494449 2091 dbSNP
rs901248695 2096 dbSNP
rs1156598924 2097 dbSNP
rs998465008 2104 dbSNP
rs1052800418 2107 dbSNP
rs1414991672 2108 dbSNP
rs1286386264 2109 dbSNP
rs1025461752 2110 dbSNP
rs1322270922 2113 dbSNP
rs764427291 2117 dbSNP
rs1403312077 2127 dbSNP
rs912949996 2129 dbSNP
rs1165121648 2132 dbSNP
rs1457045126 2138 dbSNP
rs1410160288 2139 dbSNP
rs112203859 2141 dbSNP
rs933760384 2141 dbSNP
rs780334489 2149 dbSNP
rs1403777799 2150 dbSNP
rs541182362 2151 dbSNP
rs1453602860 2152 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acgacaaUCGGGAUCGGGGCGu 5'
                 ||||| :|||::|| 
Target 5' ----accAGCCCCGGCCTTGCt 3'
1 - 18
2
miRNA  3' acGAC-AAUCGGGAUCGGGGCGU------- 5'
            :|| || | :||:|||:| |:       
Target 5' ccTTGCTTTG-TCTGGCCTCACGTGTCTCA 3'
12 - 40
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.659 7.9e-4 -0.695 3.4e-4 20 Click to see details
GSE28544 Breast cancer -0.479 8.9e-3 -0.695 8.2e-5 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.752 9.7e-3 0.550 6.2e-2 9 Click to see details
GSE21032 Prostate cancer -0.249 1.2e-2 -0.255 1.0e-2 83 Click to see details
GSE17498 Multiple myeloma 0.311 2.5e-2 0.358 1.2e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.372 3.4e-2 -0.311 6.5e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.145 2.1e-1 0.176 1.7e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.224 2.4e-1 0.196 2.7e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.134 2.6e-1 0.137 2.6e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.133 2.7e-1 0.068 3.8e-1 24 Click to see details
GSE19536 Breast cancer 0.06 2.8e-1 0.020 4.2e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer 0.128 3.0e-1 0.146 2.7e-1 20 Click to see details
GSE38226 Liver fibrosis 0.069 3.8e-1 0.086 3.6e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.021 4.3e-1 -0.046 3.6e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.023 4.6e-1 0.085 3.5e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.018 4.8e-1 -0.159 3.0e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.006 4.8e-1 -0.054 3.2e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.445 0.01 0.428 0.01 32 Click to see details
BLCA 0.441 0.03 0.304 0.11 18 Click to see details
HNSC 0.259 0.05 0.330 0.02 42 Click to see details
PCPG 0.981 0.06 1.000 0.5 3 Click to see details
PRAD 0.186 0.1 0.077 0.3 50 Click to see details
KICH -0.249 0.12 -0.125 0.28 25 Click to see details
UCEC -0.266 0.14 -0.242 0.16 19 Click to see details
COAD -0.43 0.14 -0.452 0.13 8 Click to see details
CESC -0.792 0.21 -0.500 0.33 3 Click to see details
LUAD 0.244 0.22 0.245 0.22 12 Click to see details
KIRC -0.087 0.24 -0.091 0.23 68 Click to see details
LUSC -0.11 0.26 -0.061 0.36 38 Click to see details
KIRP 0.113 0.27 -0.016 0.47 32 Click to see details
CHOL 0.234 0.27 0.017 0.48 9 Click to see details
THCA -0.056 0.34 -0.066 0.31 59 Click to see details
LIHC -0.051 0.36 -0.169 0.12 49 Click to see details
PAAD -0.219 0.39 -0.400 0.3 4 Click to see details
ESCA -0.081 0.41 -0.045 0.45 11 Click to see details
BRCA 0.003 0.49 0.005 0.48 84 Click to see details
BRCA 0.003 0.49 0.005 0.48 84 Click to see details
BRCA 0.003 0.49 0.005 0.48 84 Click to see details
412 hsa-miR-744-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016085 ARL15 ADP ribosylation factor like GTPase 15 1 1
MIRT016086 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 2
MIRT016087 PPTC7 PTC7 protein phosphatase homolog 2 3
MIRT016088 RASSF1 Ras association domain family member 1 1 1
MIRT016089 IER5 immediate early response 5 1 1
MIRT037383 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT037384 STAM2 signal transducing adaptor molecule 2 1 1
MIRT037385 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037386 DCXR dicarbonyl and L-xylulose reductase 1 1
MIRT037387 TSPAN17 tetraspanin 17 1 1
MIRT037388 ACTB actin beta 1 1
MIRT037389 HIST1H2BC histone cluster 1 H2B family member c 1 1
MIRT037390 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT037391 VDAC1 voltage dependent anion channel 1 1 1
MIRT037392 RNASEK ribonuclease K 1 1
MIRT037393 CDK16 cyclin dependent kinase 16 1 1
MIRT037394 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT037395 ARRDC2 arrestin domain containing 2 1 1
MIRT037396 SGMS1 sphingomyelin synthase 1 1 1
MIRT037397 HSPD1 heat shock protein family D (Hsp60) member 1 1 1
MIRT037398 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT037399 RHEB Ras homolog, mTORC1 binding 1 1
MIRT037400 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037401 TP53I13 tumor protein p53 inducible protein 13 1 1
MIRT037402 CD44 CD44 molecule (Indian blood group) 1 1
MIRT037403 USP12 ubiquitin specific peptidase 12 1 1
MIRT037404 AP2B1 adaptor related protein complex 2 beta 1 subunit 1 1
MIRT037405 RPL18A ribosomal protein L18a 1 1
MIRT037406 PPP1CA protein phosphatase 1 catalytic subunit alpha 1 1
MIRT037407 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT037408 PXK PX domain containing serine/threonine kinase like 1 1
MIRT037409 TDRKH tudor and KH domain containing 1 1
MIRT037410 PRRC2A proline rich coiled-coil 2A 1 1
MIRT037411 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT037412 NDE1 nudE neurodevelopment protein 1 1 1
MIRT037413 STK16 serine/threonine kinase 16 1 1
MIRT037414 PSMB2 proteasome subunit beta 2 1 1
MIRT037415 EPN1 epsin 1 1 1
MIRT037416 EN2 engrailed homeobox 2 1 1
MIRT037417 LARP1 La ribonucleoprotein domain family member 1 1 1
MIRT037418 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT037419 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT037420 AP2A2 adaptor related protein complex 2 alpha 2 subunit 1 1
MIRT037421 ACTG1 actin gamma 1 1 1
MIRT037422 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT037423 UBE2O ubiquitin conjugating enzyme E2 O 1 1
MIRT037424 KLHL15 kelch like family member 15 1 1
MIRT037425 SECISBP2 SECIS binding protein 2 1 1
MIRT037426 KIAA0922 transmembrane 131 like 1 1
MIRT037427 PTMA prothymosin, alpha 1 1
MIRT037428 WDR45B WD repeat domain 45B 1 1
MIRT037429 ZNF282 zinc finger protein 282 1 1
MIRT037430 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT037431 TNKS tankyrase 1 1
MIRT037432 NOP2 NOP2 nucleolar protein 1 1
MIRT037433 GAK cyclin G associated kinase 1 1
MIRT037434 ATP6 ATP synthase F0 subunit 6 1 1
MIRT037435 DIDO1 death inducer-obliterator 1 1 1
MIRT037436 RPL3 ribosomal protein L3 1 1
MIRT037437 AIMP2 aminoacyl tRNA synthetase complex interacting multifunctional protein 2 1 1
MIRT037438 PIGC phosphatidylinositol glycan anchor biosynthesis class C 1 1
MIRT037439 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT037440 USP21 ubiquitin specific peptidase 21 1 1
MIRT037441 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT037442 RPS6 ribosomal protein S6 1 1
MIRT037443 ILKAP ILK associated serine/threonine phosphatase 1 1
MIRT037444 COX1 cytochrome c oxidase subunit I 1 1
MIRT037445 VPS37C VPS37C, ESCRT-I subunit 1 1
MIRT037446 CDK12 cyclin dependent kinase 12 1 1
MIRT037447 RBM8A RNA binding motif protein 8A 1 1
MIRT037448 CKB creatine kinase B 1 1
MIRT037449 DHX57 DExH-box helicase 57 1 1
MIRT037450 DDX23 DEAD-box helicase 23 1 1
MIRT037451 ABI3 ABI family member 3 1 1
MIRT037452 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT037453 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT037454 C17orf70 Fanconi anemia core complex associated protein 100 1 1
MIRT037455 SKI SKI proto-oncogene 1 1
MIRT037456 KCTD11 potassium channel tetramerization domain containing 11 1 1
MIRT037457 GNB2L1 receptor for activated C kinase 1 1 1
MIRT037458 NCOA3 nuclear receptor coactivator 3 1 1
MIRT037459 PAK4 p21 (RAC1) activated kinase 4 2 3
MIRT037460 GDI2 GDP dissociation inhibitor 2 1 1
MIRT037461 SLC2A4RG SLC2A4 regulator 1 1
MIRT037462 SLX4 SLX4 structure-specific endonuclease subunit 1 1
MIRT037463 COPA coatomer protein complex subunit alpha 1 1
MIRT037464 GPRASP2 G protein-coupled receptor associated sorting protein 2 1 1
MIRT037465 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT037466 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT037467 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT037468 CAPNS1 calpain small subunit 1 1 1
MIRT037469 FRZB frizzled-related protein 1 1
MIRT037470 UBQLN4 ubiquilin 4 1 1
MIRT037471 NUP153 nucleoporin 153 1 1
MIRT037472 TMEM175 transmembrane protein 175 1 1
MIRT037473 HIST1H2BD histone cluster 1 H2B family member d 1 1
MIRT037474 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT037475 BCL2L12 BCL2 like 12 1 1
MIRT037476 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT037477 MINK1 misshapen like kinase 1 1 1
MIRT037478 PDXK pyridoxal kinase 1 1
MIRT037479 FAM110A family with sequence similarity 110 member A 1 1
MIRT037480 ZNF598 zinc finger protein 598 1 1
MIRT037481 ILK integrin linked kinase 1 1
MIRT037482 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT037483 WBP2 WW domain binding protein 2 1 1
MIRT037484 CYTB cytochrome b 1 1
MIRT037485 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT037486 TRIM33 tripartite motif containing 33 1 1
MIRT037487 SLC25A3 solute carrier family 25 member 3 1 1
MIRT037488 IRS4 insulin receptor substrate 4 1 1
MIRT037489 TSR1 TSR1, ribosome maturation factor 1 1
MIRT037490 TCOF1 treacle ribosome biogenesis factor 1 1 1
MIRT037491 ATXN2L ataxin 2 like 1 1
MIRT037492 MTOR mechanistic target of rapamycin kinase 1 1
MIRT037493 ZNF318 zinc finger protein 318 1 1
MIRT037494 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 3
MIRT037495 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT037496 STMN1 stathmin 1 1 1
MIRT037497 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT037498 SALL1 spalt like transcription factor 1 1 1
MIRT037499 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT037500 SLC35D1 solute carrier family 35 member D1 1 1
MIRT037501 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT037502 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT037503 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT037504 BAG6 BCL2 associated athanogene 6 1 1
MIRT037505 MED28 mediator complex subunit 28 1 1
MIRT037506 ANKRD52 ankyrin repeat domain 52 1 1
MIRT037507 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 1 1
MIRT037508 PPDPF pancreatic progenitor cell differentiation and proliferation factor 1 1
MIRT037509 PRKACA protein kinase cAMP-activated catalytic subunit alpha 1 1
MIRT037510 HPCAL4 hippocalcin like 4 1 1
MIRT037511 ZNF256 zinc finger protein 256 1 1
MIRT037512 CGNL1 cingulin like 1 1 1
MIRT037513 TUBA1B tubulin alpha 1b 1 1
MIRT037514 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT037515 PDE4A phosphodiesterase 4A 1 1
MIRT037516 HOXD11 homeobox D11 2 3
MIRT037517 QARS glutaminyl-tRNA synthetase 1 1
MIRT037518 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT037519 PLEKHM2 pleckstrin homology and RUN domain containing M2 1 1
MIRT037520 POLR2A RNA polymerase II subunit A 1 1
MIRT037521 KIAA1462 junctional cadherin 5 associated 1 1
MIRT037522 SF3A1 splicing factor 3a subunit 1 1 1
MIRT037523 YBX1 Y-box binding protein 1 1 1
MIRT037524 PTGES3 prostaglandin E synthase 3 1 1
MIRT037525 FOXO3 forkhead box O3 1 1
MIRT037526 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT037527 AARS alanyl-tRNA synthetase 1 1
MIRT037528 ZNF155 zinc finger protein 155 1 1
MIRT037529 NCS1 neuronal calcium sensor 1 1 1
MIRT037530 FKBP4 FK506 binding protein 4 1 1
MIRT037531 ARHGDIA Rho GDP dissociation inhibitor alpha 1 1
MIRT037532 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT037533 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT037534 HIST1H1E histone cluster 1 H1 family member e 1 1
MIRT037535 MLF2 myeloid leukemia factor 2 1 1
MIRT037536 EDC3 enhancer of mRNA decapping 3 1 1
MIRT037537 CHRAC1 chromatin accessibility complex 1 1 1
MIRT037538 WIPF3 WAS/WASL interacting protein family member 3 1 1
MIRT037539 COX2 cytochrome c oxidase subunit II 1 1
MIRT037540 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT037541 CTNNBIP1 catenin beta interacting protein 1 1 1
MIRT037542 RPL4 ribosomal protein L4 1 1
MIRT037543 COX3 cytochrome c oxidase III 1 1
MIRT037544 DDX54 DEAD-box helicase 54 1 1
MIRT037545 TOB2 transducer of ERBB2, 2 1 1
MIRT037546 MAN2C1 mannosidase alpha class 2C member 1 1 1
MIRT037547 SMCR7L mitochondrial elongation factor 1 1 1
MIRT037548 RPLP1 ribosomal protein lateral stalk subunit P1 1 1
MIRT037549 RAN RAN, member RAS oncogene family 1 1
MIRT037550 NONO non-POU domain containing octamer binding 1 1
MIRT037551 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT037552 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT037553 COLGALT1 collagen beta(1-O)galactosyltransferase 1 1 1
MIRT037554 MGRN1 mahogunin ring finger 1 1 1
MIRT037555 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT037556 TBX1 T-box 1 1 1
MIRT037557 NXPH4 neurexophilin 4 1 1
MIRT037558 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT037559 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT037560 KPNB1 karyopherin subunit beta 1 1 1
MIRT037561 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 1 1
MIRT037562 SYMPK symplekin 1 1
MIRT037563 SYPL1 synaptophysin like 1 1 1
MIRT037564 LRP3 LDL receptor related protein 3 1 1
MIRT037565 DDX24 DEAD-box helicase 24 1 1
MIRT037566 WDR37 WD repeat domain 37 1 1
MIRT037567 RPS14 ribosomal protein S14 1 1
MIRT037568 FAM53C family with sequence similarity 53 member C 1 1
MIRT037569 NMT1 N-myristoyltransferase 1 1 1
MIRT037570 PAGR1 PAXIP1 associated glutamate rich protein 1 1 1
MIRT037571 AKT2 AKT serine/threonine kinase 2 1 1
MIRT037572 TMEM14C transmembrane protein 14C 1 1
MIRT037573 MEX3D mex-3 RNA binding family member D 1 1
MIRT037574 BRAF B-Raf proto-oncogene, serine/threonine kinase 1 1
MIRT037575 POLR2L RNA polymerase II subunit L 1 1
MIRT037576 SERP1 stress associated endoplasmic reticulum protein 1 1 1
MIRT037577 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT037578 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT037579 POLD3 DNA polymerase delta 3, accessory subunit 1 1
MIRT037580 HMGA1 high mobility group AT-hook 1 1 1
MIRT037581 SLC35B4 solute carrier family 35 member B4 1 1
MIRT037582 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT037583 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 1 1
MIRT037584 RPL7A ribosomal protein L7a 1 1
MIRT037585 LAIR1 leukocyte associated immunoglobulin like receptor 1 1 1
MIRT037586 RPL10 ribosomal protein L10 1 1
MIRT037587 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT037588 SRM spermidine synthase 1 1
MIRT037589 EIF3K eukaryotic translation initiation factor 3 subunit K 1 1
MIRT037590 DESI1 desumoylating isopeptidase 1 1 1
MIRT037591 BET1 Bet1 golgi vesicular membrane trafficking protein 1 1
MIRT037592 HTRA2 HtrA serine peptidase 2 1 1
MIRT037593 LARP6 La ribonucleoprotein domain family member 6 1 1
MIRT037594 NOTCH2 notch 2 1 1
MIRT037595 ADCY9 adenylate cyclase 9 1 1
MIRT037596 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT037597 FBXL19 F-box and leucine rich repeat protein 19 1 1
MIRT037598 L3MBTL2 L3MBTL2, polycomb repressive complex 1 subunit 1 1
MIRT037599 TRIM28 tripartite motif containing 28 1 1
MIRT037600 LGALS3 galectin 3 1 1
MIRT037601 IGSF8 immunoglobulin superfamily member 8 1 1
MIRT037602 LIN37 lin-37 DREAM MuvB core complex component 1 1
MIRT037603 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT037604 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT037605 TRMT2A tRNA methyltransferase 2 homolog A 1 1
MIRT037606 DVL1 dishevelled segment polarity protein 1 1 1
MIRT037607 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 1 1
MIRT037608 TOR2A torsin family 2 member A 1 1
MIRT037609 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT037610 SMYD4 SET and MYND domain containing 4 1 1
MIRT037611 TJAP1 tight junction associated protein 1 1 1
MIRT037612 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT037613 PPM1M protein phosphatase, Mg2+/Mn2+ dependent 1M 1 1
MIRT037614 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT037615 GFER growth factor, augmenter of liver regeneration 1 1
MIRT037616 PKP2 plakophilin 2 1 1
MIRT037617 FARSB phenylalanyl-tRNA synthetase beta subunit 1 1
MIRT037618 OPRD1 opioid receptor delta 1 1 1
MIRT037619 CCNY cyclin Y 1 1
MIRT037620 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT037621 CXCL16 C-X-C motif chemokine ligand 16 1 1
MIRT037622 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT037623 DDX11 DEAD/H-box helicase 11 1 1
MIRT037624 URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 1 1
MIRT037625 SBF1 SET binding factor 1 1 1
MIRT037626 GNB2 G protein subunit beta 2 1 1
MIRT037627 KMT2D lysine methyltransferase 2D 2 3
MIRT037628 DDX17 DEAD-box helicase 17 1 1
MIRT037629 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT037630 TAPBP TAP binding protein 1 1
MIRT037631 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT037632 RPL18 ribosomal protein L18 1 1
MIRT037633 INTS3 integrator complex subunit 3 1 1
MIRT037634 CDC25B cell division cycle 25B 1 1
MIRT037635 LDOC1L retrotransposon Gag like 6 1 1
MIRT037636 TUB tubby bipartite transcription factor 1 1
MIRT037637 NUDT2 nudix hydrolase 2 1 1
MIRT037638 CDAN1 codanin 1 1 1
MIRT037639 MRS2 MRS2, magnesium transporter 1 1
MIRT037640 PYGB glycogen phosphorylase B 1 1
MIRT037641 LDLRAD3 low density lipoprotein receptor class A domain containing 3 1 1
MIRT037642 COL5A1 collagen type V alpha 1 chain 1 1
MIRT037643 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT037644 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT037645 ZNF212 zinc finger protein 212 1 1
MIRT037646 TSC2 TSC complex subunit 2 1 1
MIRT037647 FASN fatty acid synthase 1 1
MIRT037648 NOL9 nucleolar protein 9 1 1
MIRT037649 CLUH clustered mitochondria homolog 1 1
MIRT037650 PHF8 PHD finger protein 8 1 1
MIRT037651 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 1 1
MIRT037652 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT037653 HOXC11 homeobox C11 1 1
MIRT037654 DGCR14 ess-2 splicing factor homolog 1 1
MIRT037655 SLC25A1 solute carrier family 25 member 1 1 1
MIRT037656 MEX3C mex-3 RNA binding family member C 1 1
MIRT037657 RAI1 retinoic acid induced 1 1 1
MIRT037658 LY6E lymphocyte antigen 6 family member E 1 1
MIRT037659 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT037660 RPL37 ribosomal protein L37 1 1
MIRT037661 CNN2 calponin 2 1 1
MIRT037662 ALDH18A1 aldehyde dehydrogenase 18 family member A1 1 1
MIRT037663 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 1 1
MIRT037664 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT037665 PIM3 Pim-3 proto-oncogene, serine/threonine kinase 1 1
MIRT037666 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT037667 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT037668 ART5 ADP-ribosyltransferase 5 1 1
MIRT037669 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT037670 NCL nucleolin 1 1
MIRT037671 NCKAP5L NCK associated protein 5 like 1 1
MIRT037672 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT037673 CCDC71 coiled-coil domain containing 71 1 1
MIRT037674 SURF4 surfeit 4 1 1
MIRT037675 RPL13 ribosomal protein L13 1 1
MIRT037676 ACTN4 actinin alpha 4 1 1
MIRT037677 PA2G4 proliferation-associated 2G4 1 1
MIRT037678 MIF macrophage migration inhibitory factor 1 1
MIRT037679 UBE2N ubiquitin conjugating enzyme E2 N 1 1
MIRT037680 LYNX1 Ly6/neurotoxin 1 1 1
MIRT037681 TACC3 transforming acidic coiled-coil containing protein 3 1 1
MIRT037682 GSR glutathione-disulfide reductase 1 1
MIRT037683 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT037684 ZMYM3 zinc finger MYM-type containing 3 1 1
MIRT037685 ERP29 endoplasmic reticulum protein 29 1 1
MIRT037686 MATR3 matrin 3 1 1
MIRT037687 FANCG Fanconi anemia complementation group G 1 1
MIRT037688 FAM83G family with sequence similarity 83 member G 1 1
MIRT037689 DUSP18 dual specificity phosphatase 18 1 1
MIRT037690 MYC MYC proto-oncogene, bHLH transcription factor 3 2
MIRT037691 TSPAN7 tetraspanin 7 1 1
MIRT037692 ATMIN ATM interactor 1 1
MIRT037693 SEPT2 septin 2 1 1
MIRT037694 FOXRED2 FAD dependent oxidoreductase domain containing 2 1 1
MIRT037695 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT037696 MRPL11 mitochondrial ribosomal protein L11 1 1
MIRT037697 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT037698 PSMD4 proteasome 26S subunit, non-ATPase 4 1 1
MIRT037699 SH3GL1 SH3 domain containing GRB2 like 1, endophilin A2 1 1
MIRT037700 CTNNB1 catenin beta 1 1 1
MIRT037701 TMEM189 transmembrane protein 189 1 1
MIRT037702 LDLR low density lipoprotein receptor 1 1
MIRT037703 OGFR opioid growth factor receptor 1 1
MIRT037704 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT037705 LIPA lipase A, lysosomal acid type 1 1
MIRT037706 SNAPC4 small nuclear RNA activating complex polypeptide 4 1 1
MIRT037707 FBN2 fibrillin 2 1 1
MIRT037708 ZNF704 zinc finger protein 704 1 1
MIRT037709 EIF3M eukaryotic translation initiation factor 3 subunit M 1 1
MIRT037710 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT037711 FZR1 fizzy and cell division cycle 20 related 1 1 1
MIRT037712 NANOS1 nanos C2HC-type zinc finger 1 1 1
MIRT037713 PRR12 proline rich 12 1 1
MIRT037714 PHC2 polyhomeotic homolog 2 1 1
MIRT037715 NOP9 NOP9 nucleolar protein 1 1
MIRT037716 HM13 histocompatibility minor 13 1 1
MIRT037717 PRDX5 peroxiredoxin 5 1 1
MIRT037718 IRGQ immunity related GTPase Q 1 1
MIRT037719 TGFB1 transforming growth factor beta 1 7 2
MIRT037720 MARCH3 membrane associated ring-CH-type finger 3 1 1
MIRT037721 TBX2 T-box 2 1 1
MIRT037722 TSC22D3 TSC22 domain family member 3 1 1
MIRT037723 DUT deoxyuridine triphosphatase 1 1
MIRT037724 FAM171A2 family with sequence similarity 171 member A2 1 1
MIRT037725 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT037726 FRAT1 FRAT1, WNT signaling pathway regulator 1 1
MIRT037727 PSMD11 proteasome 26S subunit, non-ATPase 11 1 1
MIRT037728 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT037729 ENO1 enolase 1 1 1
MIRT037730 AP3D1 adaptor related protein complex 3 delta 1 subunit 1 1
MIRT037731 TUBA1A tubulin alpha 1a 1 1
MIRT037732 ULK3 unc-51 like kinase 3 1 1
MIRT037733 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT037734 SLC25A46 solute carrier family 25 member 46 1 1
MIRT037735 MED15 mediator complex subunit 15 1 1
MIRT037736 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT037737 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT037738 ATHL1 protein-glucosylgalactosylhydroxylysine glucosidase 1 1
MIRT037739 CTNNA1 catenin alpha 1 1 1
MIRT037740 ADRM1 adhesion regulating molecule 1 1 1
MIRT037741 CCDC106 coiled-coil domain containing 106 1 1
MIRT054493 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 3 1
MIRT451195 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 2 2
MIRT452931 DISC1 disrupted in schizophrenia 1 2 2
MIRT455468 LYPLA2 lysophospholipase II 2 2
MIRT457068 TOR4A torsin family 4 member A 2 2
MIRT464195 VGLL4 vestigial like family member 4 2 4
MIRT483030 KHSRP KH-type splicing regulatory protein 2 4
MIRT486062 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT486120 INO80E INO80 complex subunit E 2 2
MIRT486866 DPF1 double PHD fingers 1 2 2
MIRT488343 PAX2 paired box 2 2 2
MIRT488790 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT490249 MFI2 melanotransferrin 2 2
MIRT490264 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT490756 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT492321 SETD1B SET domain containing 1B 2 2
MIRT492851 NRGN neurogranin 2 2
MIRT499604 ANKRD45 ankyrin repeat domain 45 2 2
MIRT500189 BARX1 BARX homeobox 1 2 4
MIRT516765 FAM212B family with sequence similarity 212 member B 2 4
MIRT517949 TRIM59 tripartite motif containing 59 2 2
MIRT521182 SCAF4 SR-related CTD associated factor 4 2 2
MIRT526462 OSBPL5 oxysterol binding protein like 5 2 2
MIRT535148 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT569528 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT570593 NFIX nuclear factor I X 2 2
MIRT571219 F2R coagulation factor II thrombin receptor 2 2
MIRT574145 MARVELD1 MARVEL domain containing 1 2 2
MIRT608758 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT649509 RAB17 RAB17, member RAS oncogene family 2 2
MIRT692165 RNF207 ring finger protein 207 2 2
MIRT703495 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT711081 NEUROD2 neuronal differentiation 2 2 2
MIRT712090 UNC13A unc-13 homolog A 2 2
MIRT712531 CYTH2 cytohesin 2 2 2
MIRT712755 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT712893 TGFA transforming growth factor alpha 2 2
MIRT714684 PRX periaxin 2 2
MIRT714723 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714814 NOB1 NIN1/PSMD8 binding protein 1 homolog 2 2
MIRT716774 C1orf229 chromosome 1 open reading frame 229 2 2
MIRT717511 HRNR hornerin 2 2
MIRT717653 THBS2 thrombospondin 2 2 2
MIRT719595 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT720525 PTGR2 prostaglandin reductase 2 2 2
MIRT724925 VPS18 VPS18, CORVET/HOPS core subunit 2 2
MIRT737146 NOS3 nitric oxide synthase 3 1 0
MIRT756003 SLC7A5 solute carrier family 7 member 5 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-744 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-744 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-744 Ursodeoxycholic acid (UDCA) approved 31401 Microarray rat Liver 20689055 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-744 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-744 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-744 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-744-5p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-744-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-744-5p 5,7-dibromo-2-[(e)-2-(4-hydroxy-3-methoxyphenyl)ethenyl]quinolin-8-ol 135460261 NSC67090 sensitive
hsa-miR-744-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-744-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-744-5p Paullone analog 47 396411 NSC702373 sensitive
hsa-miR-744-5p Ursa-11,13(18)-dien-28-oic acid-3.beta.-ol 378695 NSC661747 sensitive
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-744-5p Carboplatin 38904 NSC241240 approved sensitive High Ovarian Cancer tissue and cell line (MDAH-2274, SKOV3)
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-744-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-744-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-744-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma tissue
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-744-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-744-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-744-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-744-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)

Error report submission