miRTarBase - #MIRT038627


—
pre-miRNA Information
pre-miRNA hsa-mir-125b-2   
Genomic Coordinates chr21: 16590237 - 16590325
Synonyms MIRN125B2, MIR125B2
Description Homo sapiens miR-125b-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-125b-2-3p
Sequence 54| UCACAAGUCAGGCUCUUGGGAC |75
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 21 + 16590292 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs575583557 6 dbSNP
rs1331783293 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPP1R12C   
Synonyms AAVS1, LENG3, MBS85, p84, p85
Description protein phosphatase 1 regulatory subunit 12C
Transcript NM_017607   
Expression
Putative miRNA Targets on PPP1R12C
3'UTR of PPP1R12C
(miRNA target sites are highlighted)		 
>PPP1R12C|NM_017607|3'UTR
   1 CCCGGAGGGACTTTCCCGCACCCGTATTTATACAGCTGCTTCTGCCACACGCACCCCTTCCCCCGTGTGAACACGAGTGA
  81 CAGGGCTCCGGGGGAAGTCTCAGAGAAGCCATAGCCCCCCTGGGACCTCCGGACTGGGAGGGGAGCAGAGTCCCCAGGAG
 161 CCGAGGGGGCCACCCGAGGCCAGGATGGAGGTGGGAGGCCGAGCCAAGCAGGGGGACGTTGCCAGAGGGGACCAGGGCCA
 241 GAGACGGGACCAGGAAGGAACTGAGGACCAAGAAGTGCAAGGATCAGTAGCCAGGACCAGAGTGGCCGCCTGGAGGTCCC
 321 CATCTCACGTGTGATGCCACCCCGTCACCCCTCCCCTCCTGAGCAGGGATCCAAGAATGTGCCAAGAGTCCCGCCAGCCT
 401 CAGCCAGGTGGGCCTGTATATAGGGTCCATGTGCAATAGGGAGGGACGTCTTCTATTTTTTGCTGCCCCCTCCCCGCCCA
 481 CTGTCTGGGGCAGGGGGAGAAGGTATTTTCGAGATAAAGCACAGGCACCACAAATAAAAGTCGTGAAGTTGCCACTCAAA
 561 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caGGGUUCUCGGACUGAACACu 5'
            ||||    :|| || |||| 
Target 5' tcCCCA----TCTCACGTGTGa 3'
 317 - 334 122.00 -12.40
2 
miRNA  3' caggguUCUCGGACUGAACACu 5'
                | |||:  :||| || 
Target 5' atttatACAGCT--GCTTCTGc 3'
 26 - 45 100.00 -6.40
3 
miRNA  3' cagGGUUCUCGGACUGAAcacu 5'
             || :|||   |||||    
Target 5' ---CCCGGAG--GGACTTtccc 3'
 1 - 17 95.00 -10.66
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30101614 3 COSMIC
COSN30502365 3 COSMIC
COSN26439371 18 COSMIC
COSN26990084 32 COSMIC
COSN30676097 48 COSMIC
COSN30168618 89 COSMIC
COSN31577624 114 COSMIC
COSN31562547 344 COSMIC
COSN31546054 393 COSMIC
COSN30540013 491 COSMIC
COSN26573123 520 COSMIC
COSN31546274 545 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs944365518 1 dbSNP
rs779851380 2 dbSNP
rs757758468 3 dbSNP
rs368912034 4 dbSNP
rs1361077622 5 dbSNP
rs778425358 6 dbSNP
rs374836820 7 dbSNP
rs1360733556 10 dbSNP
rs752740644 14 dbSNP
rs544413423 15 dbSNP
rs754979203 17 dbSNP
rs372522834 18 dbSNP
rs1366513406 20 dbSNP
rs1477894495 22 dbSNP
rs766572853 23 dbSNP
rs201023615 24 dbSNP
rs772951489 25 dbSNP
rs767466051 29 dbSNP
rs1163806655 38 dbSNP
rs879084232 40 dbSNP
rs761860223 42 dbSNP
rs1307676344 43 dbSNP
rs1307083518 44 dbSNP
rs774128150 50 dbSNP
rs367675451 51 dbSNP
rs565262132 54 dbSNP
rs950442014 57 dbSNP
rs1296412789 64 dbSNP
rs993255181 65 dbSNP
rs1400852770 74 dbSNP
rs575277411 75 dbSNP
rs1359605181 77 dbSNP
rs1027379738 81 dbSNP
rs1317578576 83 dbSNP
rs994422228 85 dbSNP
rs1285353078 88 dbSNP
rs894821017 89 dbSNP
rs1237412235 94 dbSNP
rs1015657256 95 dbSNP
rs1033795545 96 dbSNP
rs1003457961 111 dbSNP
rs1441659819 112 dbSNP
rs1187956891 115 dbSNP
rs906463965 115 dbSNP
rs545369271 119 dbSNP
rs1437730955 122 dbSNP
rs1157912461 124 dbSNP
rs573194810 127 dbSNP
rs553427519 130 dbSNP
rs1054548875 131 dbSNP
rs935955913 137 dbSNP
rs965005429 139 dbSNP
rs1017491991 140 dbSNP
rs1342844843 141 dbSNP
rs757830171 142 dbSNP
rs921949322 145 dbSNP
rs1309088295 146 dbSNP
rs1009009957 154 dbSNP
rs975188721 162 dbSNP
rs1183028667 163 dbSNP
rs1343842221 172 dbSNP
rs374197470 175 dbSNP
rs1258025195 176 dbSNP
rs536300767 190 dbSNP
rs1242030634 200 dbSNP
rs983560279 201 dbSNP
rs1466506037 208 dbSNP
rs950887249 210 dbSNP
rs574191132 217 dbSNP
rs973117690 218 dbSNP
rs1213484522 219 dbSNP
rs1465720909 229 dbSNP
rs1173321141 231 dbSNP
rs570991987 238 dbSNP
rs1464357941 245 dbSNP
rs959153235 246 dbSNP
rs1033330336 251 dbSNP
rs1448431664 255 dbSNP
rs1292301905 257 dbSNP
rs1329941700 260 dbSNP
rs1003647814 271 dbSNP
rs1257353342 272 dbSNP
rs1315860209 277 dbSNP
rs1197756203 281 dbSNP
rs16986261 288 dbSNP
rs1258676814 291 dbSNP
rs1228906982 295 dbSNP
rs1361436191 306 dbSNP
rs537266634 307 dbSNP
rs748681917 308 dbSNP
rs1432600320 312 dbSNP
rs1199893184 315 dbSNP
rs1367071079 316 dbSNP
rs916159022 325 dbSNP
rs772932511 328 dbSNP
rs769397633 329 dbSNP
rs1463988264 336 dbSNP
rs571544695 339 dbSNP
rs1389424192 340 dbSNP
rs1166541704 342 dbSNP
rs1053655047 343 dbSNP
rs936069008 344 dbSNP
rs966579965 347 dbSNP
rs952803581 353 dbSNP
rs1167236935 356 dbSNP
rs1319667383 357 dbSNP
rs900608142 358 dbSNP
rs1039021751 365 dbSNP
rs1264756345 372 dbSNP
rs1451828340 379 dbSNP
rs551422878 381 dbSNP
rs1193324757 385 dbSNP
rs752304041 388 dbSNP
rs747803569 392 dbSNP
rs534603914 393 dbSNP
rs1254214437 398 dbSNP
rs1424807166 399 dbSNP
rs973658037 403 dbSNP
rs912107377 404 dbSNP
rs1222678262 405 dbSNP
rs565587771 408 dbSNP
rs1272638930 409 dbSNP
rs1230737489 411 dbSNP
rs1458014578 411 dbSNP
rs1008812711 412 dbSNP
rs1344139908 413 dbSNP
rs1298255602 414 dbSNP
rs1358306923 415 dbSNP
rs1385995635 426 dbSNP
rs1298366142 436 dbSNP
rs548969101 437 dbSNP
rs781586140 442 dbSNP
rs528917817 443 dbSNP
rs1311968971 444 dbSNP
rs1322226320 445 dbSNP
rs920758790 447 dbSNP
rs973562488 448 dbSNP
rs959137856 449 dbSNP
rs1436814349 459 dbSNP
rs1369583422 463 dbSNP
rs1200380678 464 dbSNP
rs1033857672 467 dbSNP
rs981779101 472 dbSNP
rs970804299 474 dbSNP
rs1020851473 475 dbSNP
rs755285364 476 dbSNP
rs1424899325 477 dbSNP
rs747542809 478 dbSNP
rs904289970 479 dbSNP
rs1158902272 481 dbSNP
rs563062979 483 dbSNP
rs550738696 484 dbSNP
rs1043813 485 dbSNP
rs1346562774 487 dbSNP
rs1013529205 493 dbSNP
rs894623381 510 dbSNP
rs1057513810 511 dbSNP
rs1306931552 514 dbSNP
rs1374809242 524 dbSNP
rs1431800700 525 dbSNP
rs1009481585 526 dbSNP
rs1043834 527 dbSNP
rs957980662 528 dbSNP
rs1043838 530 dbSNP
rs1285279974 539 dbSNP
rs1032158697 540 dbSNP
rs1191973888 542 dbSNP
rs996712219 543 dbSNP
rs531041382 549 dbSNP
rs780468724 554 dbSNP
rs1236841177 555 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cagggUUCUCGGACUGAacacu 5'
               :| :||: ||||     
Target 5' acgggGACGGCTGGACTcccct 3'
 		19 - 40
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.256 9.7e-3 0.212 2.7e-2 83 Click to see details
GSE21687 Ependynoma primary tumors 0.24 2.8e-2 0.179 7.8e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.394 2.8e-2 -0.275 9.7e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.339 2.9e-2 -0.306 4.4e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.364 4.4e-2 -0.338 5.7e-2 23 Click to see details
GSE19783 ER- ER- breast cancer 0.192 4.5e-2 0.188 4.9e-2 79 Click to see details
GSE28544 Breast cancer -0.295 8.1e-2 -0.276 9.6e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.257 1.1e-1 0.339 4.9e-2 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.245 1.5e-1 -0.144 2.7e-1 20 Click to see details
GSE38226 Liver fibrosis -0.237 1.5e-1 -0.072 3.8e-1 21 Click to see details
GSE28260 Renal cortex and medulla -0.297 1.6e-1 -0.423 7.5e-2 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.202 2.0e-1 0.056 4.1e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.173 2.0e-1 -0.042 4.2e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.798 2.1e-1 1.000 5.0e-1 3 Click to see details
GSE19536 Breast cancer 0.074 2.3e-1 0.136 8.9e-2 100 Click to see details
GSE19350 CNS germ cell tumors 0.01 4.9e-1 0.005 4.9e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.352 0.02 0.306 0.04 32 Click to see details
THCA -0.216 0.05 -0.247 0.03 59 Click to see details
PAAD -0.816 0.09 -0.800 0.1 4 Click to see details
PRAD -0.181 0.1 -0.144 0.16 50 Click to see details
CESC 0.932 0.12 1.000 0.5 3 Click to see details
LUAD 0.333 0.15 0.245 0.22 12 Click to see details
KIRC 0.126 0.15 0.205 0.05 68 Click to see details
COAD 0.368 0.18 0.310 0.23 8 Click to see details
KICH 0.174 0.2 0.221 0.14 25 Click to see details
HNSC 0.124 0.22 0.188 0.12 42 Click to see details
BLCA -0.125 0.31 -0.079 0.38 18 Click to see details
KIRP -0.087 0.32 -0.045 0.4 32 Click to see details
LUSC -0.075 0.33 0.009 0.48 38 Click to see details
CHOL 0.076 0.42 0.017 0.48 9 Click to see details
PCPG 0.182 0.44 0.500 0.33 3 Click to see details
LIHC -0.02 0.45 -0.117 0.21 49 Click to see details
UCEC 0.031 0.45 0.135 0.29 19 Click to see details
BRCA -0.012 0.46 -0.044 0.35 84 Click to see details
ESCA -0.015 0.48 0.191 0.29 11 Click to see details
ESCA -0.015 0.48 0.191 0.29 11 Click to see details
ESCA -0.015 0.48 0.191 0.29 11 Click to see details
91 hsa-miR-125b-2-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038624 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT038625 KDELC2 KDEL motif containing 2 1 1
MIRT038626 ABHD15 abhydrolase domain containing 15 1 1
MIRT038627 PPP1R12C protein phosphatase 1 regulatory subunit 12C 1 1
MIRT038628 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT038629 ASH2L ASH2 like histone lysine methyltransferase complex subunit 1 1
MIRT038630 USP22 ubiquitin specific peptidase 22 1 1
MIRT038631 CSTB cystatin B 1 1
MIRT038632 SYT2 synaptotagmin 2 1 1
MIRT038633 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 1 1
MIRT038634 MTA2 metastasis associated 1 family member 2 1 1
MIRT053086 IGF1R insulin like growth factor 1 receptor 3 1
MIRT055788 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT061248 AMOTL1 angiomotin like 1 2 10
MIRT061649 BTG2 BTG anti-proliferation factor 2 2 6
MIRT079046 TNRC6C trinucleotide repeat containing 6C 2 4
MIRT084583 BCL2L11 BCL2 like 11 2 8
MIRT093523 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 2
MIRT097383 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT098030 SOBP sine oculis binding protein homolog 2 2
MIRT186262 TCEB3 elongin A 2 2
MIRT187284 DAZAP2 DAZ associated protein 2 2 10
MIRT361113 LRRC1 leucine rich repeat containing 1 2 2
MIRT443585 FAM84B family with sequence similarity 84 member B 2 2
MIRT452249 TRAM1 translocation associated membrane protein 1 2 2
MIRT476289 GMFB glia maturation factor beta 2 8
MIRT483871 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT484250 ANK1 ankyrin 1 2 2
MIRT499251 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502270 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504652 RPL9 ribosomal protein L9 2 6
MIRT505210 UBN2 ubinuclein 2 2 6
MIRT512690 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT517341 ZNF529 zinc finger protein 529 2 4
MIRT518946 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520866 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT521236 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT528324 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT533297 USP46 ubiquitin specific peptidase 46 2 2
MIRT541024 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT544034 ERRFI1 ERBB receptor feedback inhibitor 1 2 2
MIRT547037 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556102 MOAP1 modulator of apoptosis 1 2 2
MIRT558320 DR1 down-regulator of transcription 1 2 2
MIRT558520 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT566230 PTMA prothymosin, alpha 2 4
MIRT568437 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570584 OTUD7B OTU deubiquitinase 7B 2 2
MIRT571384 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572798 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573864 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT609930 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610437 CSMD2 CUB and Sushi multiple domains 2 2 2
MIRT614407 MURC caveolae associated protein 4 2 2
MIRT618625 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620605 SAP30 Sin3A associated protein 30 2 2
MIRT635313 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635918 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638507 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT640597 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT644066 IQCE IQ motif containing E 2 2
MIRT648287 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT653089 SSR3 signal sequence receptor subunit 3 2 2
MIRT654651 PTAFR platelet activating factor receptor 2 2
MIRT658084 FOXR2 forkhead box R2 2 2
MIRT665306 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665974 SYTL4 synaptotagmin like 4 2 2
MIRT674905 RASSF9 Ras association domain family member 9 2 2
MIRT680085 THAP1 THAP domain containing 1 2 2
MIRT681487 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691243 DFNB59 pejvakin 2 2
MIRT692361 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693034 MB21D1 Mab-21 domain containing 1 2 2
MIRT694478 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696069 ZNF264 zinc finger protein 264 2 2
MIRT696579 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696759 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697306 ZNF652 zinc finger protein 652 2 2
MIRT698736 STX12 syntaxin 12 2 2
MIRT701055 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701197 OTUD3 OTU deubiquitinase 3 2 2
MIRT701334 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT703617 FBXO45 F-box protein 45 2 2
MIRT708893 ZNF780A zinc finger protein 780A 2 2
MIRT711621 DGKH diacylglycerol kinase eta 2 2
MIRT713744 TMEM81 transmembrane protein 81 2 2
MIRT715060 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT719711 CD101 CD101 molecule 2 2
MIRT720293 DLGAP3 DLG associated protein 3 2 2
MIRT722605 CCDC152 coiled-coil domain containing 152 2 2
MIRT724565 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125b-2 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-125b-2 Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-mir-125b-2 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-mir-125b-2 Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, HLE, HuH1)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-125b-2 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-125b-2 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-125b-2 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-125b-2 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT8, HCT-116)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-125b-2-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-125b-2-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-125b-2-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-125b-2-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission