miRTarBase - #MIRT037714


—
pre-miRNA Information
pre-miRNA hsa-mir-744   
Genomic Coordinates chr17: 12081899 - 12081996
Synonyms MIRN744, hsa-mir-744, MIR744
Description Homo sapiens miR-744 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-744-5p
Sequence 11| UGCGGGGCUAGGGCUAACAGCA |32
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN23015028 1 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs557969425 1 dbSNP
rs748252260 4 dbSNP
rs1470408501 7 dbSNP
rs1178657616 10 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6B8SM miR-744-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol PHC2   
Synonyms EDR2, HPH2, PH2
Description polyhomeotic homolog 2
Transcript NM_004427   
Other Transcripts NM_198040   
Expression
Putative miRNA Targets on PHC2
3'UTR of PHC2
(miRNA target sites are highlighted)		 
>PHC2|NM_004427|3'UTR
   1 GGCTGGTGGCAGCCAGGATTCTGGCCCAGGGCGCCTCCTCCCGACTGAGCAGAGCCAGACAGACATTCCTGAGGGGCCCA
  81 GAAATGGGGCCGGTTGGAGGGCAGGGGCTCTCCCTAGGGGCATAGCTGGTGAGGAGGTCTGGGCACCTCCTCCATGGCTC
 161 TCAGGGGCCTTTCATTTCTGTGGGAGGGGCAGAGAGGTAGGTGGCACAGAAGATGGGGCTTTATGCTTGTAAATATTGAT
 241 AGCACTGGCTTCCTCCAAAGTCCCAATACTCTAGCCCCGCTCTCTTCCCCTCTTTCTGTCCCCCATTTTCCAGGGGGTAT
 321 ATGGTCAGGGCTCCCCAACCTGAGTTGGGTTACTTCAAGGGCAGCCAGCAGGCCTGGATGGAGGCCTAGAAAGCCCTTGC
 401 CTTCCTTCCTCCCACTTCTTTCTCCAGGCCTGGTTAACTCTTCCGTTGTCAGCTTCTCCCCCTTCAGCCTGTTTCTGCAG
 481 CAGCCAGGGTTCTCCCCCCTACACCCTCTGCAGGTGGAGAGAGAGAAGCTGGGCCCAGCCGGGCCGTGCCTGCTGGCACA
 561 GACGCCTTAACGCTGTGTGTATGACTGTGTGACTGTGTGGGAGCCTGGACTGACAGATAGGCCAAGGGCTACTCTCTGGC
 641 ATCTCCAGGTGTTTTGTAGCAAACAGCCACTTAGTGCTTTGTCCTGGACTCCACTCAGCCTCAGGATGGGGAATAGCCAA
 721 GAATGGCAGCCTCAGCGCAGAGGCAAGGTCAGAAAGAGACGGCGCTTCAGAGTTTCCTTTCCAGACACCCCTCCCCGCAC
 801 TGTGAAGTTCCCCTGACCGCCCTCCTGGTTCACAAAGAGCATTAAGAAAGCTGCGGTGGTCTGAGCAACATAGCCCAAAG
 881 GGCTGAGCCTCCTGGCCTGCCTGCCCGCCCACCCTGGGAGTCCCAGTGGTGAGGCTCAGAGAACTGCTAAGGGGAAAGAA
 961 CAGCTGGAGTTTCTGTTGATGTGAAGAAGGCAGCTCTTGGCCTCCCACTCCCACACTTCTTTGCCTATAAATCTTCCTAG
1041 CAGCAATTTGAGCTACCTGAGGAGGAGGCAGGGCAGAAAGGGCGAGGGCCTGCCTCTGACCTGCCGTGTCCTTTGCAGGA
1121 AGGAGGTAGGCACCTTTCTGAGCTTATTCTATTCCCCACCCACACCCCCAGGCAGGGTTGGAAATGAAGGACTTTTTTAA
1201 CCTTTGTTTTGTTTTTTAAAAATAAATCTGTAAAATCTGTCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acgacaAUCGGGAUCGGGGCGu 5'
                || |:|||||||||| 
Target 5' tcccaaTA-CTCTAGCCCCGCt 3'
 261 - 281 163.00 -24.70
2 
miRNA  3' acGACAAUCGGGAUCGGGGCGu 5'
            | |  | ||||  |||||| 
Target 5' tcCAGACACCCCT--CCCCGCa 3'
 780 - 799 127.00 -19.50
3 
miRNA  3' acgacaaUCGGGAUCGGGGCGu 5'
                 || |: :|||| || 
Target 5' agagagaAG-CTGGGCCCAGCc 3'
 520 - 540 114.00 -17.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31594027 5 COSMIC
COSN31510063 21 COSMIC
COSN30151135 29 COSMIC
COSN26988797 33 COSMIC
COSN28637244 43 COSMIC
COSN13539636 55 COSMIC
COSN30131690 91 COSMIC
COSN30134250 92 COSMIC
COSN30473767 113 COSMIC
COSN31530959 274 COSMIC
COSN30106370 279 COSMIC
COSN31481973 342 COSMIC
COSN24297427 369 COSMIC
COSN31516565 422 COSMIC
COSN16127690 525 COSMIC
COSN16127536 583 COSMIC
COSN30539931 622 COSMIC
COSN31597172 736 COSMIC
COSN17236566 797 COSMIC
COSN23014332 828 COSMIC
COSN23310041 891 COSMIC
COSN23014331 946 COSMIC
COSN6034108 973 COSMIC
COSN30161191 1059 COSMIC
COSN6453928 1084 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374127538 3 dbSNP
rs781478343 3 dbSNP
rs755311093 7 dbSNP
rs145458937 10 dbSNP
rs141285527 17 dbSNP
rs1235930969 26 dbSNP
rs372657676 30 dbSNP
rs752325255 32 dbSNP
rs969520283 33 dbSNP
rs918043694 36 dbSNP
rs781762028 37 dbSNP
rs999622512 38 dbSNP
rs1414193660 39 dbSNP
rs755486479 41 dbSNP
rs190291963 42 dbSNP
rs751750944 42 dbSNP
rs376969728 43 dbSNP
rs1171027707 45 dbSNP
rs1396608910 47 dbSNP
rs369725555 48 dbSNP
rs1186634863 65 dbSNP
rs1430229905 71 dbSNP
rs1257536372 83 dbSNP
rs916874663 91 dbSNP
rs1014937711 92 dbSNP
rs760743953 93 dbSNP
rs1320296031 105 dbSNP
rs1291623455 108 dbSNP
rs1232791210 110 dbSNP
rs554446830 116 dbSNP
rs939560192 117 dbSNP
rs147830016 120 dbSNP
rs928154848 122 dbSNP
rs1474107218 132 dbSNP
rs1466949112 133 dbSNP
rs983555526 144 dbSNP
rs1163723912 146 dbSNP
rs775778744 147 dbSNP
rs1472869788 166 dbSNP
rs1259828569 168 dbSNP
rs1190302024 172 dbSNP
rs1211894815 173 dbSNP
rs750642528 175 dbSNP
rs772327983 177 dbSNP
rs571819948 188 dbSNP
rs1417866840 194 dbSNP
rs1238050929 195 dbSNP
rs1482880427 196 dbSNP
rs1459344734 203 dbSNP
rs996047496 205 dbSNP
rs1209450739 212 dbSNP
rs144481598 213 dbSNP
rs951137151 229 dbSNP
rs918333714 233 dbSNP
rs537810146 236 dbSNP
rs1309840509 248 dbSNP
rs1312638829 253 dbSNP
rs1368489720 257 dbSNP
rs774445528 264 dbSNP
rs1018213971 274 dbSNP
rs891680129 278 dbSNP
rs1054079098 279 dbSNP
rs1156326499 279 dbSNP
rs1414981600 280 dbSNP
rs935651035 281 dbSNP
rs567653185 285 dbSNP
rs1251512644 287 dbSNP
rs1295937869 288 dbSNP
rs1198514633 290 dbSNP
rs1386781550 293 dbSNP
rs1452424731 296 dbSNP
rs1292238213 301 dbSNP
rs1044132221 305 dbSNP
rs949764959 311 dbSNP
rs878900127 312 dbSNP
rs1203503522 314 dbSNP
rs1463084613 316 dbSNP
rs1353040424 317 dbSNP
rs1354974192 318 dbSNP
rs767805433 318 dbSNP
rs918110046 319 dbSNP
rs992705248 321 dbSNP
rs549060627 325 dbSNP
rs940979905 334 dbSNP
rs527818052 338 dbSNP
rs1274034565 340 dbSNP
rs902642412 345 dbSNP
rs1044193739 349 dbSNP
rs1419735436 361 dbSNP
rs984826619 362 dbSNP
rs1010936802 394 dbSNP
rs1381208439 396 dbSNP
rs1360586135 401 dbSNP
rs952019989 403 dbSNP
rs78590355 409 dbSNP
rs974828605 418 dbSNP
rs939620088 420 dbSNP
rs966505015 420 dbSNP
rs771379383 422 dbSNP
rs1047922104 429 dbSNP
rs1488038498 440 dbSNP
rs1010473424 442 dbSNP
rs1481017109 444 dbSNP
rs918363526 445 dbSNP
rs1277780340 452 dbSNP
rs1212338469 458 dbSNP
rs974209302 461 dbSNP
rs1485429015 486 dbSNP
rs1274188809 489 dbSNP
rs1228232169 492 dbSNP
rs1299509382 496 dbSNP
rs1340672896 496 dbSNP
rs1130800 498 dbSNP
rs955278540 499 dbSNP
rs1029584298 500 dbSNP
rs150601150 502 dbSNP
rs1477620995 506 dbSNP
rs1000034975 507 dbSNP
rs1195971920 516 dbSNP
rs1392587228 523 dbSNP
rs1373457557 524 dbSNP
rs576456338 525 dbSNP
rs1022402985 529 dbSNP
rs1236882676 530 dbSNP
rs1011426106 533 dbSNP
rs1270626192 538 dbSNP
rs895204067 539 dbSNP
rs1034104793 540 dbSNP
rs757432775 541 dbSNP
rs1165305110 545 dbSNP
rs185835192 546 dbSNP
rs1377785963 548 dbSNP
rs149464849 551 dbSNP
rs544507286 552 dbSNP
rs201943063 558 dbSNP
rs528839372 561 dbSNP
rs181577469 563 dbSNP
rs1419946390 564 dbSNP
rs191806595 571 dbSNP
rs574162316 572 dbSNP
rs899345309 575 dbSNP
rs1037843372 584 dbSNP
rs1173066380 584 dbSNP
rs1474300218 586 dbSNP
rs41265889 587 dbSNP
rs910936017 588 dbSNP
rs908150921 595 dbSNP
rs1473743003 600 dbSNP
rs985050844 604 dbSNP
rs1231052793 615 dbSNP
rs1177813941 616 dbSNP
rs1458023800 618 dbSNP
rs1211426915 621 dbSNP
rs763020050 621 dbSNP
rs1320662956 629 dbSNP
rs1289977932 633 dbSNP
rs1229480579 635 dbSNP
rs1349028181 638 dbSNP
rs554385564 647 dbSNP
rs545235615 649 dbSNP
rs930845598 658 dbSNP
rs578130146 661 dbSNP
rs1446570877 663 dbSNP
rs373499655 666 dbSNP
rs377509988 666 dbSNP
rs1240719849 673 dbSNP
rs1333695751 686 dbSNP
rs1456584089 687 dbSNP
rs921948465 689 dbSNP
rs1317185776 694 dbSNP
rs1302057639 697 dbSNP
rs977985973 698 dbSNP
rs754720941 699 dbSNP
rs187569669 702 dbSNP
rs1239776430 704 dbSNP
rs1191443817 711 dbSNP
rs1487962100 713 dbSNP
rs911947275 724 dbSNP
rs1246879477 730 dbSNP
rs1223170951 734 dbSNP
rs766013837 737 dbSNP
rs966594577 742 dbSNP
rs988700695 743 dbSNP
rs956059312 746 dbSNP
rs1434022586 760 dbSNP
rs1032767292 761 dbSNP
rs1000086727 763 dbSNP
rs1382480241 770 dbSNP
rs554269659 772 dbSNP
rs1367203235 777 dbSNP
rs77061281 779 dbSNP
rs1438764865 787 dbSNP
rs959760238 789 dbSNP
rs1382034070 793 dbSNP
rs11061 796 dbSNP
rs1377337238 797 dbSNP
rs1432346533 799 dbSNP
rs1003528294 811 dbSNP
rs1014317298 812 dbSNP
rs1171786747 813 dbSNP
rs375043378 818 dbSNP
rs1037179028 819 dbSNP
rs1488914336 823 dbSNP
rs10914683 828 dbSNP
rs566600059 834 dbSNP
rs1264267456 837 dbSNP
rs1302316910 840 dbSNP
rs1049236752 847 dbSNP
rs930897443 855 dbSNP
rs1485983655 857 dbSNP
rs1297674560 858 dbSNP
rs551477713 862 dbSNP
rs532946717 865 dbSNP
rs569039697 870 dbSNP
rs943549498 875 dbSNP
rs1130804 878 dbSNP
rs1177884388 879 dbSNP
rs1476641380 882 dbSNP
rs1303567965 885 dbSNP
rs1049494612 887 dbSNP
rs1226560290 888 dbSNP
rs1324682385 898 dbSNP
rs912015919 906 dbSNP
rs1212615019 907 dbSNP
rs180749558 907 dbSNP
rs1297435491 919 dbSNP
rs1277764440 924 dbSNP
rs1382580741 935 dbSNP
rs922281328 936 dbSNP
rs989303269 944 dbSNP
rs5861 946 dbSNP
rs11804225 947 dbSNP
rs878979882 948 dbSNP
rs1402751817 952 dbSNP
rs978551106 953 dbSNP
rs11554673 956 dbSNP
rs1463827094 958 dbSNP
rs959221964 960 dbSNP
rs113937952 964 dbSNP
rs545886086 966 dbSNP
rs1366200983 968 dbSNP
rs578108068 984 dbSNP
rs1186148442 986 dbSNP
rs1423761750 993 dbSNP
rs1257420119 1003 dbSNP
rs556754552 1004 dbSNP
rs375411424 1007 dbSNP
rs1257723517 1008 dbSNP
rs1013952546 1014 dbSNP
rs1194260707 1016 dbSNP
rs1341651343 1022 dbSNP
rs538901843 1025 dbSNP
rs767684729 1027 dbSNP
rs1244087684 1030 dbSNP
rs1341022679 1032 dbSNP
rs1256304942 1036 dbSNP
rs1444362312 1040 dbSNP
rs544559991 1041 dbSNP
rs1015222426 1046 dbSNP
rs1004390454 1048 dbSNP
rs1331706575 1050 dbSNP
rs574020244 1052 dbSNP
rs555659975 1054 dbSNP
rs964007329 1057 dbSNP
rs1162153808 1059 dbSNP
rs533900074 1062 dbSNP
rs1457934754 1069 dbSNP
rs1016510893 1071 dbSNP
rs566538845 1075 dbSNP
rs1280411031 1076 dbSNP
rs889274101 1077 dbSNP
rs189404681 1080 dbSNP
rs539972500 1083 dbSNP
rs7264 1084 dbSNP
rs944943185 1091 dbSNP
rs1012863744 1099 dbSNP
rs752450150 1102 dbSNP
rs911898419 1103 dbSNP
rs1053097110 1105 dbSNP
rs550786353 1106 dbSNP
rs926018757 1107 dbSNP
rs1352814216 1108 dbSNP
rs547734759 1114 dbSNP
rs1448663310 1117 dbSNP
rs1356417152 1122 dbSNP
rs1329027355 1126 dbSNP
rs184450560 1127 dbSNP
rs568335546 1130 dbSNP
rs774082687 1131 dbSNP
rs1130837 1138 dbSNP
rs372251158 1138 dbSNP
rs111283937 1141 dbSNP
rs3190166 1149 dbSNP
rs1295732958 1151 dbSNP
rs926468979 1154 dbSNP
rs1399209189 1157 dbSNP
rs527708960 1166 dbSNP
rs1397309962 1167 dbSNP
rs970787368 1170 dbSNP
rs1198405086 1171 dbSNP
rs546925563 1176 dbSNP
rs1416101107 1177 dbSNP
rs1271149838 1199 dbSNP
rs919338231 1200 dbSNP
rs1190595215 1204 dbSNP
rs770999295 1211 dbSNP
rs1286598980 1214 dbSNP
rs147556764 1216 dbSNP
rs963399252 1216 dbSNP
rs1016954736 1218 dbSNP
rs1015690449 1223 dbSNP
rs982457683 1228 dbSNP
rs1346938046 1236 dbSNP
rs952465277 1237 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.423 3.2e-2 -0.534 7.6e-3 20 Click to see details
GSE17498 Multiple myeloma 0.292 3.4e-2 0.371 9.2e-3 40 Click to see details
GSE28544 Breast cancer -0.365 4.0e-2 -0.498 6.6e-3 24 Click to see details
GSE19783 ER- ER- breast cancer -0.18 5.6e-2 -0.210 3.2e-2 79 Click to see details
GSE19536 Breast cancer -0.139 8.4e-2 -0.176 4.0e-2 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.281 1.2e-1 -0.149 2.7e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.224 1.5e-1 0.309 7.6e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.187 1.5e-1 0.297 4.9e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.197 1.7e-1 0.180 1.9e-1 25 Click to see details
GSE28260 Renal cortex and medulla 0.281 1.8e-1 0.099 3.7e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.273 2.0e-1 0.273 2.0e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.165 2.2e-1 0.121 2.9e-1 24 Click to see details
GSE21032 Prostate cancer -0.079 2.4e-1 -0.146 9.4e-2 83 Click to see details
GSE21687 Ependynoma primary tumors -0.056 3.3e-1 -0.139 1.4e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.084 3.4e-1 0.006 4.9e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.122 3.8e-1 -0.100 4.0e-1 9 Click to see details
GSE38226 Liver fibrosis 0.048 4.2e-1 0.002 5.0e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.33 0.02 -0.326 0.02 42 Click to see details
KICH 0.402 0.02 0.434 0.02 25 Click to see details
STAD -0.322 0.04 -0.367 0.02 32 Click to see details
LUSC -0.287 0.04 -0.239 0.07 38 Click to see details
LUAD 0.502 0.05 0.182 0.29 12 Click to see details
LIHC 0.199 0.09 0.193 0.09 49 Click to see details
KIRP 0.222 0.11 0.286 0.06 32 Click to see details
PCPG 0.892 0.15 1.000 0.5 3 Click to see details
PRAD -0.143 0.16 -0.233 0.05 50 Click to see details
KIRC -0.106 0.19 -0.078 0.26 68 Click to see details
BLCA -0.208 0.2 0.022 0.47 18 Click to see details
CHOL -0.271 0.24 -0.400 0.14 9 Click to see details
UCEC -0.146 0.28 -0.216 0.19 19 Click to see details
CESC 0.567 0.31 0.500 0.33 3 Click to see details
THCA 0.063 0.32 0.124 0.17 59 Click to see details
COAD -0.178 0.34 -0.095 0.41 8 Click to see details
BRCA 0.043 0.35 0.063 0.28 84 Click to see details
ESCA -0.046 0.45 -0.218 0.26 11 Click to see details
PAAD -0.036 0.48 -0.400 0.3 4 Click to see details
PAAD -0.036 0.48 -0.400 0.3 4 Click to see details
PAAD -0.036 0.48 -0.400 0.3 4 Click to see details
412 hsa-miR-744-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016085 ARL15 ADP ribosylation factor like GTPase 15 1 1
MIRT016086 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 2
MIRT016087 PPTC7 PTC7 protein phosphatase homolog 2 3
MIRT016088 RASSF1 Ras association domain family member 1 1 1
MIRT016089 IER5 immediate early response 5 1 1
MIRT037383 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT037384 STAM2 signal transducing adaptor molecule 2 1 1
MIRT037385 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037386 DCXR dicarbonyl and L-xylulose reductase 1 1
MIRT037387 TSPAN17 tetraspanin 17 1 1
MIRT037388 ACTB actin beta 1 1
MIRT037389 HIST1H2BC histone cluster 1 H2B family member c 1 1
MIRT037390 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT037391 VDAC1 voltage dependent anion channel 1 1 1
MIRT037392 RNASEK ribonuclease K 1 1
MIRT037393 CDK16 cyclin dependent kinase 16 1 1
MIRT037394 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT037395 ARRDC2 arrestin domain containing 2 1 1
MIRT037396 SGMS1 sphingomyelin synthase 1 1 1
MIRT037397 HSPD1 heat shock protein family D (Hsp60) member 1 1 1
MIRT037398 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT037399 RHEB Ras homolog, mTORC1 binding 1 1
MIRT037400 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037401 TP53I13 tumor protein p53 inducible protein 13 1 1
MIRT037402 CD44 CD44 molecule (Indian blood group) 1 1
MIRT037403 USP12 ubiquitin specific peptidase 12 1 1
MIRT037404 AP2B1 adaptor related protein complex 2 beta 1 subunit 1 1
MIRT037405 RPL18A ribosomal protein L18a 1 1
MIRT037406 PPP1CA protein phosphatase 1 catalytic subunit alpha 1 1
MIRT037407 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT037408 PXK PX domain containing serine/threonine kinase like 1 1
MIRT037409 TDRKH tudor and KH domain containing 1 1
MIRT037410 PRRC2A proline rich coiled-coil 2A 1 1
MIRT037411 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT037412 NDE1 nudE neurodevelopment protein 1 1 1
MIRT037413 STK16 serine/threonine kinase 16 1 1
MIRT037414 PSMB2 proteasome subunit beta 2 1 1
MIRT037415 EPN1 epsin 1 1 1
MIRT037416 EN2 engrailed homeobox 2 1 1
MIRT037417 LARP1 La ribonucleoprotein domain family member 1 1 1
MIRT037418 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT037419 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT037420 AP2A2 adaptor related protein complex 2 alpha 2 subunit 1 1
MIRT037421 ACTG1 actin gamma 1 1 1
MIRT037422 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT037423 UBE2O ubiquitin conjugating enzyme E2 O 1 1
MIRT037424 KLHL15 kelch like family member 15 1 1
MIRT037425 SECISBP2 SECIS binding protein 2 1 1
MIRT037426 KIAA0922 transmembrane 131 like 1 1
MIRT037427 PTMA prothymosin, alpha 1 1
MIRT037428 WDR45B WD repeat domain 45B 1 1
MIRT037429 ZNF282 zinc finger protein 282 1 1
MIRT037430 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT037431 TNKS tankyrase 1 1
MIRT037432 NOP2 NOP2 nucleolar protein 1 1
MIRT037433 GAK cyclin G associated kinase 1 1
MIRT037434 ATP6 ATP synthase F0 subunit 6 1 1
MIRT037435 DIDO1 death inducer-obliterator 1 1 1
MIRT037436 RPL3 ribosomal protein L3 1 1
MIRT037437 AIMP2 aminoacyl tRNA synthetase complex interacting multifunctional protein 2 1 1
MIRT037438 PIGC phosphatidylinositol glycan anchor biosynthesis class C 1 1
MIRT037439 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT037440 USP21 ubiquitin specific peptidase 21 1 1
MIRT037441 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT037442 RPS6 ribosomal protein S6 1 1
MIRT037443 ILKAP ILK associated serine/threonine phosphatase 1 1
MIRT037444 COX1 cytochrome c oxidase subunit I 1 1
MIRT037445 VPS37C VPS37C, ESCRT-I subunit 1 1
MIRT037446 CDK12 cyclin dependent kinase 12 1 1
MIRT037447 RBM8A RNA binding motif protein 8A 1 1
MIRT037448 CKB creatine kinase B 1 1
MIRT037449 DHX57 DExH-box helicase 57 1 1
MIRT037450 DDX23 DEAD-box helicase 23 1 1
MIRT037451 ABI3 ABI family member 3 1 1
MIRT037452 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT037453 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT037454 C17orf70 Fanconi anemia core complex associated protein 100 1 1
MIRT037455 SKI SKI proto-oncogene 1 1
MIRT037456 KCTD11 potassium channel tetramerization domain containing 11 1 1
MIRT037457 GNB2L1 receptor for activated C kinase 1 1 1
MIRT037458 NCOA3 nuclear receptor coactivator 3 1 1
MIRT037459 PAK4 p21 (RAC1) activated kinase 4 2 3
MIRT037460 GDI2 GDP dissociation inhibitor 2 1 1
MIRT037461 SLC2A4RG SLC2A4 regulator 1 1
MIRT037462 SLX4 SLX4 structure-specific endonuclease subunit 1 1
MIRT037463 COPA coatomer protein complex subunit alpha 1 1
MIRT037464 GPRASP2 G protein-coupled receptor associated sorting protein 2 1 1
MIRT037465 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT037466 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT037467 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT037468 CAPNS1 calpain small subunit 1 1 1
MIRT037469 FRZB frizzled-related protein 1 1
MIRT037470 UBQLN4 ubiquilin 4 1 1
MIRT037471 NUP153 nucleoporin 153 1 1
MIRT037472 TMEM175 transmembrane protein 175 1 1
MIRT037473 HIST1H2BD histone cluster 1 H2B family member d 1 1
MIRT037474 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT037475 BCL2L12 BCL2 like 12 1 1
MIRT037476 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT037477 MINK1 misshapen like kinase 1 1 1
MIRT037478 PDXK pyridoxal kinase 1 1
MIRT037479 FAM110A family with sequence similarity 110 member A 1 1
MIRT037480 ZNF598 zinc finger protein 598 1 1
MIRT037481 ILK integrin linked kinase 1 1
MIRT037482 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT037483 WBP2 WW domain binding protein 2 1 1
MIRT037484 CYTB cytochrome b 1 1
MIRT037485 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT037486 TRIM33 tripartite motif containing 33 1 1
MIRT037487 SLC25A3 solute carrier family 25 member 3 1 1
MIRT037488 IRS4 insulin receptor substrate 4 1 1
MIRT037489 TSR1 TSR1, ribosome maturation factor 1 1
MIRT037490 TCOF1 treacle ribosome biogenesis factor 1 1 1
MIRT037491 ATXN2L ataxin 2 like 1 1
MIRT037492 MTOR mechanistic target of rapamycin kinase 1 1
MIRT037493 ZNF318 zinc finger protein 318 1 1
MIRT037494 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 3
MIRT037495 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT037496 STMN1 stathmin 1 1 1
MIRT037497 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT037498 SALL1 spalt like transcription factor 1 1 1
MIRT037499 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT037500 SLC35D1 solute carrier family 35 member D1 1 1
MIRT037501 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT037502 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT037503 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT037504 BAG6 BCL2 associated athanogene 6 1 1
MIRT037505 MED28 mediator complex subunit 28 1 1
MIRT037506 ANKRD52 ankyrin repeat domain 52 1 1
MIRT037507 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 1 1
MIRT037508 PPDPF pancreatic progenitor cell differentiation and proliferation factor 1 1
MIRT037509 PRKACA protein kinase cAMP-activated catalytic subunit alpha 1 1
MIRT037510 HPCAL4 hippocalcin like 4 1 1
MIRT037511 ZNF256 zinc finger protein 256 1 1
MIRT037512 CGNL1 cingulin like 1 1 1
MIRT037513 TUBA1B tubulin alpha 1b 1 1
MIRT037514 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT037515 PDE4A phosphodiesterase 4A 1 1
MIRT037516 HOXD11 homeobox D11 2 3
MIRT037517 QARS glutaminyl-tRNA synthetase 1 1
MIRT037518 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT037519 PLEKHM2 pleckstrin homology and RUN domain containing M2 1 1
MIRT037520 POLR2A RNA polymerase II subunit A 1 1
MIRT037521 KIAA1462 junctional cadherin 5 associated 1 1
MIRT037522 SF3A1 splicing factor 3a subunit 1 1 1
MIRT037523 YBX1 Y-box binding protein 1 1 1
MIRT037524 PTGES3 prostaglandin E synthase 3 1 1
MIRT037525 FOXO3 forkhead box O3 1 1
MIRT037526 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT037527 AARS alanyl-tRNA synthetase 1 1
MIRT037528 ZNF155 zinc finger protein 155 1 1
MIRT037529 NCS1 neuronal calcium sensor 1 1 1
MIRT037530 FKBP4 FK506 binding protein 4 1 1
MIRT037531 ARHGDIA Rho GDP dissociation inhibitor alpha 1 1
MIRT037532 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT037533 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT037534 HIST1H1E histone cluster 1 H1 family member e 1 1
MIRT037535 MLF2 myeloid leukemia factor 2 1 1
MIRT037536 EDC3 enhancer of mRNA decapping 3 1 1
MIRT037537 CHRAC1 chromatin accessibility complex 1 1 1
MIRT037538 WIPF3 WAS/WASL interacting protein family member 3 1 1
MIRT037539 COX2 cytochrome c oxidase subunit II 1 1
MIRT037540 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT037541 CTNNBIP1 catenin beta interacting protein 1 1 1
MIRT037542 RPL4 ribosomal protein L4 1 1
MIRT037543 COX3 cytochrome c oxidase III 1 1
MIRT037544 DDX54 DEAD-box helicase 54 1 1
MIRT037545 TOB2 transducer of ERBB2, 2 1 1
MIRT037546 MAN2C1 mannosidase alpha class 2C member 1 1 1
MIRT037547 SMCR7L mitochondrial elongation factor 1 1 1
MIRT037548 RPLP1 ribosomal protein lateral stalk subunit P1 1 1
MIRT037549 RAN RAN, member RAS oncogene family 1 1
MIRT037550 NONO non-POU domain containing octamer binding 1 1
MIRT037551 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT037552 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT037553 COLGALT1 collagen beta(1-O)galactosyltransferase 1 1 1
MIRT037554 MGRN1 mahogunin ring finger 1 1 1
MIRT037555 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT037556 TBX1 T-box 1 1 1
MIRT037557 NXPH4 neurexophilin 4 1 1
MIRT037558 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT037559 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT037560 KPNB1 karyopherin subunit beta 1 1 1
MIRT037561 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 1 1
MIRT037562 SYMPK symplekin 1 1
MIRT037563 SYPL1 synaptophysin like 1 1 1
MIRT037564 LRP3 LDL receptor related protein 3 1 1
MIRT037565 DDX24 DEAD-box helicase 24 1 1
MIRT037566 WDR37 WD repeat domain 37 1 1
MIRT037567 RPS14 ribosomal protein S14 1 1
MIRT037568 FAM53C family with sequence similarity 53 member C 1 1
MIRT037569 NMT1 N-myristoyltransferase 1 1 1
MIRT037570 PAGR1 PAXIP1 associated glutamate rich protein 1 1 1
MIRT037571 AKT2 AKT serine/threonine kinase 2 1 1
MIRT037572 TMEM14C transmembrane protein 14C 1 1
MIRT037573 MEX3D mex-3 RNA binding family member D 1 1
MIRT037574 BRAF B-Raf proto-oncogene, serine/threonine kinase 1 1
MIRT037575 POLR2L RNA polymerase II subunit L 1 1
MIRT037576 SERP1 stress associated endoplasmic reticulum protein 1 1 1
MIRT037577 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT037578 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT037579 POLD3 DNA polymerase delta 3, accessory subunit 1 1
MIRT037580 HMGA1 high mobility group AT-hook 1 1 1
MIRT037581 SLC35B4 solute carrier family 35 member B4 1 1
MIRT037582 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT037583 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 1 1
MIRT037584 RPL7A ribosomal protein L7a 1 1
MIRT037585 LAIR1 leukocyte associated immunoglobulin like receptor 1 1 1
MIRT037586 RPL10 ribosomal protein L10 1 1
MIRT037587 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT037588 SRM spermidine synthase 1 1
MIRT037589 EIF3K eukaryotic translation initiation factor 3 subunit K 1 1
MIRT037590 DESI1 desumoylating isopeptidase 1 1 1
MIRT037591 BET1 Bet1 golgi vesicular membrane trafficking protein 1 1
MIRT037592 HTRA2 HtrA serine peptidase 2 1 1
MIRT037593 LARP6 La ribonucleoprotein domain family member 6 1 1
MIRT037594 NOTCH2 notch 2 1 1
MIRT037595 ADCY9 adenylate cyclase 9 1 1
MIRT037596 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT037597 FBXL19 F-box and leucine rich repeat protein 19 1 1
MIRT037598 L3MBTL2 L3MBTL2, polycomb repressive complex 1 subunit 1 1
MIRT037599 TRIM28 tripartite motif containing 28 1 1
MIRT037600 LGALS3 galectin 3 1 1
MIRT037601 IGSF8 immunoglobulin superfamily member 8 1 1
MIRT037602 LIN37 lin-37 DREAM MuvB core complex component 1 1
MIRT037603 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT037604 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT037605 TRMT2A tRNA methyltransferase 2 homolog A 1 1
MIRT037606 DVL1 dishevelled segment polarity protein 1 1 1
MIRT037607 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 1 1
MIRT037608 TOR2A torsin family 2 member A 1 1
MIRT037609 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT037610 SMYD4 SET and MYND domain containing 4 1 1
MIRT037611 TJAP1 tight junction associated protein 1 1 1
MIRT037612 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT037613 PPM1M protein phosphatase, Mg2+/Mn2+ dependent 1M 1 1
MIRT037614 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT037615 GFER growth factor, augmenter of liver regeneration 1 1
MIRT037616 PKP2 plakophilin 2 1 1
MIRT037617 FARSB phenylalanyl-tRNA synthetase beta subunit 1 1
MIRT037618 OPRD1 opioid receptor delta 1 1 1
MIRT037619 CCNY cyclin Y 1 1
MIRT037620 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT037621 CXCL16 C-X-C motif chemokine ligand 16 1 1
MIRT037622 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT037623 DDX11 DEAD/H-box helicase 11 1 1
MIRT037624 URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 1 1
MIRT037625 SBF1 SET binding factor 1 1 1
MIRT037626 GNB2 G protein subunit beta 2 1 1
MIRT037627 KMT2D lysine methyltransferase 2D 2 3
MIRT037628 DDX17 DEAD-box helicase 17 1 1
MIRT037629 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT037630 TAPBP TAP binding protein 1 1
MIRT037631 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT037632 RPL18 ribosomal protein L18 1 1
MIRT037633 INTS3 integrator complex subunit 3 1 1
MIRT037634 CDC25B cell division cycle 25B 1 1
MIRT037635 LDOC1L retrotransposon Gag like 6 1 1
MIRT037636 TUB tubby bipartite transcription factor 1 1
MIRT037637 NUDT2 nudix hydrolase 2 1 1
MIRT037638 CDAN1 codanin 1 1 1
MIRT037639 MRS2 MRS2, magnesium transporter 1 1
MIRT037640 PYGB glycogen phosphorylase B 1 1
MIRT037641 LDLRAD3 low density lipoprotein receptor class A domain containing 3 1 1
MIRT037642 COL5A1 collagen type V alpha 1 chain 1 1
MIRT037643 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT037644 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT037645 ZNF212 zinc finger protein 212 1 1
MIRT037646 TSC2 TSC complex subunit 2 1 1
MIRT037647 FASN fatty acid synthase 1 1
MIRT037648 NOL9 nucleolar protein 9 1 1
MIRT037649 CLUH clustered mitochondria homolog 1 1
MIRT037650 PHF8 PHD finger protein 8 1 1
MIRT037651 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 1 1
MIRT037652 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT037653 HOXC11 homeobox C11 1 1
MIRT037654 DGCR14 ess-2 splicing factor homolog 1 1
MIRT037655 SLC25A1 solute carrier family 25 member 1 1 1
MIRT037656 MEX3C mex-3 RNA binding family member C 1 1
MIRT037657 RAI1 retinoic acid induced 1 1 1
MIRT037658 LY6E lymphocyte antigen 6 family member E 1 1
MIRT037659 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT037660 RPL37 ribosomal protein L37 1 1
MIRT037661 CNN2 calponin 2 1 1
MIRT037662 ALDH18A1 aldehyde dehydrogenase 18 family member A1 1 1
MIRT037663 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 1 1
MIRT037664 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT037665 PIM3 Pim-3 proto-oncogene, serine/threonine kinase 1 1
MIRT037666 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT037667 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT037668 ART5 ADP-ribosyltransferase 5 1 1
MIRT037669 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT037670 NCL nucleolin 1 1
MIRT037671 NCKAP5L NCK associated protein 5 like 1 1
MIRT037672 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT037673 CCDC71 coiled-coil domain containing 71 1 1
MIRT037674 SURF4 surfeit 4 1 1
MIRT037675 RPL13 ribosomal protein L13 1 1
MIRT037676 ACTN4 actinin alpha 4 1 1
MIRT037677 PA2G4 proliferation-associated 2G4 1 1
MIRT037678 MIF macrophage migration inhibitory factor 1 1
MIRT037679 UBE2N ubiquitin conjugating enzyme E2 N 1 1
MIRT037680 LYNX1 Ly6/neurotoxin 1 1 1
MIRT037681 TACC3 transforming acidic coiled-coil containing protein 3 1 1
MIRT037682 GSR glutathione-disulfide reductase 1 1
MIRT037683 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT037684 ZMYM3 zinc finger MYM-type containing 3 1 1
MIRT037685 ERP29 endoplasmic reticulum protein 29 1 1
MIRT037686 MATR3 matrin 3 1 1
MIRT037687 FANCG Fanconi anemia complementation group G 1 1
MIRT037688 FAM83G family with sequence similarity 83 member G 1 1
MIRT037689 DUSP18 dual specificity phosphatase 18 1 1
MIRT037690 MYC MYC proto-oncogene, bHLH transcription factor 3 2
MIRT037691 TSPAN7 tetraspanin 7 1 1
MIRT037692 ATMIN ATM interactor 1 1
MIRT037693 SEPT2 septin 2 1 1
MIRT037694 FOXRED2 FAD dependent oxidoreductase domain containing 2 1 1
MIRT037695 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT037696 MRPL11 mitochondrial ribosomal protein L11 1 1
MIRT037697 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT037698 PSMD4 proteasome 26S subunit, non-ATPase 4 1 1
MIRT037699 SH3GL1 SH3 domain containing GRB2 like 1, endophilin A2 1 1
MIRT037700 CTNNB1 catenin beta 1 1 1
MIRT037701 TMEM189 transmembrane protein 189 1 1
MIRT037702 LDLR low density lipoprotein receptor 1 1
MIRT037703 OGFR opioid growth factor receptor 1 1
MIRT037704 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT037705 LIPA lipase A, lysosomal acid type 1 1
MIRT037706 SNAPC4 small nuclear RNA activating complex polypeptide 4 1 1
MIRT037707 FBN2 fibrillin 2 1 1
MIRT037708 ZNF704 zinc finger protein 704 1 1
MIRT037709 EIF3M eukaryotic translation initiation factor 3 subunit M 1 1
MIRT037710 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT037711 FZR1 fizzy and cell division cycle 20 related 1 1 1
MIRT037712 NANOS1 nanos C2HC-type zinc finger 1 1 1
MIRT037713 PRR12 proline rich 12 1 1
MIRT037714 PHC2 polyhomeotic homolog 2 1 1
MIRT037715 NOP9 NOP9 nucleolar protein 1 1
MIRT037716 HM13 histocompatibility minor 13 1 1
MIRT037717 PRDX5 peroxiredoxin 5 1 1
MIRT037718 IRGQ immunity related GTPase Q 1 1
MIRT037719 TGFB1 transforming growth factor beta 1 7 2
MIRT037720 MARCH3 membrane associated ring-CH-type finger 3 1 1
MIRT037721 TBX2 T-box 2 1 1
MIRT037722 TSC22D3 TSC22 domain family member 3 1 1
MIRT037723 DUT deoxyuridine triphosphatase 1 1
MIRT037724 FAM171A2 family with sequence similarity 171 member A2 1 1
MIRT037725 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT037726 FRAT1 FRAT1, WNT signaling pathway regulator 1 1
MIRT037727 PSMD11 proteasome 26S subunit, non-ATPase 11 1 1
MIRT037728 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT037729 ENO1 enolase 1 1 1
MIRT037730 AP3D1 adaptor related protein complex 3 delta 1 subunit 1 1
MIRT037731 TUBA1A tubulin alpha 1a 1 1
MIRT037732 ULK3 unc-51 like kinase 3 1 1
MIRT037733 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT037734 SLC25A46 solute carrier family 25 member 46 1 1
MIRT037735 MED15 mediator complex subunit 15 1 1
MIRT037736 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT037737 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT037738 ATHL1 protein-glucosylgalactosylhydroxylysine glucosidase 1 1
MIRT037739 CTNNA1 catenin alpha 1 1 1
MIRT037740 ADRM1 adhesion regulating molecule 1 1 1
MIRT037741 CCDC106 coiled-coil domain containing 106 1 1
MIRT054493 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 3 1
MIRT451195 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 2 2
MIRT452931 DISC1 disrupted in schizophrenia 1 2 2
MIRT455468 LYPLA2 lysophospholipase II 2 2
MIRT457068 TOR4A torsin family 4 member A 2 2
MIRT464195 VGLL4 vestigial like family member 4 2 4
MIRT483030 KHSRP KH-type splicing regulatory protein 2 4
MIRT486062 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT486120 INO80E INO80 complex subunit E 2 2
MIRT486866 DPF1 double PHD fingers 1 2 2
MIRT488343 PAX2 paired box 2 2 2
MIRT488790 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT490249 MFI2 melanotransferrin 2 2
MIRT490264 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT490756 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT492321 SETD1B SET domain containing 1B 2 2
MIRT492851 NRGN neurogranin 2 2
MIRT499604 ANKRD45 ankyrin repeat domain 45 2 2
MIRT500189 BARX1 BARX homeobox 1 2 4
MIRT516765 FAM212B family with sequence similarity 212 member B 2 4
MIRT517949 TRIM59 tripartite motif containing 59 2 2
MIRT521182 SCAF4 SR-related CTD associated factor 4 2 2
MIRT526462 OSBPL5 oxysterol binding protein like 5 2 2
MIRT535148 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT569528 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT570593 NFIX nuclear factor I X 2 2
MIRT571219 F2R coagulation factor II thrombin receptor 2 2
MIRT574145 MARVELD1 MARVEL domain containing 1 2 2
MIRT608758 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT649509 RAB17 RAB17, member RAS oncogene family 2 2
MIRT692165 RNF207 ring finger protein 207 2 2
MIRT703495 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT711081 NEUROD2 neuronal differentiation 2 2 2
MIRT712090 UNC13A unc-13 homolog A 2 2
MIRT712531 CYTH2 cytohesin 2 2 2
MIRT712755 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT712893 TGFA transforming growth factor alpha 2 2
MIRT714684 PRX periaxin 2 2
MIRT714723 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714814 NOB1 NIN1/PSMD8 binding protein 1 homolog 2 2
MIRT716774 C1orf229 chromosome 1 open reading frame 229 2 2
MIRT717511 HRNR hornerin 2 2
MIRT717653 THBS2 thrombospondin 2 2 2
MIRT719595 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT720525 PTGR2 prostaglandin reductase 2 2 2
MIRT724925 VPS18 VPS18, CORVET/HOPS core subunit 2 2
MIRT737146 NOS3 nitric oxide synthase 3 1 0
MIRT756003 SLC7A5 solute carrier family 7 member 5 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-744 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-744 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-744 Ursodeoxycholic acid (UDCA) approved 31401 Microarray rat Liver 20689055 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-744 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-744 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-744 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-744-5p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-744-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-744-5p 5,7-dibromo-2-[(e)-2-(4-hydroxy-3-methoxyphenyl)ethenyl]quinolin-8-ol 135460261 NSC67090 sensitive
hsa-miR-744-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-744-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-744-5p Paullone analog 47 396411 NSC702373 sensitive
hsa-miR-744-5p Ursa-11,13(18)-dien-28-oic acid-3.beta.-ol 378695 NSC661747 sensitive
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-744-5p Carboplatin 38904 NSC241240 approved sensitive High Ovarian Cancer tissue and cell line (MDAH-2274, SKOV3)
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-744-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-744-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-744-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma tissue
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-744-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-744-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-744-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-744-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)

Error report submission