miRTarBase - #MIRT038624


—
pre-miRNA Information
pre-miRNA hsa-mir-125b-2   
Genomic Coordinates chr21: 16590237 - 16590325
Synonyms MIRN125B2, MIR125B2
Description Homo sapiens miR-125b-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-125b-2-3p
Sequence 54| UCACAAGUCAGGCUCUUGGGAC |75
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 21 + 16590292 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs575583557 6 dbSNP
rs1331783293 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HN1L
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.675 2.1e-4 -0.668 2.5e-4 23 Click to see details
GSE19536 Breast cancer -0.313 7.6e-4 -0.220 1.4e-2 100 Click to see details
GSE28544 Breast cancer 0.544 3.0e-3 0.628 5.1e-4 24 Click to see details
GSE21687 Ependynoma primary tumors -0.317 5.4e-3 -0.216 4.3e-2 64 Click to see details
GSE38226 Liver fibrosis 0.408 3.3e-2 0.162 2.4e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.326 5.6e-2 -0.386 2.8e-2 25 Click to see details
GSE19783 ER- ER- breast cancer -0.177 5.9e-2 -0.124 1.4e-1 79 Click to see details
GSE28260 Renal cortex and medulla 0.356 1.2e-1 0.297 1.6e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.932 1.2e-1 1.000 5.0e-1 3 Click to see details
GSE21032 Prostate cancer -0.102 1.8e-1 -0.195 3.9e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.163 2.5e-1 -0.268 1.3e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.111 3.0e-1 0.114 2.9e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.082 3.3e-1 0.167 1.8e-1 32 Click to see details
GSE17498 Multiple myeloma 0.068 3.4e-1 0.053 3.7e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.124 3.5e-1 -0.236 2.3e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.012 4.8e-1 -0.098 3.4e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.008 4.9e-1 0.068 3.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.384 0 -0.295 0.02 49 Click to see details
KIRC 0.223 0.03 0.226 0.03 68 Click to see details
KIRP -0.258 0.08 -0.301 0.05 32 Click to see details
PRAD 0.177 0.11 0.123 0.2 50 Click to see details
KICH -0.252 0.11 -0.120 0.28 25 Click to see details
STAD -0.215 0.12 -0.172 0.17 32 Click to see details
BLCA -0.245 0.16 -0.077 0.38 18 Click to see details
BRCA -0.097 0.19 -0.083 0.23 84 Click to see details
LUAD -0.231 0.24 -0.406 0.1 12 Click to see details
CHOL -0.274 0.24 -0.300 0.22 9 Click to see details
COAD 0.284 0.25 0.452 0.13 8 Click to see details
HNSC 0.077 0.31 -0.030 0.43 42 Click to see details
PCPG 0.515 0.33 0.500 0.33 3 Click to see details
PAAD 0.285 0.36 0.400 0.3 4 Click to see details
ESCA 0.104 0.38 0.082 0.41 11 Click to see details
CESC 0.254 0.42 0.500 0.33 3 Click to see details
UCEC 0.043 0.43 0.016 0.47 19 Click to see details
LUSC 0.029 0.43 0.043 0.4 38 Click to see details
THCA -0.021 0.44 -0.106 0.21 59 Click to see details
THCA -0.021 0.44 -0.106 0.21 59 Click to see details
THCA -0.021 0.44 -0.106 0.21 59 Click to see details
91 hsa-miR-125b-2-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038624 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT038625 KDELC2 KDEL motif containing 2 1 1
MIRT038626 ABHD15 abhydrolase domain containing 15 1 1
MIRT038627 PPP1R12C protein phosphatase 1 regulatory subunit 12C 1 1
MIRT038628 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT038629 ASH2L ASH2 like histone lysine methyltransferase complex subunit 1 1
MIRT038630 USP22 ubiquitin specific peptidase 22 1 1
MIRT038631 CSTB cystatin B 1 1
MIRT038632 SYT2 synaptotagmin 2 1 1
MIRT038633 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 1 1
MIRT038634 MTA2 metastasis associated 1 family member 2 1 1
MIRT053086 IGF1R insulin like growth factor 1 receptor 3 1
MIRT055788 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT061248 AMOTL1 angiomotin like 1 2 10
MIRT061649 BTG2 BTG anti-proliferation factor 2 2 6
MIRT079046 TNRC6C trinucleotide repeat containing 6C 2 4
MIRT084583 BCL2L11 BCL2 like 11 2 8
MIRT093523 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 2
MIRT097383 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT098030 SOBP sine oculis binding protein homolog 2 2
MIRT186262 TCEB3 elongin A 2 2
MIRT187284 DAZAP2 DAZ associated protein 2 2 10
MIRT361113 LRRC1 leucine rich repeat containing 1 2 2
MIRT443585 FAM84B family with sequence similarity 84 member B 2 2
MIRT452249 TRAM1 translocation associated membrane protein 1 2 2
MIRT476289 GMFB glia maturation factor beta 2 8
MIRT483871 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT484250 ANK1 ankyrin 1 2 2
MIRT499251 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502270 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504652 RPL9 ribosomal protein L9 2 6
MIRT505210 UBN2 ubinuclein 2 2 6
MIRT512690 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT517341 ZNF529 zinc finger protein 529 2 4
MIRT518946 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520866 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT521236 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT528324 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT533297 USP46 ubiquitin specific peptidase 46 2 2
MIRT541024 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT544034 ERRFI1 ERBB receptor feedback inhibitor 1 2 2
MIRT547037 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556102 MOAP1 modulator of apoptosis 1 2 2
MIRT558320 DR1 down-regulator of transcription 1 2 2
MIRT558520 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT566230 PTMA prothymosin, alpha 2 4
MIRT568437 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570584 OTUD7B OTU deubiquitinase 7B 2 2
MIRT571384 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572798 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573864 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT609930 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610437 CSMD2 CUB and Sushi multiple domains 2 2 2
MIRT614407 MURC caveolae associated protein 4 2 2
MIRT618625 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620605 SAP30 Sin3A associated protein 30 2 2
MIRT635313 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635918 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638507 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT640597 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT644066 IQCE IQ motif containing E 2 2
MIRT648287 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT653089 SSR3 signal sequence receptor subunit 3 2 2
MIRT654651 PTAFR platelet activating factor receptor 2 2
MIRT658084 FOXR2 forkhead box R2 2 2
MIRT665306 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665974 SYTL4 synaptotagmin like 4 2 2
MIRT674905 RASSF9 Ras association domain family member 9 2 2
MIRT680085 THAP1 THAP domain containing 1 2 2
MIRT681487 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691243 DFNB59 pejvakin 2 2
MIRT692361 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693034 MB21D1 Mab-21 domain containing 1 2 2
MIRT694478 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696069 ZNF264 zinc finger protein 264 2 2
MIRT696579 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696759 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697306 ZNF652 zinc finger protein 652 2 2
MIRT698736 STX12 syntaxin 12 2 2
MIRT701055 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701197 OTUD3 OTU deubiquitinase 3 2 2
MIRT701334 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT703617 FBXO45 F-box protein 45 2 2
MIRT708893 ZNF780A zinc finger protein 780A 2 2
MIRT711621 DGKH diacylglycerol kinase eta 2 2
MIRT713744 TMEM81 transmembrane protein 81 2 2
MIRT715060 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT719711 CD101 CD101 molecule 2 2
MIRT720293 DLGAP3 DLG associated protein 3 2 2
MIRT722605 CCDC152 coiled-coil domain containing 152 2 2
MIRT724565 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125b-2 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-125b-2 Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-mir-125b-2 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-mir-125b-2 Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, HLE, HuH1)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-125b-2 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-125b-2 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-125b-2 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-125b-2 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT8, HCT-116)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-125b-2-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-125b-2-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-125b-2-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-125b-2-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission