>PGAM4|NM_001029891|3'UTR
   1 AGGCCAGCGGGGAGGATACTGTCCCCAGGAGCACCCTCCCTGCTGGTCTTGTCCCTCTGCCCCTCCCACCTGCACATGTC
  81 ACACTGACCACATCTGTAGACATCTTGAGTTGTAGCTGCAGATGGGGACCAGTGGCTCCCATTTTCATTTTAGCCATTTT
 161 GTCGCCTGCACCCACTCCCTTCATACAATCTAGTCAGAATAGCAGTTCTAGAGCACAGGTTCTCAGTCTAAGCTGTGGAA
 241 AAGCTCCCCTTATCCAACAGAGTTTAAAAGTAGTGACTTGGGTTTTTGTGAGTGCTTTGTTTACTAAGGACTTTGGGGAG
 321 GAACATGCTAAGCCACGACCAATGAGGAGAAGCAACAGAGCCTGTCTGTCCCCATGAGCAGAGTCTGTCCTCTGCTCTTC
 401 TGCAGTCAGGCCACTGCCTGGGGGCTCTAGTCATTCCAGTGGAAGATGAATGTAATCTGCATGGTGATGTGACAACTGTT
 481 TCCTCCTTGACCCCAGAGGATCTGGCTCTAGGTTGGGATCAATCCTGAATTTCGTTATGTGTTATATTTACTTTTATTAA
 561 AAAAGTATAGTATATATTAATAATACAAAACAATAACCCTTCTGGGGTTTCTTGTGGCGGTTGAAATAGTCCCACATGTG
 641 GTCATCAGAAAATAAGCCATTCCTCATACCAATATAGGATCAGCTCCTTGACCTCTGAGGGGCAGGAGTGCTTCCTGGTG
 721 TGTGTATTAGAATCCCTTCCTGCCTTGTTTCATGGCAGTGAAATGCCTCTTGGTCCTGTCCAAGTGTGTCTTTCACTGAT
 801 TTCTGAATCATGTTCTAGTTGCTTGACCCTGCCACATGGGCCCAGTGTTCATCTGAGCATAACTGTACTAAATCCTTTTA
 881 CCAGATCAGTATAATAAAGGAGTGATGTGCAAT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuUCAGAGC-GAGAGACGGGGAGu 5' :||||:| | ||||||||||| Target 5' ctGGTCTTGTCCCTCTGCCCCTCc 3'	43 - 66	181.00	-30.90
2	miRNA 3' uuUCAGAGCGAGAGACGGGGAGu 5' ||||| |: ||||||:|:|| Target 5' agAGTCT-GTCCTCTGCTCTTCt 3'	380 - 401	148.00	-24.20
3	miRNA 3' uuuCAGAG---CGAGA---GACGGGGAGu 5' ||:|| || | ||||:||: Target 5' cttGTTTCATGGCAGTGAAATGCCTCTTg 3'	744 - 772	116.00	-13.00

Mutant ID	Mutant Position	Mutant Source
rs1177553917	3	dbSNP
rs782535693	6	dbSNP
rs370972288	8	dbSNP
rs782762847	9	dbSNP
rs1174605294	10	dbSNP
rs782136628	15	dbSNP
rs782775711	32	dbSNP
rs1377540587	35	dbSNP
rs190235986	41	dbSNP
rs782047376	45	dbSNP
rs781931947	46	dbSNP
rs1398452571	47	dbSNP
rs781831467	60	dbSNP
rs1446338988	61	dbSNP
rs1298921217	72	dbSNP
rs185437080	73	dbSNP
rs1217524801	78	dbSNP
rs1299153552	87	dbSNP
rs1311526577	89	dbSNP
rs1223948158	152	dbSNP
rs1264780416	154	dbSNP
rs1315764881	163	dbSNP
rs1197663460	164	dbSNP
rs1233052917	172	dbSNP
rs1481358257	216	dbSNP
rs1188919078	225	dbSNP
rs1267349498	242	dbSNP
rs1481042804	261	dbSNP
rs782057262	280	dbSNP
rs1421971021	282	dbSNP
rs1465385036	292	dbSNP
rs1171452596	294	dbSNP
rs782355542	326	dbSNP
rs1356463575	332	dbSNP
rs1434484876	336	dbSNP
rs1292999435	337	dbSNP
rs1346163707	339	dbSNP
rs1405484143	357	dbSNP
rs1285076590	366	dbSNP
rs1213753184	376	dbSNP
rs1273323389	380	dbSNP
rs782038018	390	dbSNP
rs782808962	401	dbSNP
rs1218819351	421	dbSNP
rs1264366365	422	dbSNP
rs782134806	428	dbSNP
rs1490351715	448	dbSNP
rs1202255253	459	dbSNP
rs781991422	466	dbSNP
rs1477721811	470	dbSNP
rs1187464416	483	dbSNP
rs782363641	491	dbSNP
rs1421986950	508	dbSNP
rs1403822563	513	dbSNP
rs782046653	513	dbSNP
rs782048834	527	dbSNP
rs1366310867	532	dbSNP
rs181072116	533	dbSNP
rs1304933235	534	dbSNP
rs189470519	538	dbSNP
rs1429850085	539	dbSNP
rs1270540650	540	dbSNP
rs1363743148	541	dbSNP
rs1226264320	543	dbSNP
rs1313857304	544	dbSNP
rs1359594768	545	dbSNP
rs1224029522	559	dbSNP
rs1284590345	565	dbSNP
rs1488240668	565	dbSNP
rs1217057299	577	dbSNP
rs1244194532	584	dbSNP
rs5913628	590	dbSNP
rs1471989474	605	dbSNP
rs1181523250	616	dbSNP
rs1386073651	618	dbSNP
rs1446565572	619	dbSNP
rs1156930914	629	dbSNP
rs1358611998	632	dbSNP
rs1400056818	663	dbSNP
rs1318811406	675	dbSNP
rs113125940	688	dbSNP
rs1346778479	693	dbSNP
rs1445509906	696	dbSNP
rs1335719937	718	dbSNP
rs1383063283	720	dbSNP
rs1247604682	722	dbSNP
rs1306469123	724	dbSNP
rs1349249863	726	dbSNP
rs1224853033	734	dbSNP
rs1286901693	735	dbSNP
rs1441100836	743	dbSNP
rs1203403019	774	dbSNP
rs1244049485	784	dbSNP
rs782304969	786	dbSNP
rs1462816868	787	dbSNP
rs1176943146	789	dbSNP
rs1379771599	796	dbSNP
rs1470531406	798	dbSNP
rs1159124383	818	dbSNP
rs1410032097	833	dbSNP
rs1412608290	845	dbSNP
rs1335822705	852	dbSNP
rs1406465986	859	dbSNP
rs782721181	882	dbSNP
rs1334679959	883	dbSNP
rs1442276810	890	dbSNP
rs1281825270	898	dbSNP
rs1343491534	904	dbSNP
rs1223343882	919	dbSNP
rs1197019875	926	dbSNP
rs1264160687	926	dbSNP
rs1326018020	926	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Cell, 2013

MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.