miRTarBase - #MIRT037783


—
pre-miRNA Information
pre-miRNA hsa-mir-628   
Genomic Coordinates chr15: 55372940 - 55373034
Synonyms MIRN628, hsa-mir-628, MIR628
Description Homo sapiens miR-628 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-628-5p
Sequence 23| AUGCUGACAUAUUUACUAGAGG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN15665015 15 COSMIC
COSN30467735 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs761527552 8 dbSNP
rs776423775 9 dbSNP
rs200771662 11 dbSNP
rs760615166 12 dbSNP
rs747172385 13 dbSNP
rs775387693 16 dbSNP
rs771606673 19 dbSNP
rs745373506 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NELFE   
Synonyms D6S45, NELF-E, RD, RDBP, RDP
Description negative elongation factor complex member E
Transcript NM_002904   
Expression
Putative miRNA Targets on NELFE
3'UTR of NELFE
(miRNA target sites are highlighted)		 
>NELFE|NM_002904|3'UTR
   1 GGAACAGAGCTGGATTCCTTGTGCCTCATATGCCCCAATGCTGGTCTCAGTAAAACACTGAGGTGGAAGCTTACACATCT
  81 CCCTCAGCCTCTGGTTTTTCAGCACTTGGGATTGGGGTTAAACCTTTAAAAACGGCTGTCAGGTTTGATCTCAGTGTAAC
 161 AACATGGCCAGTGCCTGTTCCCCACTCCCTTGCCCCAAAAGGATCTGGAACACAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggAGAUCAUUUAUACAGUCGUa 5'
            |||:||   | | |||||| 
Target 5' ccTCTGGT---T-TTTCAGCAc 3'
 88 - 105 124.00 -15.20
2 
miRNA  3' ggAGAUCAUUUAU--ACAGUCgua 5'
            |:||  ||| :  ||||||   
Target 5' ccTTTA-AAAACGGCTGTCAGgtt 3'
 123 - 145 113.00 -9.68
3 
miRNA  3' ggagaucauuuauacAGUCGUa 5'
                         ||||:| 
Target 5' gccccaatgctggtcTCAGTAa 3'
 32 - 53 104.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31783709 35 COSMIC
COSN14219475 38 COSMIC
COSN30462595 83 COSMIC
COSN32057272 122 COSMIC
COSN30461246 124 COSMIC
COSN30516714 151 COSMIC
COSN19725680 161 COSMIC
COSN26986306 180 COSMIC
COSN7870599 181 COSMIC
COSN30474309 189 COSMIC
rs522162 161 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753074425 9 dbSNP
rs1456696327 10 dbSNP
rs1382765654 13 dbSNP
rs765570341 20 dbSNP
rs1201743384 29 dbSNP
rs1479510295 32 dbSNP
rs1246303989 36 dbSNP
rs368735114 38 dbSNP
rs1175597971 39 dbSNP
rs754459419 42 dbSNP
rs1384419576 59 dbSNP
rs897169469 60 dbSNP
rs1344853890 62 dbSNP
rs1454463938 82 dbSNP
rs1291004984 85 dbSNP
rs1041413579 91 dbSNP
rs1053159 102 dbSNP
rs1008497075 103 dbSNP
rs1284480951 112 dbSNP
rs760070 122 dbSNP
rs561435164 124 dbSNP
rs149428147 127 dbSNP
rs1469066180 133 dbSNP
rs183347669 134 dbSNP
rs914707921 138 dbSNP
rs908992932 144 dbSNP
rs1489796033 148 dbSNP
rs986307449 150 dbSNP
rs953553547 154 dbSNP
rs1200481499 160 dbSNP
rs522162 161 dbSNP
rs1175585683 169 dbSNP
rs1260518656 171 dbSNP
rs976320208 176 dbSNP
rs1466653868 183 dbSNP
rs140185216 190 dbSNP
rs1398493715 201 dbSNP
rs1030986256 204 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
44 hsa-miR-628-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT037783 NELFE negative elongation factor complex member E 1 1
MIRT200944 ZNF264 zinc finger protein 264 2 6
MIRT441916 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT443436 PLSCR1 phospholipid scramblase 1 2 2
MIRT443447 CLIC5 chloride intracellular channel 5 2 2
MIRT443906 ZNF256 zinc finger protein 256 2 2
MIRT449750 SMYD2 SET and MYND domain containing 2 2 2
MIRT461377 SLFN12L schlafen family member 12 like 2 2
MIRT466416 TFAP2A transcription factor AP-2 alpha 2 8
MIRT486594 CTPS2 CTP synthase 2 2 2
MIRT491945 VPS52 VPS52, GARP complex subunit 2 2
MIRT513492 SSR1 signal sequence receptor subunit 1 2 6
MIRT528599 ZNF326 zinc finger protein 326 2 2
MIRT531325 SEMA3D semaphorin 3D 2 2
MIRT532082 RTTN rotatin 2 2
MIRT532563 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT532976 ZNF12 zinc finger protein 12 2 2
MIRT534075 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT536103 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT536183 MAOB monoamine oxidase B 2 2
MIRT543755 UBXN2B UBX domain protein 2B 2 2
MIRT550000 KIAA0408 KIAA0408 2 2
MIRT551237 COLEC10 collectin subfamily member 10 2 2
MIRT567554 FEN1 flap structure-specific endonuclease 1 2 2
MIRT570387 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 2
MIRT570808 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT576346 Pxdn peroxidasin 2 2
MIRT576520 Txlna taxilin alpha 2 2
MIRT576893 Poteg POTE ankyrin domain family, member G 2 2
MIRT606796 BICD2 BICD cargo adaptor 2 2 2
MIRT625909 GBP6 guanylate binding protein family member 6 2 2
MIRT626869 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT643603 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT645451 FOXE1 forkhead box E1 2 2
MIRT652265 TOMM20 translocase of outer mitochondrial membrane 20 2 2
MIRT689023 ARID1A AT-rich interaction domain 1A 2 2
MIRT691057 CRCP CGRP receptor component 2 2
MIRT704712 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT713069 ENTHD1 ENTH domain containing 1 2 2
MIRT719483 RBM27 RNA binding motif protein 27 2 2
MIRT732944 AGAP2-AS1 AGAP2 antisense RNA 1 3 0
MIRT732945 KLF12 Kruppel like factor 12 3 0
MIRT733520 BMP2 bone morphogenetic protein 2 3 0
MIRT733521 ETV1 ETS variant 1 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-628-5p 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-628 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved sensitive Low Renal Cell Cancer cell line (OS-RC-2)
hsa-miR-628-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-628-5p Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-628-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-628-5p Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-628-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-628-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-628-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-628-5p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-628-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-628-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-628-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-628-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-628-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR4)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-628-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-628-5p Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-628-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission