miRTarBase - #MIRT039221


—
pre-miRNA Information
pre-miRNA hsa-mir-454   
Genomic Coordinates chr17: 59137758 - 59137872
Synonyms MIRN454, hsa-mir-454, MIR454
Description Homo sapiens miR-454 stem-loop
Comment The mature miRNA sequences were named miR-454-5p and miR-454-3p in .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-454-3p
Sequence 64| UAGUGCAAUAUUGCUUAUAGGGU |86
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30529712 20 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1391884708 2 dbSNP
rs772555392 4 dbSNP
rs555225543 7 dbSNP
rs1450965019 11 dbSNP
rs779514158 12 dbSNP
rs771457463 18 dbSNP
rs377123764 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZBTB4   
Synonyms KAISO-L1, ZNF903
Description zinc finger and BTB domain containing 4
Transcript NM_001128833   
Other Transcripts NM_020899   
Expression
Putative miRNA Targets on ZBTB4
3'UTR of ZBTB4
(miRNA target sites are highlighted)		 
>ZBTB4|NM_001128833|3'UTR
   1 ACCCTGGGGCTCAATCCCCCTTTCACCAGATGCCACCCTCCCTGAACCCCCCACCACTACCAGCTCCCTGGCCTCCCTGC
  81 CCCTTGGGAGCCCCTTCACACTCTTGTGCAGGGACTTGGGGGCCCCTGGAGCTCAGGGGTCAGGCTGCTTTGTGTGAGAT
 161 GTAGTTTTCCCATCTCCTGGGAAGGGATCTTTCGAGGTTCCCCTCTCAGTCTTCCTCCAGGGAATGGCCTCCATGAGGGG
 241 CAGGGCCAGCTTCCATCCCTTCTCCAGCCCTTGGGGCAACTGAGCAATATACTTAACCTGAATCTCTACTCACAGCCCCC
 321 ACCAGCTCTGAATGTCTAACCTGCTCCCCTGATTCGTAAACCTAGGGGAAACCATCTCTCTCACCTAATGACCCGCCTTG
 401 TTCTGAAGCTTTCTCTAAGCCCTTCCCAGTTGCTTCCTAGCACATTCCATTCTTTGTGGCCCAGGGCCTGGACCAGACCA
 481 TTGTGATACCTGACCCCGCCCACCTGGGAGTGTGGCTTTGGGTTTCATCCTTCCCCAGCGTGGGTCTCTACGTCCCTGTT
 561 TCCCTTGTATCAAGACACCTTCCTCAGCTTCCATGCCTTTGGATCTTCCATGTTCCTCCCCATATTCCTGGACTTCGGAG
 641 ATGGCCTCTCCCAAGCCAGGTCAAGGAGGTTTGGGGGAGGGTTGCCCCTCTGCCCCTCTGTTCTGTGGCTGAGCACTTTC
 721 CCAGTCCAGGGCAGGGAAATATTGGCCCTATCTTGACCCCCAAATCCAGTGAGCTCCAGATTCTTCCAAGGCAAAAGAGG
 801 TAAGCAGATCACACCTCTTTCTGCCTCTACATATGGCCTATTCTGGGCTAGACCAGATTTGGGGGCCAGGAGGGAAGAAC
 881 TCCATATGGGATGGAGAAGGGAATCTACTTTCTCCCTGTTTTTTTTTCCTGATGGTTTCTCCCAGACTAGACCAAATAGC
 961 CAGAAAAATGATAGGGGTCGGATGGGTGGGTAAGCCCAGGATTTGCACATGACCTTCCATCCTTACCTGTATTCCCATCT
1041 CCCCAGTGTCACTCCCCTCACCAATCACTCCAGATGGTTTTGGGGGAACCATTCTACTCTTCTGGTGGGCTTTGGGGTAT
1121 CCCCACCAACTTTCCCTTCAAAATAGCACCTTACACCCCATCTTTGACTCAGTTCCCCACACCCAAAGATCCCAGCCTAG
1201 GGATGGGGTACAGGGACTTTAAATAGTCCCTAATCCCTAATTTGCACTAGTTAACCCTGGTCAGGGTCCCTGTATTTCCT
1281 TCCAGTGGGGGAGATAAATGTTTGCTCCTAATTCTCTTTGAAAACTGGGCCTCCCTGCTCTGTGATTGGATAAATATTTC
1361 CCATCCCACCCACCTCCCCCCAAAAAATAGCTCACAAGGGGAGAGCCAGTATGGGGGAGCAAATTTGACAAATGGGAATT
1441 AGAGGAGTGCAGTTTTAAAAGGAAAAGTTGCTGTCATCAAAATGGCAGCCTTTTCCCCAGCTACTGTTTTTGGGGCCAAG
1521 ATGGCTGCCCTAGCAGCAATCACTGCCAAGGGCAAGATCATGGCTTTTGGAGGGAGGTGAGTTTAGGGAGGGCCAGGACC
1601 ATCCTCCTACCCCTCATACCCTCCCAGCATATACAAAAGGGGAGGTTTTAGACAGGCTCCCTGAATGTTAACCACAGAGG
1681 AGTCACTCCTTCATTCCTCCTCTGTCTCTTTGCACTTTTCTTGGTCTTGGCCACAGCCTGAGTGACGAATTTCCTACTGA
1761 ATGTACCAAGTTCCAATTTTTAAGGGGGGGAAAGGTTTCAAATGGGGAAAAACACACAAAAAAAAAATCACTAAAAATTC
1841 CCACAAATCTTGTTTCTGGCACTTTAGAAAAACTGCAAAAAAATACGTAATAAAGAATACATATATATATATCTACACAC
1921 AAATTATATATCTATCTATCTATACAGCGGAACCACAAGAGAGACTGAGGAAGGCCTGGAGGCAGGGGCAGAGGTGACGA
2001 CAGTGCCCCTATATCCTTAACCCATACTCCTCTGAGGCAAACAGGCATGGGAAAATGGAAGGGTTGAGGATGGACCGGAG
2081 AATTGGAACTTCAGAATAGGTCAAAATTCCAAAACCATGGACATTTTTTTTTGGGAGAATTGAGATTGTAGACATTTTTT
2161 TTTTCTTAAATATGATCAAGGAAAATAGCTTCCAGAATGTGGTGGTTCTGGGCAACAAATGAGATTGTGGCGACGTGGAG
2241 ATTAAAATATATGTATTTGAGCTGGGGAATTTGAATATTGTGAGTTTCAGATGTTGGAAATTTGGGATTTTGCAGTTTTG
2321 TCTTTTGAAAATGATCAAGTCTTGTCAGTTCGTGCCCTCTTTCCCCATGTTCCCTGGGAAGACGGGTGGTGGCAGAGTGA
2401 GAAGGCCACTGGTTCTGTGCCGCAGCACGCAAAATTTAGAATTCTACAGACTAGCTCTATACGTAGTGAGGACCCAGATT
2481 TAGAGAAACTGACCAATATTTATCTCCGCATTTGTGTGTGTGTCCAACTCTGTAGGCCAATAAACCAACAAGACAAATGA
2561 ACTGTGCTCCACAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugGGA-UAUUCGUUAUAACGUGAu 5'
            ||| ||   :||| ||||||| 
Target 5' tcCCTAATCCCTAAT-TTGCACTa 3'
 1227 - 1249 156.00 -15.80
2 
miRNA  3' ugGGAUAUUCGUUAUAACGUGAu 5'
            ||| | : |  | ||||||| 
Target 5' ctCCTCT-GTCTCT-TTGCACTt 3'
 1697 - 1717 143.00 -10.70
3 
miRNA  3' ugggaUAUUC--GUUAU-AACGUGau 5'
               :||||  ||: | ||||||  
Target 5' ggtggGTAAGCCCAGGATTTGCACat 3'
 985 - 1010 136.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30483518 36 COSMIC
COSN25338950 42 COSMIC
COSN30647397 47 COSMIC
COSN27005503 58 COSMIC
COSN30543528 64 COSMIC
COSN30474787 67 COSMIC
COSN30522279 88 COSMIC
COSN31482886 97 COSMIC
COSN30456124 126 COSMIC
COSN31610716 161 COSMIC
COSN7455486 185 COSMIC
COSN30117657 194 COSMIC
COSN31564926 452 COSMIC
COSN30541446 457 COSMIC
COSN22579379 485 COSMIC
COSN26639745 530 COSMIC
COSN31517518 636 COSMIC
COSN26565797 685 COSMIC
COSN31482019 760 COSMIC
COSN15878524 780 COSMIC
COSN19655922 801 COSMIC
COSN31528603 803 COSMIC
COSN30541263 838 COSMIC
COSN31600960 877 COSMIC
COSN31555230 918 COSMIC
COSN31550142 1057 COSMIC
COSN26586154 1211 COSMIC
COSN31583953 1213 COSMIC
COSN31485030 1546 COSMIC
COSN31531390 1590 COSMIC
COSN31482007 1659 COSMIC
COSN31485874 1746 COSMIC
COSN31481960 1753 COSMIC
COSN31567498 1778 COSMIC
COSN19250792 1789 COSMIC
COSN23839648 1817 COSMIC
COSN20113458 1818 COSMIC
COSN26644745 1819 COSMIC
COSN1728988 1837 COSMIC
COSN31481938 1857 COSMIC
COSN31573043 1901 COSMIC
COSN31543863 1908 COSMIC
COSN31597154 1999 COSMIC
COSN17935242 2078 COSMIC
COSN17638504 2133 COSMIC
COSN23486634 2155 COSMIC
COSN27575179 2155 COSMIC
COSN21400242 2178 COSMIC
COSN9673942 2183 COSMIC
COSN30541252 2407 COSMIC
COSN31537675 2544 COSMIC
COSN31515772 2552 COSMIC
rs9217 2171 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1198301452 2 dbSNP
rs373429072 8 dbSNP
rs745811486 9 dbSNP
rs1177348826 19 dbSNP
rs538086275 21 dbSNP
rs1375877735 25 dbSNP
rs1447324395 29 dbSNP
rs781443119 37 dbSNP
rs755152252 44 dbSNP
rs751662865 46 dbSNP
rs199829683 48 dbSNP
rs753782481 49 dbSNP
rs1010533666 55 dbSNP
rs893358957 59 dbSNP
rs1212084044 60 dbSNP
rs1055989816 61 dbSNP
rs1271586644 75 dbSNP
rs549131771 76 dbSNP
rs928846593 83 dbSNP
rs1179700348 87 dbSNP
rs527396846 95 dbSNP
rs369963786 116 dbSNP
rs1205151715 121 dbSNP
rs1187128372 123 dbSNP
rs868424522 124 dbSNP
rs1459574897 130 dbSNP
rs1166080083 131 dbSNP
rs376962489 134 dbSNP
rs1399519153 137 dbSNP
rs1465914571 141 dbSNP
rs1333069547 155 dbSNP
rs1380333251 162 dbSNP
rs566530732 169 dbSNP
rs1312990224 170 dbSNP
rs1341737034 171 dbSNP
rs551090106 176 dbSNP
rs1222000134 185 dbSNP
rs747575740 193 dbSNP
rs778652678 193 dbSNP
rs918683543 194 dbSNP
rs974041022 195 dbSNP
rs1199850596 208 dbSNP
rs1317802147 208 dbSNP
rs1260332287 217 dbSNP
rs1047338819 222 dbSNP
rs111848741 224 dbSNP
rs1200091172 228 dbSNP
rs1257203009 233 dbSNP
rs111690305 235 dbSNP
rs1423042035 237 dbSNP
rs911125811 262 dbSNP
rs1403542866 279 dbSNP
rs1465416749 283 dbSNP
rs1303052937 287 dbSNP
rs1403957447 292 dbSNP
rs1055900371 293 dbSNP
rs1296989388 297 dbSNP
rs182435232 309 dbSNP
rs1219716409 310 dbSNP
rs985425126 318 dbSNP
rs955378204 322 dbSNP
rs1334972594 325 dbSNP
rs1280724978 329 dbSNP
rs1310799011 331 dbSNP
rs937733898 333 dbSNP
rs926416123 335 dbSNP
rs1421463317 340 dbSNP
rs1029538805 346 dbSNP
rs1484334234 347 dbSNP
rs1475071696 351 dbSNP
rs946442908 353 dbSNP
rs1388273987 354 dbSNP
rs778942402 355 dbSNP
rs115990086 356 dbSNP
rs1022011725 361 dbSNP
rs1379177352 363 dbSNP
rs1010502497 366 dbSNP
rs531815301 378 dbSNP
rs1451105566 383 dbSNP
rs561163601 387 dbSNP
rs955288407 388 dbSNP
rs542786569 390 dbSNP
rs539397385 395 dbSNP
rs374077424 403 dbSNP
rs749424277 413 dbSNP
rs1366170594 418 dbSNP
rs1386734300 420 dbSNP
rs975298478 421 dbSNP
rs777691704 423 dbSNP
rs964464665 434 dbSNP
rs1017055623 441 dbSNP
rs1005961567 455 dbSNP
rs951342593 468 dbSNP
rs1001827171 475 dbSNP
rs1488089112 480 dbSNP
rs1191717452 487 dbSNP
rs146199517 491 dbSNP
rs1337959192 492 dbSNP
rs1045865807 494 dbSNP
rs1437668640 494 dbSNP
rs930149683 495 dbSNP
rs1246716543 496 dbSNP
rs896089235 497 dbSNP
rs1161084560 498 dbSNP
rs918651006 498 dbSNP
rs1457791046 500 dbSNP
rs572373055 508 dbSNP
rs752796104 514 dbSNP
rs545116626 517 dbSNP
rs1313171963 521 dbSNP
rs911261628 531 dbSNP
rs781549719 540 dbSNP
rs1445102559 546 dbSNP
rs1444719259 551 dbSNP
rs1242615137 552 dbSNP
rs985780340 559 dbSNP
rs1287745829 572 dbSNP
rs1321204298 574 dbSNP
rs1222216074 578 dbSNP
rs1267212047 582 dbSNP
rs1001738973 585 dbSNP
rs933885054 587 dbSNP
rs1356040391 588 dbSNP
rs755289151 591 dbSNP
rs1238598491 602 dbSNP
rs1441101165 604 dbSNP
rs977921146 608 dbSNP
rs904938637 610 dbSNP
rs1423953320 612 dbSNP
rs1166088122 622 dbSNP
rs1043443420 631 dbSNP
rs946456400 633 dbSNP
rs1368561351 637 dbSNP
rs1401500094 644 dbSNP
rs1449192274 645 dbSNP
rs752093800 646 dbSNP
rs762662408 655 dbSNP
rs1229015538 656 dbSNP
rs1314739368 664 dbSNP
rs1315948510 669 dbSNP
rs577970529 674 dbSNP
rs1197954436 688 dbSNP
rs1258398911 688 dbSNP
rs1021981213 693 dbSNP
rs1052117490 696 dbSNP
rs1444707931 697 dbSNP
rs1472827288 704 dbSNP
rs1384143874 710 dbSNP
rs933875659 723 dbSNP
rs1477095006 729 dbSNP
rs556526679 732 dbSNP
rs1170600664 738 dbSNP
rs989217868 741 dbSNP
rs1179714034 742 dbSNP
rs1424782780 742 dbSNP
rs1332412357 750 dbSNP
rs959023097 755 dbSNP
rs141653568 757 dbSNP
rs1449076587 760 dbSNP
rs1003629889 762 dbSNP
rs975642380 762 dbSNP
rs1204213860 765 dbSNP
rs963953622 768 dbSNP
rs138647816 790 dbSNP
rs1278838034 805 dbSNP
rs1319717965 806 dbSNP
rs1217311443 813 dbSNP
rs1277439670 815 dbSNP
rs1294511600 816 dbSNP
rs555620588 823 dbSNP
rs1223960454 826 dbSNP
rs1358814738 827 dbSNP
rs1260324595 831 dbSNP
rs1487715438 833 dbSNP
rs984189591 840 dbSNP
rs1264594100 849 dbSNP
rs554150266 852 dbSNP
rs907424288 868 dbSNP
rs1424937658 872 dbSNP
rs1415194347 880 dbSNP
rs951480709 882 dbSNP
rs1374276059 884 dbSNP
rs535371807 885 dbSNP
rs533938347 897 dbSNP
rs1025577409 905 dbSNP
rs1279191983 907 dbSNP
rs1441133976 908 dbSNP
rs1348459717 916 dbSNP
rs1304869550 918 dbSNP
rs1425261790 919 dbSNP
rs1273978052 923 dbSNP
rs1014233482 928 dbSNP
rs1266546100 928 dbSNP
rs1283513143 933 dbSNP
rs568274730 945 dbSNP
rs994319863 949 dbSNP
rs1264746742 958 dbSNP
rs1449192181 959 dbSNP
rs1197392941 963 dbSNP
rs1478597400 969 dbSNP
rs897358815 972 dbSNP
rs1378749855 974 dbSNP
rs566451954 979 dbSNP
rs1043628629 980 dbSNP
rs3177511 982 dbSNP
rs1176283509 999 dbSNP
rs1403479374 1000 dbSNP
rs941466619 1016 dbSNP
rs551446240 1020 dbSNP
rs1010636038 1024 dbSNP
rs889878948 1028 dbSNP
rs749218096 1035 dbSNP
rs933997047 1041 dbSNP
rs1240446374 1043 dbSNP
rs922518143 1046 dbSNP
rs978435582 1066 dbSNP
rs539108552 1070 dbSNP
rs1353655178 1087 dbSNP
rs775129983 1087 dbSNP
rs1208578525 1091 dbSNP
rs915109490 1092 dbSNP
rs1289869521 1114 dbSNP
rs989186535 1122 dbSNP
rs1215989171 1125 dbSNP
rs1452531753 1125 dbSNP
rs568812016 1130 dbSNP
rs1439265095 1134 dbSNP
rs1033860744 1143 dbSNP
rs1217957155 1144 dbSNP
rs981777655 1154 dbSNP
rs1283807079 1168 dbSNP
rs550094538 1175 dbSNP
rs909689905 1176 dbSNP
rs1326773439 1180 dbSNP
rs930044461 1188 dbSNP
rs1024548196 1189 dbSNP
rs1446974540 1190 dbSNP
rs994457766 1195 dbSNP
rs918700486 1197 dbSNP
rs992780914 1199 dbSNP
rs897328041 1211 dbSNP
rs1336057949 1212 dbSNP
rs769125760 1228 dbSNP
rs1291724010 1229 dbSNP
rs1432218436 1245 dbSNP
rs1256496887 1249 dbSNP
rs1345329453 1253 dbSNP
rs1199493691 1265 dbSNP
rs1034771625 1269 dbSNP
rs75312798 1270 dbSNP
rs74820808 1271 dbSNP
rs980350340 1274 dbSNP
rs1017075965 1290 dbSNP
rs1005733445 1300 dbSNP
rs549682240 1305 dbSNP
rs1369148119 1306 dbSNP
rs1476111682 1311 dbSNP
rs1168445853 1316 dbSNP
rs1422656307 1318 dbSNP
rs1466003689 1330 dbSNP
rs531904690 1335 dbSNP
rs1399667993 1336 dbSNP
rs538354436 1345 dbSNP
rs763349708 1346 dbSNP
rs1431005212 1349 dbSNP
rs1334192816 1354 dbSNP
rs1177551888 1359 dbSNP
rs1480316287 1361 dbSNP
rs1010436538 1368 dbSNP
rs143120070 1369 dbSNP
rs1317657042 1376 dbSNP
rs1030793965 1379 dbSNP
rs997940424 1380 dbSNP
rs1188858169 1381 dbSNP
rs1256868542 1382 dbSNP
rs1486230965 1382 dbSNP
rs998176406 1385 dbSNP
rs759107032 1388 dbSNP
rs1241633102 1390 dbSNP
rs1486730959 1409 dbSNP
rs1191408327 1413 dbSNP
rs1207029555 1414 dbSNP
rs1462789296 1416 dbSNP
rs900805636 1420 dbSNP
rs191122288 1425 dbSNP
rs866994414 1447 dbSNP
rs1223828673 1449 dbSNP
rs1465183217 1456 dbSNP
rs942610903 1462 dbSNP
rs1376739993 1470 dbSNP
rs1299090090 1472 dbSNP
rs1216328121 1477 dbSNP
rs888386831 1489 dbSNP
rs1340408077 1491 dbSNP
rs1362001366 1500 dbSNP
rs1287833304 1501 dbSNP
rs779433009 1506 dbSNP
rs945333682 1536 dbSNP
rs1298105743 1541 dbSNP
rs878911502 1558 dbSNP
rs1048203108 1560 dbSNP
rs763511314 1561 dbSNP
rs545724605 1574 dbSNP
rs1407756631 1576 dbSNP
rs1336996980 1577 dbSNP
rs186268476 1581 dbSNP
rs937865441 1600 dbSNP
rs1376350263 1613 dbSNP
rs926374870 1623 dbSNP
rs1486127037 1625 dbSNP
rs760376257 1628 dbSNP
rs1264922578 1633 dbSNP
rs560430262 1636 dbSNP
rs35293352 1643 dbSNP
rs1429676175 1644 dbSNP
rs1199105127 1649 dbSNP
rs149094559 1657 dbSNP
rs938778377 1665 dbSNP
rs1360619933 1672 dbSNP
rs1291210386 1673 dbSNP
rs1365907642 1675 dbSNP
rs971728223 1676 dbSNP
rs1304406013 1678 dbSNP
rs980532323 1680 dbSNP
rs961588873 1682 dbSNP
rs1308553286 1699 dbSNP
rs1022326728 1704 dbSNP
rs1217860296 1710 dbSNP
rs1203341982 1711 dbSNP
rs1488017054 1718 dbSNP
rs1214047961 1727 dbSNP
rs1254677919 1728 dbSNP
rs1437370323 1733 dbSNP
rs988973640 1735 dbSNP
rs1204656798 1739 dbSNP
rs577987066 1740 dbSNP
rs1017208928 1746 dbSNP
rs1161891528 1746 dbSNP
rs867721165 1747 dbSNP
rs1326942483 1764 dbSNP
rs954377298 1770 dbSNP
rs1206510988 1776 dbSNP
rs997909175 1778 dbSNP
rs1028392531 1782 dbSNP
rs1307964825 1782 dbSNP
rs34055023 1785 dbSNP
rs901171639 1787 dbSNP
rs1042328910 1788 dbSNP
rs1225470782 1791 dbSNP
rs544587458 1792 dbSNP
rs1384432698 1793 dbSNP
rs8081449 1794 dbSNP
rs1006997953 1803 dbSNP
rs555657293 1804 dbSNP
rs1395129286 1813 dbSNP
rs34779616 1813 dbSNP
rs1400483578 1815 dbSNP
rs1300209060 1817 dbSNP
rs1462846716 1818 dbSNP
rs10729 1819 dbSNP
rs879048676 1819 dbSNP
rs1456325340 1821 dbSNP
rs1197603079 1823 dbSNP
rs201431888 1828 dbSNP
rs1412475468 1829 dbSNP
rs1481312562 1829 dbSNP
rs34579688 1829 dbSNP
rs371036148 1829 dbSNP
rs397732975 1829 dbSNP
rs398078866 1829 dbSNP
rs532290650 1829 dbSNP
rs565204151 1829 dbSNP
rs1231122638 1834 dbSNP
rs1475135743 1841 dbSNP
rs1166292171 1850 dbSNP
rs879190893 1854 dbSNP
rs1420470072 1856 dbSNP
rs1053654912 1869 dbSNP
rs1464445773 1873 dbSNP
rs1330908319 1875 dbSNP
rs1354398568 1885 dbSNP
rs1355294100 1885 dbSNP
rs550394903 1885 dbSNP
rs926484649 1887 dbSNP
rs994052895 1888 dbSNP
rs540028615 1899 dbSNP
rs1386014581 1900 dbSNP
rs1046146399 1904 dbSNP
rs774256345 1906 dbSNP
rs572991325 1908 dbSNP
rs971697241 1910 dbSNP
rs1044393346 1912 dbSNP
rs1189253213 1914 dbSNP
rs746775254 1914 dbSNP
rs963056565 1914 dbSNP
rs1411801131 1920 dbSNP
rs989030758 1923 dbSNP
rs1273808474 1925 dbSNP
rs956290965 1928 dbSNP
rs923412353 1929 dbSNP
rs910115201 1933 dbSNP
rs557594553 1935 dbSNP
rs181554683 1943 dbSNP
rs965145395 1945 dbSNP
rs976272561 1945 dbSNP
rs1217113885 1948 dbSNP
rs984399090 1949 dbSNP
rs188907364 1950 dbSNP
rs1028948098 1954 dbSNP
rs998366142 1955 dbSNP
rs1283287544 1963 dbSNP
rs1487561293 1964 dbSNP
rs1291928083 1978 dbSNP
rs1243050616 1998 dbSNP
rs550165878 1999 dbSNP
rs965807886 2000 dbSNP
rs770949136 2002 dbSNP
rs1338291520 2003 dbSNP
rs1394744052 2007 dbSNP
rs1021014479 2010 dbSNP
rs1435610563 2012 dbSNP
rs186060676 2015 dbSNP
rs1009506519 2020 dbSNP
rs1358719328 2023 dbSNP
rs577956250 2030 dbSNP
rs1318978274 2031 dbSNP
rs1346734571 2038 dbSNP
rs893836990 2046 dbSNP
rs1392274294 2047 dbSNP
rs1371213622 2050 dbSNP
rs1032213009 2077 dbSNP
rs1306715390 2078 dbSNP
rs1002572366 2081 dbSNP
rs1205043417 2089 dbSNP
rs1285631874 2100 dbSNP
rs181567261 2105 dbSNP
rs905114110 2117 dbSNP
rs549650609 2124 dbSNP
rs1162689501 2125 dbSNP
rs1046624052 2133 dbSNP
rs1003151667 2134 dbSNP
rs572999573 2134 dbSNP
rs1159055254 2136 dbSNP
rs1410124845 2148 dbSNP
rs527911297 2150 dbSNP
rs12453572 2151 dbSNP
rs1394946758 2156 dbSNP
rs1036135659 2158 dbSNP
rs1442641861 2161 dbSNP
rs941661235 2165 dbSNP
rs1280813469 2166 dbSNP
rs1320422660 2166 dbSNP
rs914550866 2166 dbSNP
rs1365697053 2169 dbSNP
rs9217 2171 dbSNP
rs773407368 2181 dbSNP
rs923548020 2184 dbSNP
rs533486632 2190 dbSNP
rs1215776404 2196 dbSNP
rs1179894440 2199 dbSNP
rs932857011 2200 dbSNP
rs1236632779 2202 dbSNP
rs371972614 2204 dbSNP
rs1182572598 2211 dbSNP
rs1208662398 2212 dbSNP
rs976270128 2213 dbSNP
rs977295707 2232 dbSNP
rs748393027 2233 dbSNP
rs1168052115 2235 dbSNP
rs1262111866 2236 dbSNP
rs189182868 2246 dbSNP
rs1391632744 2252 dbSNP
rs529294062 2256 dbSNP
rs1338200273 2266 dbSNP
rs1413473234 2267 dbSNP
rs562009083 2269 dbSNP
rs781353534 2276 dbSNP
rs965286628 2278 dbSNP
rs1239408135 2279 dbSNP
rs910724699 2281 dbSNP
rs1250010488 2282 dbSNP
rs1338928822 2284 dbSNP
rs1196605420 2286 dbSNP
rs772416355 2291 dbSNP
rs1252747033 2302 dbSNP
rs1440826733 2303 dbSNP
rs1187109769 2316 dbSNP
rs988220752 2325 dbSNP
rs1258180196 2326 dbSNP
rs1328875486 2335 dbSNP
rs1286900438 2336 dbSNP
rs985584218 2350 dbSNP
rs1372299613 2351 dbSNP
rs1348946919 2352 dbSNP
rs952482246 2353 dbSNP
rs958030455 2355 dbSNP
rs1399420973 2356 dbSNP
rs1433614534 2362 dbSNP
rs1312773635 2364 dbSNP
rs1356619599 2368 dbSNP
rs1417187000 2369 dbSNP
rs1293795371 2370 dbSNP
rs1032266992 2384 dbSNP
rs1228411532 2385 dbSNP
rs1253350498 2392 dbSNP
rs75345110 2393 dbSNP
rs1210195642 2398 dbSNP
rs755164520 2410 dbSNP
rs1047300 2416 dbSNP
rs961267766 2422 dbSNP
rs905082560 2423 dbSNP
rs1159334148 2424 dbSNP
rs1375615504 2429 dbSNP
rs1035608612 2430 dbSNP
rs1173665520 2453 dbSNP
rs747426046 2458 dbSNP
rs1437118286 2460 dbSNP
rs1410058851 2463 dbSNP
rs1156629129 2464 dbSNP
rs1383166383 2480 dbSNP
rs1298223980 2490 dbSNP
rs1368984628 2497 dbSNP
rs1233860068 2505 dbSNP
rs753161493 2509 dbSNP
rs572986028 2515 dbSNP
rs1213546728 2525 dbSNP
rs1260126139 2525 dbSNP
rs905656578 2534 dbSNP
rs1022812244 2557 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugggauauucguuauAACGUGAu 5'
                         ||||||| 
Target 5' ----------ucucuUUGCACUu 3'
 		1 - 13
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 57659.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000380599.4 | 3UTR | UCUCUUUGCACUUUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000380599.4 | 3UTR | UCUCUUUGCACUUUUCUUGGUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000380599.4 | 3UTR | UCACUCCUUCAUUCCUCCUCUGUCUCUUUGCACUUUUCUUGGUCUUGGCCACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000380599.4 | 3UTR | UCUCUUUGCACUUUUCUUGGUCUUGGCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.591 1.2e-3 -0.629 5.0e-4 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.439 1.8e-2 -0.423 2.2e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.581 1.9e-2 -0.555 2.4e-2 13 Click to see details
GSE19783 ER- ER- breast cancer -0.209 3.2e-2 -0.197 4.1e-2 79 Click to see details
GSE17306 Multiple myeloma -0.262 3.4e-2 -0.231 5.5e-2 49 Click to see details
GSE21849 B cell lymphoma -0.297 5.9e-2 -0.275 7.4e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.338 7.2e-2 -0.377 5.1e-2 20 Click to see details
GSE27834 Pluripotent stem cells -0.318 1.2e-1 -0.438 4.5e-2 16 Click to see details
GSE19536 Breast cancer -0.117 1.2e-1 -0.156 6.1e-2 100 Click to see details
GSE21032 Prostate cancer -0.118 1.4e-1 -0.104 1.7e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.218 1.5e-1 0.242 1.2e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.118 1.8e-1 -0.080 2.6e-1 64 Click to see details
GSE32688 Pancreatic cancer -0.157 2.0e-1 -0.136 2.3e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.088 2.0e-1 0.128 1.1e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.306 2.1e-1 0.283 2.3e-1 9 Click to see details
GSE38226 Liver fibrosis 0.129 2.9e-1 0.169 2.3e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.16 3.1e-1 0.154 3.2e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.032 4.4e-1 -0.036 4.3e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.028 4.5e-1 -0.016 4.7e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.029 4.5e-1 -0.159 2.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.667 0 -0.662 0 32 Click to see details
ESCA -0.805 0 -0.745 0 11 Click to see details
CHOL -0.829 0 -0.950 0 9 Click to see details
KIRP -0.44 0.01 -0.446 0.01 32 Click to see details
KIRC -0.287 0.01 -0.241 0.02 68 Click to see details
BLCA -0.564 0.01 -0.566 0.01 17 Click to see details
HNSC -0.327 0.02 -0.252 0.05 42 Click to see details
PRAD -0.228 0.06 -0.257 0.04 50 Click to see details
LIHC 0.197 0.09 0.105 0.24 49 Click to see details
THCA 0.151 0.13 0.172 0.1 59 Click to see details
PAAD -0.561 0.22 -0.400 0.3 4 Click to see details
BRCA -0.081 0.23 -0.170 0.06 83 Click to see details
KICH -0.111 0.3 -0.255 0.11 25 Click to see details
CESC -0.529 0.32 -0.500 0.33 3 Click to see details
LUAD -0.144 0.33 -0.154 0.32 12 Click to see details
UCEC -0.075 0.38 -0.161 0.26 19 Click to see details
PCPG 0.272 0.41 -0.500 0.33 3 Click to see details
LUSC -0.019 0.45 -0.003 0.49 38 Click to see details
LUSC -0.019 0.45 -0.003 0.49 38 Click to see details
373 hsa-miR-454-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007251 SMAD4 SMAD family member 4 5 8
MIRT039219 KCTD12 potassium channel tetramerization domain containing 12 1 1
MIRT039220 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT039221 ZBTB4 zinc finger and BTB domain containing 4 2 7
MIRT039222 SPTSSA serine palmitoyltransferase small subunit A 1 1
MIRT039223 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT039224 METTL2A methyltransferase like 2A 1 1
MIRT039225 C6orf120 chromosome 6 open reading frame 120 1 1
MIRT039226 CSPP1 centrosome and spindle pole associated protein 1 1 1
MIRT039227 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT039228 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT039229 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT039230 RPL4 ribosomal protein L4 1 1
MIRT039231 POLR2A RNA polymerase II subunit A 1 1
MIRT039232 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT039233 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT039234 SIK3 SIK family kinase 3 1 1
MIRT039235 ZNF805 zinc finger protein 805 1 1
MIRT039236 TET1 tet methylcytosine dioxygenase 1 1 1
MIRT039237 HMGXB3 HMG-box containing 3 1 1
MIRT039238 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT039239 PCSK6 proprotein convertase subtilisin/kexin type 6 1 1
MIRT039240 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT039241 MED12 mediator complex subunit 12 1 1
MIRT039242 FLNC filamin C 1 1
MIRT039243 STK38 serine/threonine kinase 38 1 1
MIRT039244 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT039245 TP53 tumor protein p53 1 1
MIRT039246 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT039247 PPP1R7 protein phosphatase 1 regulatory subunit 7 1 1
MIRT039248 GID4 GID complex subunit 4 homolog 1 1
MIRT039249 PHF12 PHD finger protein 12 2 3
MIRT039250 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT057500 CEP55 centrosomal protein 55 2 4
MIRT060511 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT061519 OTUD3 OTU deubiquitinase 3 2 2
MIRT061804 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT062715 MLEC malectin 2 4
MIRT063602 FBXO28 F-box protein 28 2 2
MIRT064810 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT065626 CLIC4 chloride intracellular channel 4 2 4
MIRT065898 RAB5B RAB5B, member RAS oncogene family 2 8
MIRT071011 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT071920 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT075119 C16ORF70 chromosome 16 open reading frame 70 2 4
MIRT076031 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 6
MIRT079272 NPTX1 neuronal pentraxin 1 2 2
MIRT079362 CCDC137 coiled-coil domain containing 137 2 2
MIRT081131 LDLR low density lipoprotein receptor 2 6
MIRT083130 BTBD3 BTB domain containing 3 2 12
MIRT083156 SEC23B Sec23 homolog B, coat complex II component 2 4
MIRT086442 NABP1 nucleic acid binding protein 1 2 6
MIRT087868 CBY1 chibby family member 1, beta catenin antagonist 2 4
MIRT088348 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT090809 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT090904 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT091219 USP13 ubiquitin specific peptidase 13 2 2
MIRT091700 TGFBR2 transforming growth factor beta receptor 2 2 6
MIRT092494 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT095388 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096901 ERBB2IP erbb2 interacting protein 2 2
MIRT097422 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT097465 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT099324 QKI QKI, KH domain containing RNA binding 2 4
MIRT099841 SOX4 SRY-box 4 2 10
MIRT100782 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT101821 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT102154 POP7 POP7 homolog, ribonuclease P/MRP subunit 2 4
MIRT102235 HBP1 HMG-box transcription factor 1 2 2
MIRT102624 UBN2 ubinuclein 2 2 8
MIRT105313 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT105436 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT105807 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT107283 FAM73B mitoguardin 2 2 2
MIRT108268 HABP4 hyaluronan binding protein 4 2 4
MIRT108885 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT109677 KLHL15 kelch like family member 15 2 6
MIRT109831 MID1IP1 MID1 interacting protein 1 2 8
MIRT123867 FZD6 frizzled class receptor 6 2 8
MIRT126574 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT130148 TXNIP thioredoxin interacting protein 2 6
MIRT132502 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT134787 CCND2 cyclin D2 2 2
MIRT139885 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT142443 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT154001 PRNP prion protein 2 2
MIRT162279 LMLN leishmanolysin like peptidase 2 4
MIRT164540 MSMO1 methylsterol monooxygenase 1 2 2
MIRT178076 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT178935 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT179073 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT180851 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 4
MIRT182976 TROVE2 TROVE domain family member 2 2 2
MIRT193030 TMOD3 tropomodulin 3 2 8
MIRT195765 ATMIN ATM interactor 2 6
MIRT196627 TAOK1 TAO kinase 1 2 6
MIRT212153 CLCN3 chloride voltage-gated channel 3 2 4
MIRT217615 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT220701 MTPN myotrophin 2 4
MIRT222278 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT223641 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 4
MIRT224762 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT227998 NFIB nuclear factor I B 2 4
MIRT230983 PRRG4 proline rich and Gla domain 4 2 2
MIRT242671 SALL3 spalt like transcription factor 3 2 4
MIRT243099 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT244079 EDN1 endothelin 1 2 2
MIRT246462 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT248079 SLC38A2 solute carrier family 38 member 2 2 4
MIRT270943 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT295182 ZNF317 zinc finger protein 317 2 4
MIRT296535 STX16 syntaxin 16 2 2
MIRT301578 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT316378 PPP1R14C protein phosphatase 1 regulatory inhibitor subunit 14C 2 2
MIRT323697 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT327914 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT367113 ZNF711 zinc finger protein 711 2 4
MIRT368759 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT407342 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT448324 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448957 CDK19 cyclin dependent kinase 19 2 4
MIRT449145 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT454117 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT459833 TPP1 tripeptidyl peptidase 1 2 2
MIRT460418 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT461658 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT462949 ZNF800 zinc finger protein 800 2 12
MIRT463646 YY1 YY1 transcription factor 2 8
MIRT464853 RPS27A ribosomal protein S27a 2 12
MIRT464873 UBB ubiquitin B 2 8
MIRT466321 THRA thyroid hormone receptor, alpha 2 2
MIRT466828 STX6 syntaxin 6 2 6
MIRT467415 SNTB1 syntrophin beta 1 2 4
MIRT467456 SNAPIN SNAP associated protein 2 2
MIRT468561 SERINC3 serine incorporator 3 2 10
MIRT469808 RAB14 RAB14, member RAS oncogene family 2 2
MIRT469869 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470335 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473777 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474740 KIF13A kinesin family member 13A 2 6
MIRT474957 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT475482 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT476297 GMFB glia maturation factor beta 2 10
MIRT477365 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477491 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478112 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479819 CCNA2 cyclin A2 2 6
MIRT480020 CAPRIN2 caprin family member 2 2 4
MIRT480841 BLCAP bladder cancer associated protein 2 10
MIRT481612 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT481871 ANKRD50 ankyrin repeat domain 50 2 2
MIRT484940 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485124 SECISBP2L SECIS binding protein 2 like 2 4
MIRT485438 KLF6 Kruppel like factor 6 2 2
MIRT485572 FOXQ1 forkhead box Q1 2 2
MIRT485647 DICER1 dicer 1, ribonuclease III 2 8
MIRT486744 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT490885 OSBP oxysterol binding protein 2 2
MIRT491424 PDZD11 PDZ domain containing 11 2 4
MIRT491646 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491792 ZNF24 zinc finger protein 24 2 2
MIRT492269 SIK1 salt inducible kinase 1 2 6
MIRT493093 MMGT1 membrane magnesium transporter 1 2 12
MIRT498068 SNX5 sorting nexin 5 2 6
MIRT498875 ZNF12 zinc finger protein 12 2 10
MIRT499895 KIAA1191 KIAA1191 2 4
MIRT500406 ZMAT3 zinc finger matrin-type 3 2 10
MIRT500732 TRIM37 tripartite motif containing 37 2 2
MIRT500921 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT501472 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 8
MIRT501552 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501785 NRBF2 nuclear receptor binding factor 2 2 6
MIRT501993 MAPK1 mitogen-activated protein kinase 1 2 10
MIRT502012 MAP7 microtubule associated protein 7 2 8
MIRT502417 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT502517 ESR1 estrogen receptor 1 2 2
MIRT502758 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT503052 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 2 2
MIRT503473 ZNF154 zinc finger protein 154 2 6
MIRT503676 SLC46A1 solute carrier family 46 member 1 2 2
MIRT504270 PARP1 poly(ADP-ribose) polymerase 1 2 6
MIRT504554 ZNF417 zinc finger protein 417 2 6
MIRT504683 ATP6V0D1 ATPase H+ transporting V0 subunit d1 2 6
MIRT505250 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT505876 POLR1B RNA polymerase I subunit B 2 4
MIRT506465 NACC2 NACC family member 2 2 4
MIRT506506 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506690 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT507905 CALM2 calmodulin 2 2 6
MIRT509659 ZNF354B zinc finger protein 354B 2 10
MIRT510724 SPG20 spartin 2 6
MIRT510863 RAN RAN, member RAS oncogene family 2 8
MIRT511092 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511247 KLHL36 kelch like family member 36 2 6
MIRT513212 RFT1 RFT1 homolog 2 2
MIRT513618 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT513716 RBM20 RNA binding motif protein 20 2 4
MIRT513910 GRB10 growth factor receptor bound protein 10 2 6
MIRT514366 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT517865 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT521314 RRAGD Ras related GTP binding D 2 4
MIRT521697 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 8
MIRT521771 PPIG peptidylprolyl isomerase G 2 8
MIRT524502 CEP170 centrosomal protein 170 2 4
MIRT527459 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT530125 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530844 RAG1 recombination activating 1 2 4
MIRT531099 PEX13 peroxisomal biogenesis factor 13 2 2
MIRT533490 TRIM71 tripartite motif containing 71 2 2
MIRT534267 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534718 RFX7 regulatory factor X7 2 2
MIRT535265 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 4
MIRT536337 LEFTY1 left-right determination factor 1 2 2
MIRT536405 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT538270 CUL3 cullin 3 2 4
MIRT538411 COX20 COX20, cytochrome c oxidase assembly factor 2 2
MIRT539457 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT540445 RBM43 RNA binding motif protein 43 2 2
MIRT541131 RAB34 RAB34, member RAS oncogene family 2 2
MIRT543568 RPF2 ribosome production factor 2 homolog 2 4
MIRT544105 IPMK inositol polyphosphate multikinase 2 2
MIRT544487 TRIM4 tripartite motif containing 4 2 2
MIRT544690 ZNF224 zinc finger protein 224 2 4
MIRT544986 MFF mitochondrial fission factor 2 4
MIRT546273 TMEM30A transmembrane protein 30A 2 4
MIRT546562 SATB2 SATB homeobox 2 2 2
MIRT546654 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT546774 RLIM ring finger protein, LIM domain interacting 2 2
MIRT546956 SFTPA1 surfactant protein A1 2 2
MIRT547040 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547494 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547911 HOXA5 homeobox A5 2 2
MIRT548401 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548479 EGLN3 egl-9 family hypoxia inducible factor 3 2 2
MIRT548645 DAPK1 death associated protein kinase 1 2 2
MIRT548852 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT548889 CHEK2 checkpoint kinase 2 2 4
MIRT549138 BRWD1 bromodomain and WD repeat domain containing 1 2 4
MIRT549183 BMP3 bone morphogenetic protein 3 2 2
MIRT549335 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549433 ACVR1 activin A receptor type 1 2 2
MIRT549463 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549491 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT550212 MAVS mitochondrial antiviral signaling protein 2 4
MIRT551702 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT552152 DAD1 defender against cell death 1 2 2
MIRT552358 ZNF620 zinc finger protein 620 2 2
MIRT552521 ZIC5 Zic family member 5 2 2
MIRT552848 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT552885 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553307 TSPAN3 tetraspanin 3 2 2
MIRT553347 TRPC3 transient receptor potential cation channel subfamily C member 3 5 4
MIRT553714 TCF7L2 transcription factor 7 like 2 2 2
MIRT553895 SUN2 Sad1 and UNC84 domain containing 2 2 4
MIRT554851 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT555078 PURG purine rich element binding protein G 2 2
MIRT555198 PRUNE2 prune homolog 2 2 2
MIRT556193 MCC mutated in colorectal cancers 2 2
MIRT556224 MB21D2 Mab-21 domain containing 2 2 2
MIRT556482 LIPA lipase A, lysosomal acid type 2 2
MIRT556965 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT557022 HOXD11 homeobox D11 2 2
MIRT557076 HOXB3 homeobox B3 2 2
MIRT557580 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT558280 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT558415 DEPDC1 DEP domain containing 1 2 2
MIRT558769 CFL2 cofilin 2 2 2
MIRT559632 AKIRIN2 akirin 2 2 2
MIRT560230 KLHL21 kelch like family member 21 2 4
MIRT560649 ZNF107 zinc finger protein 107 2 2
MIRT560931 CDK2AP2 cyclin dependent kinase 2 associated protein 2 2 2
MIRT563754 ZNF678 zinc finger protein 678 2 2
MIRT566007 RNF11 ring finger protein 11 2 2
MIRT566158 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT566692 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT567065 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567532 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567767 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT567831 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT571621 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT573076 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT610908 NF2 neurofibromin 2 2 2
MIRT620056 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT623177 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT627016 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627082 SF3A1 splicing factor 3a subunit 1 2 2
MIRT628280 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629099 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629239 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629415 ADM2 adrenomedullin 2 2 2
MIRT629590 RFC2 replication factor C subunit 2 2 2
MIRT629643 WDR31 WD repeat domain 31 2 2
MIRT629804 GPR82 G protein-coupled receptor 82 2 2
MIRT629878 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629922 POLR2D RNA polymerase II subunit D 2 2
MIRT629987 NARS asparaginyl-tRNA synthetase 2 2
MIRT630048 TERF2 telomeric repeat binding factor 2 2 2
MIRT630066 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630161 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630256 SMTNL2 smoothelin like 2 2 2
MIRT630286 PSMB5 proteasome subunit beta 5 2 2
MIRT630350 NKAP NFKB activating protein 2 2
MIRT630500 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT632051 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT632476 RPS15A ribosomal protein S15a 2 2
MIRT632603 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632999 DUSP18 dual specificity phosphatase 18 2 2
MIRT633086 CXorf21 chromosome X open reading frame 21 2 2
MIRT635056 MYH11 myosin heavy chain 11 2 2
MIRT635949 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636660 CDK4 cyclin dependent kinase 4 2 2
MIRT637191 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637930 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT641813 USP32 ubiquitin specific peptidase 32 2 2
MIRT642648 PTGR2 prostaglandin reductase 2 2 2
MIRT644240 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644669 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645097 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645997 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646512 FAM217B family with sequence similarity 217 member B 2 2
MIRT646778 IL23R interleukin 23 receptor 2 2
MIRT648519 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT651469 XIAP X-linked inhibitor of apoptosis 2 2
MIRT654353 RBM27 RNA binding motif protein 27 2 2
MIRT660831 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT661183 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT661244 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662847 OMD osteomodulin 2 2
MIRT662922 MED18 mediator complex subunit 18 2 2
MIRT663549 CCR6 C-C motif chemokine receptor 6 2 2
MIRT664360 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT666085 SSTR2 somatostatin receptor 2 2 2
MIRT666261 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666681 RBM23 RNA binding motif protein 23 2 2
MIRT667233 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667760 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669264 C4orf36 chromosome 4 open reading frame 36 2 2
MIRT671480 FLYWCH2 FLYWCH family member 2 2 2
MIRT671502 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671930 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672297 GP2 glycoprotein 2 2 2
MIRT672608 IRF1 interferon regulatory factor 1 2 2
MIRT674033 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674225 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674535 PRR23A proline rich 23A 2 2
MIRT675107 SNTB2 syntrophin beta 2 2 2
MIRT675273 ZNF431 zinc finger protein 431 2 2
MIRT684270 PRPF4 pre-mRNA processing factor 4 2 2
MIRT694280 ZNF529 zinc finger protein 529 2 4
MIRT698253 TMEM2 transmembrane protein 2 2 2
MIRT699912 RUNDC1 RUN domain containing 1 2 2
MIRT702594 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT705199 BTG1 BTG anti-proliferation factor 1 2 2
MIRT706927 THAP6 THAP domain containing 6 2 2
MIRT708878 MOCS2 molybdenum cofactor synthesis 2 2 2
MIRT709115 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709615 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT710589 CDCA4 cell division cycle associated 4 2 2
MIRT710793 IFNLR1 interferon lambda receptor 1 2 2
MIRT711775 RFXAP regulatory factor X associated protein 2 2
MIRT713336 KLRD1 killer cell lectin like receptor D1 2 2
MIRT713633 MED8 mediator complex subunit 8 2 2
MIRT713907 IGF2R insulin like growth factor 2 receptor 2 2
MIRT715061 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715178 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT715196 FKTN fukutin 2 2
MIRT715272 RNF125 ring finger protein 125 2 2
MIRT717800 FAM114A1 family with sequence similarity 114 member A1 2 2
MIRT720536 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT736758 TSPAN1 tetraspanin 1 4 0
MIRT736759 FAM83A family with sequence similarity 83 member A 4 0
MIRT736761 SBF2 SET binding factor 2 3 0
MIRT736853 FRZB frizzled-related protein 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-454 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-454-3p 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-454-3p Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-454-3p Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-454 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-454 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-454-3p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-(benzyloxy)cyclopentyl)methanol 385240 NSC676353 sensitive
hsa-miR-454-3p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-454-3p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-454-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-454-3p (2e)-5,6-dimethoxy-2-[(3-phenacyloxyphenyl)methylidene]-3h-inden-1-one 45028869 NSC744650 sensitive
hsa-miR-454-3p (3S,8R,9S,10R,13S,14S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthrene-3,17-diol 24204037 NSC730478 resistant
hsa-miR-454-3p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-454-3p (4-(1,3-dihydro-2h-pyrrolo[3,4-b]quinolin-2-ylcarbonyl)-2-oxotetrahydro-3-furanyl)methyl acetate 283490 NSC138333 sensitive
hsa-miR-454-3p (4E,5Z)-4,5-bis[(6-bromoquinazolin-4-yl)hydrazinylidene]pentane-1,2,3-triol 54611941 NSC716031 sensitive
hsa-miR-454-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-454-3p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-454-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-454-3p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-454-3p (5e)-2-[[5-methyl-4-[5-methyl-2-[[(5e)-5-[(4-methylphenyl)methylidene]-4-oxo-1,3-thiazol-2-yl]amino]-1,3-thiazol-4-yl]-1,3-thiazol-2-yl]amino]-5-[(4-methylphenyl)methylidene]-1,3-thiazol-4-one NSC730523 resistant
hsa-miR-454-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-454-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-454-3p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-454-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-454-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-454-3p (E)-3-(4-phenylphenyl)-1-thiophen-2-ylprop-2-en-1-one 5782484 NSC700125 sensitive
hsa-miR-454-3p (e)-5-morpholin-4-yl-1,2-diphenylpent-1-en-3-one;hydrochloride 5386798 NSC617826 sensitive
hsa-miR-454-3p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 sensitive
hsa-miR-454-3p (z)-1-(5-chloro-2-hydroxyphenyl)-3-quinolin-2-ylprop-2-en-1-one NSC71097 sensitive
hsa-miR-454-3p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 sensitive
hsa-miR-454-3p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-454-3p [(2r,3s,4r,5r)-5-(6-chloropurin-9-yl)-4-hydroxy-2-(trityloxymethyl)oxolan-3-yl] benzoate 401669 NSC715399 sensitive
hsa-miR-454-3p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-454-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-454-3p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24204032 NSC730473 resistant
hsa-miR-454-3p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 sensitive
hsa-miR-454-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 sensitive
hsa-miR-454-3p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 sensitive
hsa-miR-454-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-454-3p [2-[[5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-3-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 6712908 NSC719661 sensitive
hsa-miR-454-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-454-3p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-454-3p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 sensitive
hsa-miR-454-3p 1-(3-chlorophenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5494177 NSC668335 sensitive
hsa-miR-454-3p 1-(4-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465916 NSC668325 sensitive
hsa-miR-454-3p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-454-3p 1-[(E)-(5-hydroxypyridin-2-yl)methylideneamino]-3-pyridin-3-ylthiourea 135443616 NSC185065 sensitive
hsa-miR-454-3p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-454-3p 1-[(E)-1H-indol-3-ylmethylideneamino]-2-phenylguanidine;nitric acid 135439995 NSC644582 resistant
hsa-miR-454-3p 1-[(z)-(2-oxoindolin-3-ylidene)amino]-3-(2-pyridylmethyl)thiourea 3005083 NSC670961 sensitive
hsa-miR-454-3p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-454-3p 1-[2-(2-pyridyl)ethyl]-3-[(e)-2-pyridylmethyleneamino]thiourea 9571904 NSC670779 sensitive
hsa-miR-454-3p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-454-3p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 resistant
hsa-miR-454-3p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 sensitive
hsa-miR-454-3p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]thiourea 5871897 NSC689540 sensitive
hsa-miR-454-3p 11-[(E)-2-(dimethylamino)ethenyl]pyrido[2,3-b]acridine-5,12-dione 5468977 NSC680733 resistant
hsa-miR-454-3p 11-[2-(dimethylamino)ethyl]pyrido[2,3-b]acridine-5,12-dione 387193 NSC680734 resistant
hsa-miR-454-3p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-454-3p 12-iminodaunorubicin hcl 72400 NSC254681 sensitive
hsa-miR-454-3p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-454-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-phenyl- 369537 NSC641394 sensitive
hsa-miR-454-3p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-454-3p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 sensitive
hsa-miR-454-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-454-3p 2-(3,5-bis(chloromethyl)-4-methoxyphenyl)-4h-thiochromen-4-one 355507 NSC609259 sensitive
hsa-miR-454-3p 2-(4-((oxiran-2-yl)methoxy)styryl)-4,5-dihydrooxazole 24206038 NSC737757 sensitive
hsa-miR-454-3p 2-(5-bromo-6-formyl-3-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2h)-yl)ethyl nitrate 383812 NSC672424 sensitive
hsa-miR-454-3p 2-(hydroxymethyl)-8-methyl-8-azabicyclo[3.2.1]octan-3-one NSC715572 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(4-methoxyphenyl)prop-2-en-1-one;hydrochloride 353911 NSC603553 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-454-3p 2-[(z)-2-(4-chlorophenyl)ethenyl]-1-methylquinolin-1-ium iodide 54598850 NSC10520 resistant
hsa-miR-454-3p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-454-3p 2-[[4-(1h-benzimidazol-2-yl)phenyl]iminomethyl]phenol 402059 NSC715755 sensitive
hsa-miR-454-3p 2-[[4-(2-dimethylaminoethylcarbamoyl)acridin-9-yl]amino]-3-sulfanyl-propanoic acid 392357 NSC692641 sensitive
hsa-miR-454-3p 2-[2-[4-(3-chloro-1,4-dihydroxy-5,8-dioxonaphthalen-2-yl)piperazin-1-yl]ethoxy]ethyl acetate 378769 NSC661939 sensitive
hsa-miR-454-3p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 sensitive
hsa-miR-454-3p 2-benzoyl-N-[(Z)-[[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-[(4-nitrophenyl)diazenyl]methylidene]amino]-5-chlorobenzamide 135493917 NSC681967 sensitive
hsa-miR-454-3p 2-bromo-5,8-dihydroxy-3-methyl-1,4-naphthoquinone 378912 NSC662383 sensitive
hsa-miR-454-3p 2-hydroxy discorhabdin d 362391 NSC626161 sensitive
hsa-miR-454-3p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 sensitive
hsa-miR-454-3p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-454-3p 2,2-dibutyl-7-methyl-1,3,2-benzodioxastannin-4-one 16683125 NSC628560 sensitive
hsa-miR-454-3p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 sensitive
hsa-miR-454-3p 2,6-bis((2-aminophenyl)thio)benzonitrile NSC679800 sensitive
hsa-miR-454-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-454-3p 2,6-bis(pyrrolidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 380174 NSC665622 sensitive
hsa-miR-454-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-454-3p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-454-3p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 sensitive
hsa-miR-454-3p 20-[3-[2-aminoethyl-[3-(15,16-dimethoxy-11,19-dioxo-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-20-yl)propyl]amino]propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8) 45027842 NSC727620 sensitive
hsa-miR-454-3p 3-(3,5-dimethoxyphenoxy)-2-phenyl-7-(trifluoromethyl)quinoxalin-5-amine 393436 NSC695323 sensitive
hsa-miR-454-3p 3-(4-nitrophenyl)-6-phenyl-cyclohex-4-ene-1,1,2,2-tetracarbonitrile 391620 NSC691106 sensitive
hsa-miR-454-3p 3-[(1Z)-1-(1-hydroxypyridin-2-ylidene)ethyl]imino-1,1-dimethylthiourea 44384025 NSC351078 sensitive
hsa-miR-454-3p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-454-3p 3-[[4-(3,4-dihydroxyphenyl)-1,3-thiazol-2-yl]iminomethyl]-4-hydroxychromen-2-one;hydrochloride 135403636 NSC659390 sensitive
hsa-miR-454-3p 3-bromoquinolin-8-ol 384167 NSC673458 sensitive
hsa-miR-454-3p 3-hydroxy-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohexa-2,5-diene-1,4-dione 178981 NSC697134 sensitive
hsa-miR-454-3p 4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione 25181424 NSC741898 sensitive
hsa-miR-454-3p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-454-3p 4-(furo[3,2-c]quinolin-4-ylamino)-n-(2-piperazin-1-ylethyl)benzamide 24204688 NSC732492 resistant
hsa-miR-454-3p 4-[(4e)-4-[(4-chlorophenyl)methylidene]-5-oxo-2-phenylimidazol-1-yl]-3-sulfanylidene-2h-1,2,4-triazin-5-one 5471340 NSC710587 sensitive
hsa-miR-454-3p 4-[(6-sulfanylidene-3,7-dihydropurin-8-yl)diazenyl]benzenesulfonamide 3246283 NSC75140 sensitive
hsa-miR-454-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-454-3p 4-hydroxy-3-[(E)-(4-phenyl-1,3-thiazol-2-yl)iminomethyl]chromen-2-one 135409113 NSC658343 sensitive
hsa-miR-454-3p 4-O-tert-butyl 1-O-propan-2-yl 2-[8-(hydroxymethyl)-12-methoxy-9-oxo-11H-indolizino[1,2-b]quinolin-7-yl]butanedioate 384499 NSC674347 sensitive
hsa-miR-454-3p 4,6-dimethyl-5-phenyl-2-[2-[4-[3-(trifluoromethyl)phenyl]piperazin-1-yl]ethyl]pyrrolo[3,4-c]pyrrole-1,3-dione 401045 NSC713750 sensitive
hsa-miR-454-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 sensitive
hsa-miR-454-3p 5-(1-adamantyl)-2-benzyloxy-1h-benzimidazole 394400 NSC697859 sensitive
hsa-miR-454-3p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5h-benzo[b]carbazole-6,11-dione 404489 NSC720725 resistant
hsa-miR-454-3p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 sensitive
hsa-miR-454-3p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-454-3p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-454-3p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-454-3p 5-hp 135453292 NSC107392 sensitive
hsa-miR-454-3p 5-methyl-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572094 NSC703109 sensitive
hsa-miR-454-3p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-454-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-454-3p 5,7-bis(trifluoromethyl)-2,3-dihydro-[1,2]thiazolo[2,3-a]azepine 1,1-dioxide 354292 NSC605440 sensitive
hsa-miR-454-3p 6-(3-aminopropyl)-9-methoxyindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755854 NSC736988 sensitive
hsa-miR-454-3p 6h-purine-6-thione, 1,7-dihydro-, mercury complex (9ci) NSC68294 sensitive
hsa-miR-454-3p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-454-3p 7-[4,5-bis(4-methylphenoxy)oxolan-2-yl]-6-chloropurine 389531 NSC685828 sensitive
hsa-miR-454-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-454-3p 7-methoxy-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 373631 NSC650351 sensitive
hsa-miR-454-3p 7,8-dichloro-10-[3-(dimethylamino)propyl]benzo[g]pteridine-2,4-dione;hydrochloride 24185927 NSC44684 sensitive
hsa-miR-454-3p 72i9a2i712 221812 NSC6883 sensitive
hsa-miR-454-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-454-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-454-3p 8-phenyl-7,8,9,10-tetrahydropyrimido[4,5-c]isoquinoline-1,3-diamine 401168 NSC714364 resistant
hsa-miR-454-3p 8455ab 1549990 NSC24189 sensitive
hsa-miR-454-3p 9-((2-chloroethyl)thio)-2,7-dimethoxyacridine 395389 NSC699925 sensitive
hsa-miR-454-3p 9-(3-chloro-2-hydroxy-propyl)-1,3-dimethyl-purino[7,8-a]pyrimidine-2,4,8-trione 392199 NSC692332 sensitive
hsa-miR-454-3p 9-(4-sulfamoylanilino)-n-(4-sulfamoylphenyl)acridine-4-carboxamide 365396 NSC633016 sensitive
hsa-miR-454-3p 9-ethylsulfinyl-2,7-dimethoxy-acridine 395385 NSC699921 sensitive
hsa-miR-454-3p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 resistant
hsa-miR-454-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 5-methoxy- 388732 NSC683785 resistant
hsa-miR-454-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-454-3p Alatolid 5359051 NSC295426 sensitive
hsa-miR-454-3p Amonafide 50515 NSC308847 sensitive
hsa-miR-454-3p Antineoplastic-654379 NSC654379 sensitive
hsa-miR-454-3p Antineoplastic-690271 391308 NSC690271 sensitive
hsa-miR-454-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-454-3p Azane;[4-[(dithiocarboxyamino)methyl]cyclohexyl]methylcarbamodithioic acid 54600120 NSC136468 sensitive
hsa-miR-454-3p Benzofurazan, 5-nitro-6-(1-piperidinyl)-, 1-oxide 313603 NSC228132 sensitive
hsa-miR-454-3p Bromocopper;(dipyridin-2-ylmethylideneamino)-[methylsulfanyl(sulfoniumylidene)methyl]azanide 4318826 NSC321206 sensitive
hsa-miR-454-3p Bromocopper;1,1-dimethyl-3-[(E)-1-pyridin-2-ylethylideneamino]thiourea 9578864 NSC635448 sensitive
hsa-miR-454-3p C18281 361185 NSC624114 resistant
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Chlorobis(4-ethyltropolonato)bismuth(iii) NSC634368 sensitive
hsa-miR-454-3p Chlorocopper(1+); n-[(e)-1-(2-pyridyl)ethylideneamino]azepane-1-carbothioamide 9578866 NSC635450 sensitive
hsa-miR-454-3p Chlorocopper;1,1-dipropyl-3-[(E)-1-pyridin-2-ylethylideneamino]thiourea 9578865 NSC635449 sensitive
hsa-miR-454-3p Crotonosid 223996 NSC12161 sensitive
hsa-miR-454-3p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-454-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-454-3p Cyclohexanone, 2,6-bis(piperidinomethyl)- 236587 NSC39202 sensitive
hsa-miR-454-3p Deoxyartemisitene 6712468 NSC690035 sensitive
hsa-miR-454-3p Dianhydrogalactitol 31789 NSC132313 sensitive
hsa-miR-454-3p Diethyl (Z)-2-[3-(2-ethoxy-2-oxoethyl)-2,4-dioxopyrimidin-1-yl]but-2-enedioate 5468905 NSC679002 sensitive
hsa-miR-454-3p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 resistant
hsa-miR-454-3p Dimethyl 5-benzoyl-1-[(Z)-2-[(Z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1-phenylethenyl]-2,3-dihydropyrrolo[1,2-a]imidazole-6,7-dicarboxylate 5468047 NSC663245 sensitive
hsa-miR-454-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-454-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-454-3p Ethyl (E)-3-[(1S,3R)-2-(4-chlorobenzoyl)-3-[(E)-1,3-diethoxy-3-oxoprop-1-enyl]cyclopropyl]-3-ethoxyprop-2-enoate 5469838 NSC693207 sensitive
hsa-miR-454-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-454-3p Ethyl 4-(5-cyano-2-methyl-1-phenyl-6-thioxo-pyrimidin-4-yl)piperazine-1-carboxylate 388267 NSC682881 sensitive
hsa-miR-454-3p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 sensitive
hsa-miR-454-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-454-3p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 resistant
hsa-miR-454-3p Ethyl 8-(4-chlorophenyl)-4-methyl-2-oxo-6-thiophen-2-yl-4a,7-dihydrochromene-3-carboxylate 392311 NSC692587 sensitive
hsa-miR-454-3p Fastigilin c 261577 NSC176507 sensitive
hsa-miR-454-3p Gw814408x 9604912 NSC756377 resistant
hsa-miR-454-3p Haterumalide na methyl esters 24204452 NSC731928 resistant
hsa-miR-454-3p Herbimycin 6436247 NSC305978 sensitive
hsa-miR-454-3p Idebenone 12881464 NSC759228 approved sensitive
hsa-miR-454-3p Incomptina b 5459288 NSC685707 sensitive
hsa-miR-454-3p Indenoisoquinoline derivative 329826 NSC314622 sensitive
hsa-miR-454-3p Inosine dialdehyde 135400916 NSC118994 sensitive
hsa-miR-454-3p Kinamycin c NSC138425 sensitive
hsa-miR-454-3p Kkiqvsbzfbkasx-uhfffaoysa-n 381513 NSC668269 sensitive
hsa-miR-454-3p Laurusin 135476719 NSC106486 sensitive
hsa-miR-454-3p Ls-144122 135408600 NSC52427 sensitive
hsa-miR-454-3p Ls-28225 16683189 NSC643845 sensitive
hsa-miR-454-3p Maxima isoflavone d 343081 NSC382028 resistant
hsa-miR-454-3p Methyl (2e)-2-[[3-(furan-2-carbonyl)-2-sulfanylideneimidazolidin-1-yl]methylidene]-3-oxobutanoate 24203795 NSC729527 resistant
hsa-miR-454-3p Methyl 4-[(2,5-dihydroxyphenyl)methylamino]-2-hydroxybenzoate 390508 NSC687945 sensitive
hsa-miR-454-3p Methyl 5-methyl-2-[(e)-(7-methyl-1-oxo-indan-2-ylidene)methyl]benzoate 6284987 NSC678362 sensitive
hsa-miR-454-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-454-3p Methyl(2r,3as)-2-[(4-hydroxyphenyl)methyl]-1,3,3a,4-tetrahydropyrazolo[1,5-a]indole-2-carboxylate 398179 NSC707774 sensitive
hsa-miR-454-3p N'-((6-methyl-2-pyridinyl)methylene)-1-azepanecarbothiohydrazide 9554750 NSC667876 sensitive
hsa-miR-454-3p N'-(cyano(2-hydroxyphenyl)methyl)-2-phenylacetohydrazide 374997 NSC653823 sensitive
hsa-miR-454-3p N',N'-diethyl-N-(7-nitro-1,4-dioxido-1,2,4-benzotriazine-1,4-diium-3-yl)ethane-1,2-diamine 135426847 NSC628917 sensitive
hsa-miR-454-3p N',N'-diethyl-N-(7-nitro-1,4-dioxido-1,2,4-benzotriazine-1,4-diium-3-yl)ethane-1,2-diamine;hydrochloride 135488943 NSC628918 sensitive
hsa-miR-454-3p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-454-3p N-(dipyridin-2-ylmethylideneamino)-1,3-benzoxazol-2-amine 404079 NSC720200 sensitive
hsa-miR-454-3p N-[(e)-(2-phenyl-1-pyridin-2-ylethylidene)amino]-1h-benzimidazol-2-amine NSC720194 sensitive
hsa-miR-454-3p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-454-3p N-[(e)-[3-(dimethylamino)-1-phenylpropylidene]amino]aniline;hydrochloride 9569913 NSC625220 sensitive
hsa-miR-454-3p N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine;zinc 9578819 NSC625544 sensitive
hsa-miR-454-3p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-4-pyridin-2-ylpiperazine-1-carbothioamide 9554702 NSC335787 sensitive
hsa-miR-454-3p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 sensitive
hsa-miR-454-3p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 sensitive
hsa-miR-454-3p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 sensitive
hsa-miR-454-3p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-454-3p N-[(E)-1-pyrimidin-4-ylethylideneamino]-1,3-benzothiazol-2-amine 5351439 NSC693632 sensitive
hsa-miR-454-3p N-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]piperidine-1-carbothioamide 5494336 NSC668300 sensitive
hsa-miR-454-3p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 sensitive
hsa-miR-454-3p N-[2-(dimethylamino)ethyl]-9-nitrodibenzo-p-dioxin-1-carboxamide;hydrochloride 370721 NSC644221 sensitive
hsa-miR-454-3p N-[2-[6-amino-3-(chloromethyl)-2,3-dihydroindole-1-carbonyl]-1H-indol-5-yl]-1-benzofuran-2-carboxamide 394235 NSC697539 sensitive
hsa-miR-454-3p N-[2-acetamido-6-[[(2r,3s)-2-(dibenzylamino)-3-hydroxyhexyl]amino]pyrimidin-4-yl]acetamide 396448 NSC702421 sensitive
hsa-miR-454-3p N-[4-[(2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl)oxy]butyl]-1h-indole-2-carboxamide 20826874 NSC726365 sensitive
hsa-miR-454-3p N-[5-[(e)-3-[8-(chloromethyl)-1-methyl-4-phenylmethoxy-7,8-dihydro-3h-pyrrolo[3,2-e]indol-6-yl]-3-oxoprop-1-enyl]-1-methylpyrrol-3-yl]butanamide 5469857 NSC693563 sensitive
hsa-miR-454-3p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-454-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-454-3p None 12201866 NSC179207 sensitive
hsa-miR-454-3p NSC294526 NSC294526 sensitive
hsa-miR-454-3p NSC374998 NSC374998 sensitive
hsa-miR-454-3p NSC605607 NSC605607 sensitive
hsa-miR-454-3p NSC664558 NSC664558 sensitive
hsa-miR-454-3p NSC688995 NSC688995 resistant
hsa-miR-454-3p NSC716032 NSC716032 sensitive
hsa-miR-454-3p NSC751830 NSC751830 resistant
hsa-miR-454-3p NSC762149 NSC762149 resistant
hsa-miR-454-3p O-aminoazotoluene 7340 NSC1797 sensitive
hsa-miR-454-3p Pada 81528 NSC9358 sensitive
hsa-miR-454-3p Pectenotoxin ii 5468320 NSC668555 resistant
hsa-miR-454-3p Pirarubicin hcl 11970024 NSC654509 sensitive
hsa-miR-454-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-454-3p Razoxane 30623 NSC129943 sensitive
hsa-miR-454-3p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 sensitive
hsa-miR-454-3p Salarin c 24867082 NSC750154 resistant
hsa-miR-454-3p Selendale 54601159 NSC347466 resistant
hsa-miR-454-3p Stk849915 NSC691081 sensitive
hsa-miR-454-3p Stl434863 394348 NSC697730 sensitive
hsa-miR-454-3p Tert-butyl 2,6-dioxo-4-[1,2,3,4-tetrakis(phenylmethoxy)butyl]piperidine-3-carboxylate 386078 NSC677666 sensitive
hsa-miR-454-3p Tert-butyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386493 NSC678637 sensitive
hsa-miR-454-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-454-3p Thiosemicarbazone r NSC319725 sensitive
hsa-miR-454-3p Thujaplicin mixture 252101 NSC73300 sensitive
hsa-miR-454-3p Trans-bis(acetato)amminepyridineplatinum(ii) NSC722781 sensitive
hsa-miR-454-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-454-3p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 sensitive
hsa-miR-454-3p Veracoquinazole 135416663 NSC601852 sensitive
hsa-miR-454-3p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-454-3p Z1603789400 236065 NSC38090 sensitive
hsa-miR-454-3p Z734296158 391673 NSC691215 sensitive
hsa-miR-454-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Vincristine 5978 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Daunorubicin 30323 NSC82151 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p L-Asparaginase sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Prednisolone 5755 NSC9120 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (PC-3)
hsa-miR-454-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-454-3p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-454-3p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-miR-454-3p Temozolomide 5394 NSC362856 approved resistant High Glioma tissue
hsa-miR-454-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, SKOV3)
hsa-miR-454-3p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma tissue
hsa-miR-454-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive Low Nasopharyngeal Cancer cell line (5-8F, SUNE-1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (IGROV-1, W1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-454-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-454-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-454-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-454-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-454-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-454-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-454-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-454-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-454-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-454-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-454-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-454-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-454-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-454-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission