miRTarBase - #MIRT038029


—
pre-miRNA Information
pre-miRNA hsa-mir-423   
Genomic Coordinates chr17: 30117079 - 30117172
Synonyms MIRN423, hsa-mir-423, MIR423
Description Homo sapiens miR-423 stem-loop
Comment miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-423-5p
Sequence 17| UGAGGGGCAGAGAGCGAGACUUU |39
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31534005 8 COSMIC
COSN31546484 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1237323143 1 dbSNP
rs766187585 6 dbSNP
rs901641664 10 dbSNP
rs776372668 14 dbSNP
rs1410439654 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BW9LU5 miR-423 Safety Biomarker (SAF) Clinical/Experimental Data Expression Higher Urine Quantitative polymerase chain reaction
BW9LU5 miR-423 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum exosomes SRNA-sequencing
Gene Information
Gene Symbol FAM127A
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuucagagcgagaGACGGGGAGu 5'
                       | ||||||| 
Target 5' -cttccagccagcCAGCCCCTCc 3'
 		1 - 22
2 
miRNA  3' uuucaGAGCGAGAGACGGGGAGu 5'
               :|:|  | |||:||: | 
Target 5' gtacaTTTGGACGCTGTCCTGCg 3'
 		26 - 48
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001078171 | 3UTR | GAAUAGCGCUCCAGGCUCCUGCUGCCGCCCCUGGGCCUCACUCUGGAGCGAGCCGCCGCCCUCUCCUUCCAGCCAGCCAGCCCCUCCCAUGUACAUUUGGACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001078171 | 3UTR | GGCUCCUGCUGCCGCCCCUGGGCCUCACUCUGGAGCGAGCCGCCGCCCUCUCCUUCCAGCCAGCCAGCCCCUCCCAUGUACAUUUGGACGCUGUCCUGCGCUCCAGCUGCAAGCUGGGCUCCUGUUACACACUGGACAGACCACCCACUGCCGCCGCUGCCAAGCCCUCUCCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001078171 | 3UTR | CUGGGCCUCACUCUGGAGCGAGCCGCCGCCCUCUCCUUCCAGCCAGCCAGCCCCUCCCAUGUACAUUUGGACGCUGUCCUGCGCUCCAGCUGCAAGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001078171 | 3UTR | GGCUCCUGCUGCCGCCCCUGGGCCUCACUCUGGAGCGAGCCGCCGCCCUCUCCUUCCAGCCAGCCAGCCCCUCCCAUGUACAUUUGGACGCUGUCCUGCGCUCCAGCUGCAAGCUGGGCUCCUGUUACACACUGGACAGACCACCCACUGCCGCCGCUGCCAAGCCCUCUCCUCCCCACCAGACUGCCAGACGACUACAUCAUUCUGCCCACAGACCUGCGCUGCCACAGCCAUCGCCAUCCAUCGCAUCCCACCGACAGACUGCUGCUCCUAGUGAUCUGGACUCACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001078171 | 3UTR | CUCUGGAGCGAGCCGCCGCCCUCUCCUUCCAGCCAGCCAGCCCCUCCCAUGUACAUUUGGACGCUGUCCUGCGCUCCAGCUGCAAGCUGGGCUCCUGUUACACACUGGACAGACCACCCACUGCCGCCGCUGCCAAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.72 1.7e-4 -0.738 1.0e-4 20 Click to see details
GSE19783 ER- ER- breast cancer -0.367 4.4e-4 -0.349 8.1e-4 79 Click to see details
GSE28260 Renal cortex and medulla -0.726 2.5e-3 -0.736 2.1e-3 13 Click to see details
GSE19536 Breast cancer -0.275 2.8e-3 -0.269 3.4e-3 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.479 1.0e-2 -0.440 1.8e-2 23 Click to see details
GSE28544 Breast cancer 0.449 1.4e-2 0.478 9.1e-3 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.425 1.7e-2 0.420 1.8e-2 25 Click to see details
GSE21032 Prostate cancer 0.224 2.1e-2 0.196 3.8e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.297 7.5e-2 -0.342 4.7e-2 25 Click to see details
GSE21687 Ependynoma primary tumors -0.166 9.5e-2 -0.122 1.7e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.242 1.3e-1 -0.295 8.1e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.2 2.0e-1 -0.289 1.1e-1 20 Click to see details
GSE17498 Multiple myeloma -0.133 2.1e-1 -0.129 2.1e-1 40 Click to see details
GSE32688 Pancreatic cancer 0.063 3.7e-1 0.102 2.9e-1 32 Click to see details
GSE38226 Liver fibrosis 0.046 4.2e-1 -0.048 4.2e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.077 4.2e-1 -0.283 2.3e-1 9 Click to see details
GSE19350 CNS germ cell tumors -0.001 5.0e-1 0.217 2.5e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.631 0 -0.641 0 18 Click to see details
CESC -0.998 0.02 -1.000 0.5 3 Click to see details
LUSC 0.265 0.05 0.301 0.03 38 Click to see details
PAAD -0.867 0.07 -0.800 0.1 4 Click to see details
THCA -0.196 0.07 -0.192 0.07 59 Click to see details
STAD -0.255 0.08 -0.309 0.04 32 Click to see details
BRCA -0.122 0.13 -0.124 0.13 84 Click to see details
PRAD -0.157 0.14 -0.118 0.21 50 Click to see details
KIRC 0.129 0.15 0.140 0.13 68 Click to see details
LIHC 0.132 0.18 0.150 0.15 49 Click to see details
LUAD -0.231 0.24 -0.105 0.37 12 Click to see details
PCPG -0.732 0.24 -0.500 0.33 3 Click to see details
COAD -0.244 0.28 -0.190 0.33 8 Click to see details
KICH -0.078 0.36 -0.040 0.42 25 Click to see details
HNSC 0.039 0.4 0.019 0.45 42 Click to see details
CHOL -0.08 0.42 -0.200 0.3 9 Click to see details
KIRP 0.032 0.43 -0.041 0.41 32 Click to see details
ESCA -0.043 0.45 -0.082 0.41 11 Click to see details
UCEC -0.003 0.5 0.239 0.16 19 Click to see details
UCEC -0.003 0.5 0.239 0.16 19 Click to see details
UCEC -0.003 0.5 0.239 0.16 19 Click to see details
300 hsa-miR-423-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038011 RABAC1 Rab acceptor 1 1 1
MIRT038012 NMD3 NMD3 ribosome export adaptor 1 1
MIRT038013 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 1 1
MIRT038014 RGPD2 RANBP2-like and GRIP domain containing 2 1 1
MIRT038015 TSPYL6 TSPY like 6 1 1
MIRT038016 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT038017 USP6 ubiquitin specific peptidase 6 1 1
MIRT038018 PGAM4 phosphoglycerate mutase family member 4 2 3
MIRT038019 DIP2A disco interacting protein 2 homolog A 1 1
MIRT038020 NOS1AP nitric oxide synthase 1 adaptor protein 2 3
MIRT038021 IGDCC4 immunoglobulin superfamily DCC subclass member 4 1 1
MIRT038022 RC3H1 ring finger and CCCH-type domains 1 1 1
MIRT038023 KIF1A kinesin family member 1A 1 1
MIRT038024 SRSF11 serine and arginine rich splicing factor 11 1 1
MIRT038025 BCLAF1 BCL2 associated transcription factor 1 1 1
MIRT038026 RPS15A ribosomal protein S15a 1 1
MIRT038027 CCNI cyclin I 1 1
MIRT038028 GDF11 growth differentiation factor 11 1 1
MIRT038029 FAM127A retrotransposon Gag like 8C 1 1
MIRT038030 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT038031 COX1 cytochrome c oxidase subunit I 1 1
MIRT038032 ARPC1A actin related protein 2/3 complex subunit 1A 1 1
MIRT038033 MYBL2 MYB proto-oncogene like 2 1 1
MIRT038034 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT038035 NDE1 nudE neurodevelopment protein 1 1 1
MIRT038036 CDKN2A cyclin dependent kinase inhibitor 2A 1 1
MIRT038037 TDRKH tudor and KH domain containing 1 1
MIRT038038 AKAP13 A-kinase anchoring protein 13 1 1
MIRT038039 RPS10 ribosomal protein S10 1 1
MIRT038040 PRPF38B pre-mRNA processing factor 38B 1 1
MIRT038041 PPIAL4G peptidylprolyl isomerase A like 4G 1 1
MIRT038042 MRPL34 mitochondrial ribosomal protein L34 1 1
MIRT038043 NDRG1 N-myc downstream regulated 1 1 1
MIRT038044 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT038045 ATP6 ATP synthase F0 subunit 6 1 1
MIRT038046 ZFP36L1 ZFP36 ring finger protein like 1 1 1
MIRT038047 COQ6 coenzyme Q6, monooxygenase 1 1
MIRT038048 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT038049 REPS1 RALBP1 associated Eps domain containing 1 1 1
MIRT038050 AAR2 AAR2 splicing factor homolog 1 1
MIRT038051 PPIA peptidylprolyl isomerase A 1 1
MIRT038052 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 7
MIRT038053 DDX21 DExD-box helicase 21 1 1
MIRT038054 SLC6A6 solute carrier family 6 member 6 1 1
MIRT038055 RPS2 ribosomal protein S2 1 1
MIRT038056 CSTB cystatin B 1 1
MIRT038057 ABCC5 ATP binding cassette subfamily C member 5 2 5
MIRT038058 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT038059 ERRFI1 ERBB receptor feedback inhibitor 1 1 1
MIRT038060 CEACAM6 carcinoembryonic antigen related cell adhesion molecule 6 1 1
MIRT038061 FHOD1 formin homology 2 domain containing 1 1 1
MIRT038062 LMNB2 lamin B2 1 1
MIRT038063 NECAP1 NECAP endocytosis associated 1 1 1
MIRT038064 NPLOC4 NPL4 homolog, ubiquitin recognition factor 1 1
MIRT038065 PMPCA peptidase, mitochondrial processing alpha subunit 1 1
MIRT038066 C12orf10 chromosome 12 open reading frame 10 1 1
MIRT038067 DDX54 DEAD-box helicase 54 1 1
MIRT038068 VAC14 Vac14, PIKFYVE complex component 1 1
MIRT038069 RUNX1 runt related transcription factor 1 1 1
MIRT038070 FAM98A family with sequence similarity 98 member A 1 1
MIRT038071 EPN1 epsin 1 1 1
MIRT038072 TMUB1 transmembrane and ubiquitin like domain containing 1 1 1
MIRT038073 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT038074 FAM110B family with sequence similarity 110 member B 1 1
MIRT038075 MICALL1 MICAL like 1 1 1
MIRT038076 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT038077 DLX5 distal-less homeobox 5 1 1
MIRT038078 ZNF655 zinc finger protein 655 1 1
MIRT038079 FAAH fatty acid amide hydrolase 1 1
MIRT038080 ATN1 atrophin 1 1 1
MIRT038081 ATP6V1E1 ATPase H+ transporting V1 subunit E1 1 1
MIRT038082 SLC9A3R1 SLC9A3 regulator 1 1 1
MIRT038083 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT038084 PLCB1 phospholipase C beta 1 5 1
MIRT038085 SQSTM1 sequestosome 1 1 1
MIRT038086 CLSTN1 calsyntenin 1 1 1
MIRT038087 ULK1 unc-51 like autophagy activating kinase 1 1 1
MIRT038088 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 1 1
MIRT038089 EPB41 erythrocyte membrane protein band 4.1 1 1
MIRT038090 HIST1H1C histone cluster 1 H1 family member c 1 1
MIRT038091 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT038092 TPGS2 tubulin polyglutamylase complex subunit 2 1 1
MIRT038093 FKBP4 FK506 binding protein 4 1 1
MIRT038094 GNG12 G protein subunit gamma 12 1 1
MIRT038095 RPS9 ribosomal protein S9 1 1
MIRT038096 RPL18A ribosomal protein L18a 1 1
MIRT038097 CCND2 cyclin D2 1 1
MIRT038098 PCBP1 poly(rC) binding protein 1 1 1
MIRT038099 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT038100 PDPK1 3-phosphoinositide dependent protein kinase 1 4 2
MIRT038101 WBP2 WW domain binding protein 2 1 1
MIRT038102 CLSPN claspin 1 1
MIRT038103 PTTG1 pituitary tumor-transforming 1 1 1
MIRT038104 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT038105 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT038106 ARHGDIA Rho GDP dissociation inhibitor alpha 1 1
MIRT038107 KCTD2 potassium channel tetramerization domain containing 2 1 1
MIRT038108 RNF139 ring finger protein 139 1 1
MIRT038109 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT038110 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT038111 SAR1B secretion associated Ras related GTPase 1B 1 1
MIRT038112 PA2G4 proliferation-associated 2G4 1 1
MIRT038113 UBE2D3 ubiquitin conjugating enzyme E2 D3 1 1
MIRT038114 GTPBP1 GTP binding protein 1 1 1
MIRT038115 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT038116 NUTM1 NUT midline carcinoma family member 1 1 1
MIRT038117 COPS7A COP9 signalosome subunit 7A 1 1
MIRT038118 POLR3H RNA polymerase III subunit H 1 1
MIRT038119 HIST1H1E histone cluster 1 H1 family member e 1 1
MIRT038120 NFKB2 nuclear factor kappa B subunit 2 1 1
MIRT038121 SLC7A2 solute carrier family 7 member 2 1 1
MIRT038122 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT038123 PTMA prothymosin, alpha 1 1
MIRT038124 CSDE1 cold shock domain containing E1 1 1
MIRT038125 CD81 CD81 molecule 1 1
MIRT038126 CCNF cyclin F 1 1
MIRT038127 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT038128 RCE1 Ras converting CAAX endopeptidase 1 1 1
MIRT038129 FAM83H family with sequence similarity 83 member H 1 1
MIRT038130 HES4 hes family bHLH transcription factor 4 1 1
MIRT038131 FAM189B family with sequence similarity 189 member B 2 3
MIRT038132 SLC48A1 solute carrier family 48 member 1 1 1
MIRT038133 SNX8 sorting nexin 8 1 1
MIRT038134 ZYX zyxin 1 1
MIRT038135 DRAP1 DR1 associated protein 1 1 1
MIRT038136 TEX2 testis expressed 2 1 1
MIRT038137 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT038138 LRCH4 leucine rich repeats and calponin homology domain containing 4 1 1
MIRT038139 CHD8 chromodomain helicase DNA binding protein 8 1 1
MIRT038140 MYC MYC proto-oncogene, bHLH transcription factor 1 1
MIRT038141 TRIM28 tripartite motif containing 28 1 1
MIRT038142 SEPN1 selenoprotein N 1 1
MIRT038143 MIER2 MIER family member 2 1 1
MIRT038144 HOXA7 homeobox A7 1 1
MIRT038145 PRRC2A proline rich coiled-coil 2A 1 1
MIRT038146 SRP54 signal recognition particle 54 1 1
MIRT038147 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT038148 SRM spermidine synthase 2 7
MIRT038149 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT038150 HIPK2 homeodomain interacting protein kinase 2 1 1
MIRT038151 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 1 1
MIRT038152 COPZ1 coatomer protein complex subunit zeta 1 1 1
MIRT038153 GLUL glutamate-ammonia ligase 1 1
MIRT038154 PPARGC1B PPARG coactivator 1 beta 1 1
MIRT038155 PKM pyruvate kinase, muscle 1 1
MIRT038156 MTCH2 mitochondrial carrier 2 1 1
MIRT038157 ACTG1 actin gamma 1 1 1
MIRT038158 MTMR3 myotubularin related protein 3 1 1
MIRT038159 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 1 1
MIRT038160 DDX24 DEAD-box helicase 24 1 1
MIRT038161 TUBB tubulin beta class I 1 1
MIRT038162 NSD1 nuclear receptor binding SET domain protein 1 2 3
MIRT038163 PAX2 paired box 2 2 3
MIRT038164 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT038165 CEBPB CCAAT/enhancer binding protein beta 1 1
MIRT038166 YARS tyrosyl-tRNA synthetase 1 1
MIRT038167 STRIP2 striatin interacting protein 2 1 1
MIRT038168 KCTD15 potassium channel tetramerization domain containing 15 1 1
MIRT038169 RPL23A ribosomal protein L23a 1 1
MIRT038170 MFGE8 milk fat globule-EGF factor 8 protein 1 1
MIRT038171 SF3B3 splicing factor 3b subunit 3 2 5
MIRT038172 RPL10 ribosomal protein L10 1 1
MIRT038173 SALL1 spalt like transcription factor 1 1 1
MIRT038174 BCCIP BRCA2 and CDKN1A interacting protein 1 1
MIRT038175 PSMD6 proteasome 26S subunit, non-ATPase 6 1 1
MIRT038176 MED28 mediator complex subunit 28 2 3
MIRT038177 MESDC1 talin rod domain containing 1 1 1
MIRT038178 DAG1 dystroglycan 1 1 1
MIRT053601 TFF1 trefoil factor 1 3 1
MIRT060312 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT113259 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 2
MIRT246175 TXNIP thioredoxin interacting protein 2 6
MIRT253003 CALM3 calmodulin 3 2 2
MIRT254645 NF2 neurofibromin 2 2 2
MIRT283307 UBFD1 ubiquitin family domain containing 1 2 4
MIRT348822 U2AF2 U2 small nuclear RNA auxiliary factor 2 2 2
MIRT369280 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT448590 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT449933 TPST2 tyrosylprotein sulfotransferase 2 2 2
MIRT451072 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT451722 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451796 TLR5 toll like receptor 5 2 2
MIRT454761 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 2 2
MIRT454905 SEPT8 septin 8 2 17
MIRT455511 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT455534 GJB1 gap junction protein beta 1 2 2
MIRT456322 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 2 2
MIRT456420 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT456577 NID1 nidogen 1 2 2
MIRT457530 ZMAT5 zinc finger matrin-type 5 2 2
MIRT458422 KLHL38 kelch like family member 38 2 6
MIRT459072 WFIKKN2 WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 2 2
MIRT459510 TACR3 tachykinin receptor 3 2 2
MIRT460957 MUL1 mitochondrial E3 ubiquitin protein ligase 1 2 2
MIRT462614 C20orf27 chromosome 20 open reading frame 27 2 2
MIRT463958 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT464328 UST uronyl 2-sulfotransferase 2 2
MIRT464375 URM1 ubiquitin related modifier 1 2 2
MIRT466752 SYNGR2 synaptogyrin 2 2 2
MIRT467206 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT467294 SPNS1 sphingolipid transporter 1 (putative) 2 2
MIRT467370 SP1 Sp1 transcription factor 2 2
MIRT468366 SETD8 lysine methyltransferase 5A 2 2
MIRT470189 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT470469 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT470813 PLXND1 plexin D1 2 2
MIRT471415 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472958 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT473207 MINK1 misshapen like kinase 1 2 4
MIRT473434 MDM4 MDM4, p53 regulator 2 2
MIRT473741 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474273 LASP1 LIM and SH3 protein 1 2 2
MIRT477211 EVI5L ecotropic viral integration site 5 like 2 2
MIRT477700 EFHD2 EF-hand domain family member D2 2 2
MIRT477781 E2F3 E2F transcription factor 3 2 2
MIRT478657 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479241 CHTF8 chromosome transmission fidelity factor 8 2 2
MIRT481453 ARRB2 arrestin beta 2 2 2
MIRT482151 AK2 adenylate kinase 2 2 2
MIRT482660 FAM195B MAPK regulated corepressor interacting protein 1 2 4
MIRT483709 ASPH aspartate beta-hydroxylase 2 2
MIRT484556 BARHL1 BarH like homeobox 1 2 6
MIRT484675 ZBTB46 zinc finger and BTB domain containing 46 2 8
MIRT485697 CCDC64 BICD family like cargo adaptor 1 2 4
MIRT485948 BRSK1 BR serine/threonine kinase 1 2 2
MIRT486535 CLCN7 chloride voltage-gated channel 7 2 2
MIRT487030 LIMS2 LIM zinc finger domain containing 2 2 4
MIRT487048 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487089 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT487463 ANKRD42 ankyrin repeat domain 42 2 2
MIRT487485 BANP BTG3 associated nuclear protein 2 4
MIRT487882 CASZ1 castor zinc finger 1 2 4
MIRT488413 NKX6-2 NK6 homeobox 2 2 4
MIRT489230 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489300 B4GALNT4 beta-1,4-N-acetyl-galactosaminyltransferase 4 2 2
MIRT489364 SYNGR1 synaptogyrin 1 2 4
MIRT489480 SLITRK5 SLIT and NTRK like family member 5 2 2
MIRT489647 ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase 2 4
MIRT489664 SHMT1 serine hydroxymethyltransferase 1 2 4
MIRT490918 STRN4 striatin 4 2 2
MIRT491504 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT491626 RIN3 Ras and Rab interactor 3 2 2
MIRT491691 MNT MAX network transcriptional repressor 2 4
MIRT491894 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491991 UNK unkempt family zinc finger 2 2
MIRT492114 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 2 2
MIRT492189 SOX12 SRY-box 12 5 2
MIRT492992 NAV1 neuron navigator 1 2 2
MIRT493009 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT493231 MEX3A mex-3 RNA binding family member A 2 2
MIRT493434 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT493726 GPRIN1 G protein regulated inducer of neurite outgrowth 1 2 2
MIRT493983 EIF1 eukaryotic translation initiation factor 1 2 4
MIRT494370 SOLH calpain 15 1 1
MIRT494585 ATG9A autophagy related 9A 2 2
MIRT494665 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT494794 ANKRD13B ankyrin repeat domain 13B 2 4
MIRT496595 TAGLN transgelin 2 2
MIRT496775 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT497819 STAT5B signal transducer and activator of transcription 5B 2 2
MIRT498182 CREB1 cAMP responsive element binding protein 1 2 2
MIRT499186 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT500208 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 2 4
MIRT501015 SPATA2 spermatogenesis associated 2 2 6
MIRT501095 SLC5A6 solute carrier family 5 member 6 2 4
MIRT507872 CBX6 chromobox 6 2 2
MIRT509415 MCM7 minichromosome maintenance complex component 7 2 6
MIRT544297 TSPYL1 TSPY like 1 2 2
MIRT552011 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT561765 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT568305 BAK1 BCL2 antagonist/killer 1 2 2
MIRT573517 MMP17 matrix metallopeptidase 17 2 2
MIRT574579 NFIX nuclear factor I X 2 2
MIRT575680 Map1b microtubule-associated protein 1B 2 2
MIRT606935 CDK15 cyclin dependent kinase 15 2 2
MIRT642007 NCS1 neuronal calcium sensor 1 2 2
MIRT644451 ALDOC aldolase, fructose-bisphosphate C 2 2
MIRT654231 RNF165 ring finger protein 165 2 2
MIRT655874 NFASC neurofascin 2 2
MIRT661923 MLN motilin 2 2
MIRT692263 SLC2A5 solute carrier family 2 member 5 2 2
MIRT694387 MTA1 metastasis associated 1 2 2
MIRT705555 ARID5B AT-rich interaction domain 5B 2 2
MIRT710756 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT711005 CCDC106 coiled-coil domain containing 106 2 2
MIRT712118 TMEM11 transmembrane protein 11 2 2
MIRT713436 AJAP1 adherens junctions associated protein 1 2 2
MIRT722673 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT731653 FAM3A family with sequence similarity 3 member A 3 1
MIRT735672 USF2 upstream transcription factor 2, c-fos interacting 3 0
MIRT736182 CXCL12 C-X-C motif chemokine ligand 12 2 0
MIRT736539 TNIP2 TNFAIP3 interacting protein 2 2 0
MIRT737112 LOC105371414 uncharacterized LOC105371414 3 0
MIRT737113 ADCY3 adenylate cyclase 3 3 0
MIRT737402 CASC9 cancer susceptibility 9 (non-protein coding) 3 0
MIRT755749 SRF serum response factor 4 1
MIRT755800 CACNA2D2 calcium voltage-gated channel auxiliary subunit alpha2delta 2 3 1
MIRT755861 MTM1 myotubularin 1 4 1
MIRT756274 SLIT2 slit guidance ligand 2 5 1
MIRT756275 PGM5-AS1 PGM5 antisense RNA 1 5 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-423 Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 up-regulated
miR-423 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-423-5p 5-Fluorouracil approved 3385 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-423-5p 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-423-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-423-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-423-5p N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-423-5p Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-423 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-423 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-mir-423 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-423 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-423 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-423 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-423 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-423 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-423-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-423-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-423-5p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87, U251)
hsa-miR-423-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-423-5p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-423-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-423-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant Low Triple-Negative Breast Cancer cell line (MDA-MB-231)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant Low Triple-Negative Breast Cancer cell line (MDA-MB-231)
hsa-miR-423-5p Erlotinib 176870 NSC718781 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-miR-423-5p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (BCap37)
hsa-miR-423-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-423-5p Taxane 9548828 resistant Low Prostate Cancer cell line (LNCaP, 22Rv-1, C4-2)
hsa-miR-423-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-423-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-423-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-423-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-423-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-423-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-423-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-423-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-423-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-423-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-423-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-423-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-423-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-423-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-423-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission