miRTarBase - #MIRT039234


—
pre-miRNA Information
pre-miRNA hsa-mir-454   
Genomic Coordinates chr17: 59137758 - 59137872
Synonyms MIRN454, hsa-mir-454, MIR454
Description Homo sapiens miR-454 stem-loop
Comment The mature miRNA sequences were named miR-454-5p and miR-454-3p in .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-454-3p
Sequence 64| UAGUGCAAUAUUGCUUAUAGGGU |86
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30529712 20 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1391884708 2 dbSNP
rs772555392 4 dbSNP
rs555225543 7 dbSNP
rs1450965019 11 dbSNP
rs779514158 12 dbSNP
rs771457463 18 dbSNP
rs377123764 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SIK3   
Synonyms L19, QSK, SIK-3
Description SIK family kinase 3
Transcript NM_025164   
Expression
Putative miRNA Targets on SIK3
3'UTR of SIK3
(miRNA target sites are highlighted)		 
>SIK3|NM_025164|3'UTR
   1 CAAGAAACAGAGAGTTTTGTGTACAGCTTGGGAATGAAAAGGTTGATTGTAAACCCACAGTATCTAGCAGCGTTGTGCCA
  81 AATTGCCCTTGTGTTTCTCTCCACCCAAAATATCACAGCTGCTTTCCTCACATTTGGTTCATCCGTGTGCTGTTCTTTTG
 161 GGTTCTGAGAGGGTTTTGCCATGTTTGCTTGTATGACCAAGTCACCAAGGAAATAAACAGGAAGGAAATCCATGTTCTCC
 241 ATCTTTTGTGAAAGTATATTTGAGTTGGTGGTTTTTTGTTTTGTTTGGGGGTTTGTGTTTTGTTTTGTTTTTGGTATGTT
 321 TTCTTCCAGAGGTGATATACTTTCTTTTTTTTCTTCCTTTCTTTTTTTTCTTTCGTTCCTTTTTTGAAACAGGAGAGCAA
 401 AGCAGTTAGAGTTCAGAGGCCAGCGGCCTCAGGGCCACTCCCTCCCTAGCCTTCATCAGCAGAGCACCCTCCATCCCCCT
 481 GCATTGCTCTTCTGTGAAAGCAAATACTAAAGGATGCCATCCTCTGGAATCCTAATGGCAGGCAAAGGGAGAGAGGAAGG
 561 GTGACGGCTTCTGGCACTTAGAAAACAAAAAGAACAAAAAAAGAGAAACCCCCAAGCCTGGAACGCAGAGAGGTCTTTAC
 641 TGCTGGGATCCACGGAAAACATGTCTGTCCTAGCCAAGATCATATGAAGAGTTTGGCACGGAGGCTGAGAATGACCTGGC
 721 ATAGATGGTTTGCCAGTTAGGATGTCTCAATTTGAGCCTTTGCTTTTGGTGGATAACTCAGCTCCCCTCTTGTAACCTGG
 801 AAAGTTGGTTGCCTTTATCATCCTGCTGGTTTTATCCATGGACTGAACACCCAACAGCAGTGCACTATGCTTTCTATGGC
 881 ATCTTTCATTCTCATTTTATATTGTGCTATAAAAAGGATTGTTTCTCCATATATATATTATATATGTGTGTATATATATA
 961 ATATAATATATGTGTATATATATATTATATATATAATATATAATATAATATATTATATATATATTATATATATAATATAT
1041 ATATAAAATATATATATATATGCTCTCCTCTTTCAGCCTCTTTGTCACAGGGAAGAAGTGTAGGAGGTTGCCTTGGGCCC
1121 TGCCTCTCTCCTAACCTCCTCTTCCCCACTGGGTACCCTCAGCCCCTATATTTTAATTCTTGATCATGTAGAAATTGTTT
1201 TTGGTAAATGTTGATATTATTGTTATTATCATTATTAATAAATAAAGAGAAAAGGAATTTTTGTTTAAATGAGAAATGTT
1281 TAACCAGATTCTGTTCTATTTGAATTGTGACTTGCACCTTTTGTTCAAAGTATTTCCTTTAGGCATTGTAATTGTGAACA
1361 GCTCTTACTTGTGCCAGTGACAGATGCAGTGGTCTCCTTTCCCCAGTTGAAGCAGTGCATACGCAGTAGCTATTATTTGT
1441 GTTATCTTTATTTCTCTTCATTGTTAGAAACCAAAGTCTTCTCTGCTGGCTGGGGCTGAGAGAGGGTCTGGGTTATCTCC
1521 TTCTGATCTTCAAAACAAGAGAGAGACCTTGAATACACTGACTCTTCCACCCTTTTTTTTTCTGGGAAAGGAGAGCAAGA
1601 GGTCCCGAGTCCCCTCCTAGTCTTTCATCCTGAATTTGCACAGAGGAAAGCGGGTGCCCGGCATGGCCATCCTGATGTTG
1681 CTGGCGGGATCCCCATGCACCTTGTCCTTCTCCACTGATACTGGCAGCTCGGCTCCTGGACCCAAGATCCCTTGAGTGGA
1761 ATTCTGCAGTGCAAGAGCCCTTCGTGGGAGCTGTCCCATGTTTCCATGGTCCCCAGTCTCCCCTCCACTTGGTGGGGTCA
1841 CCAACTACTCACCAGAAGGGGGCTTACCAAGAAAGCCCTAAAAAGCTGTTGACTTATCTGCGCTTGTTCCAACTCTTATG
1921 CCCCCAACCTGCCCTACCACCACCACGCGCTCAGCCTGATGTGTTTACATGGTACTGTATGTATGGGAGAGCAGACTGCA
2001 CCCTCCAGCAACAACAGATGAAAGCCAGTGAGCCTACTAACCGTGCCATCTTGCAAACTACACTTTAAAAAAAACTCATT
2081 GCTTTGTATTGTAGTAACCAATATGTGCAGTATACGTTGAATGTATATGAACATACTTTCCTATTTCTGTTCTTTGAAAA
2161 TGTCAGAAATATTTTTTTCTTTCTCATTTTATGTTGAACTAAAAAGGATTAAAAAAAAAATCTCCAGACTCAAGTTGCTA
2241 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugGGAUAUUCG---UUAUAACGUGau 5'
            :|| | | |   ||| ||||||  
Target 5' agTCTTTCATCCTGAAT-TTGCACag 3'
 1619 - 1643 132.00 -8.80
2 
miRNA  3' ugGGAUAUUCGUUAU----AACGUGau 5'
            :||||  | | |:    ||||||  
Target 5' gtTCTATTTGAATTGTGACTTGCACct 3'
 1293 - 1319 131.00 -9.20
3 
miRNA  3' ugGGAUAUUCGUUAUAACGUGAu 5'
            || |  ||||:   |||||| 
Target 5' caCCCAACAGCAG---TGCACTa 3'
 848 - 867 129.00 -16.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26994736 12 COSMIC
COSN22443715 171 COSMIC
COSN14501725 302 COSMIC
COSN1515411 651 COSMIC
COSN22110781 732 COSMIC
COSN29857914 983 COSMIC
COSN26844843 1640 COSMIC
COSN6987728 1799 COSMIC
COSN6987726 1801 COSMIC
COSN20108795 1990 COSMIC
COSN8939353 2055 COSMIC
COSN17310729 2700 COSMIC
COSN29081353 2964 COSMIC
rs141469619 2819 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751961166 2 dbSNP
rs780056098 10 dbSNP
rs758265438 15 dbSNP
rs1292226201 16 dbSNP
rs893007050 19 dbSNP
rs1224353437 20 dbSNP
rs1020207679 22 dbSNP
rs1177821474 24 dbSNP
rs780228213 37 dbSNP
rs1418121634 39 dbSNP
rs1289000763 42 dbSNP
rs1175697974 45 dbSNP
rs1476005496 49 dbSNP
rs1268238816 56 dbSNP
rs12418004 60 dbSNP
rs769338245 64 dbSNP
rs995966543 70 dbSNP
rs957210227 73 dbSNP
rs1337437999 74 dbSNP
rs1442346343 75 dbSNP
rs1326604441 80 dbSNP
rs1018141727 87 dbSNP
rs901488766 88 dbSNP
rs1040036007 89 dbSNP
rs1280597975 93 dbSNP
rs940349028 95 dbSNP
rs745604608 99 dbSNP
rs887319755 106 dbSNP
rs1407681793 109 dbSNP
rs1006713754 112 dbSNP
rs372105585 113 dbSNP
rs371951697 116 dbSNP
rs1419216812 117 dbSNP
rs1166464823 124 dbSNP
rs1476609585 127 dbSNP
rs1029822460 137 dbSNP
rs553318992 138 dbSNP
rs186981833 140 dbSNP
rs1187118070 156 dbSNP
rs534655442 159 dbSNP
rs1442841431 163 dbSNP
rs1195801878 166 dbSNP
rs931466509 167 dbSNP
rs920137387 169 dbSNP
rs1204184680 170 dbSNP
rs1457301341 171 dbSNP
rs559607849 172 dbSNP
rs993857484 173 dbSNP
rs1397587619 179 dbSNP
rs1442449863 184 dbSNP
rs546248942 189 dbSNP
rs981373864 190 dbSNP
rs7103269 191 dbSNP
rs942312491 192 dbSNP
rs1341835674 203 dbSNP
rs1199826800 204 dbSNP
rs1257972649 206 dbSNP
rs1456543774 207 dbSNP
rs11216159 213 dbSNP
rs1268364689 217 dbSNP
rs367912553 225 dbSNP
rs1196958409 228 dbSNP
rs1374590887 230 dbSNP
rs472111 243 dbSNP
rs1421366326 249 dbSNP
rs1462598917 253 dbSNP
rs937504807 254 dbSNP
rs1389327805 265 dbSNP
rs549217651 269 dbSNP
rs928737248 270 dbSNP
rs981898845 272 dbSNP
rs946081596 273 dbSNP
rs752742489 282 dbSNP
rs1278171057 283 dbSNP
rs1316559303 284 dbSNP
rs182358127 287 dbSNP
rs1235634670 289 dbSNP
rs1266127013 291 dbSNP
rs1355652751 293 dbSNP
rs1208360168 298 dbSNP
rs1264111244 300 dbSNP
rs1411942965 301 dbSNP
rs1340679535 302 dbSNP
rs534924889 303 dbSNP
rs1260717918 305 dbSNP
rs1476160104 307 dbSNP
rs1163168667 309 dbSNP
rs957417238 312 dbSNP
rs1387139679 318 dbSNP
rs1184236342 326 dbSNP
rs1401030822 332 dbSNP
rs1028847268 336 dbSNP
rs990131129 341 dbSNP
rs756212699 342 dbSNP
rs957303276 343 dbSNP
rs996428661 344 dbSNP
rs572575367 345 dbSNP
rs1242674809 349 dbSNP
rs1018711000 352 dbSNP
rs1354727589 361 dbSNP
rs1438175649 365 dbSNP
rs1018196137 379 dbSNP
rs189745490 380 dbSNP
rs955351505 386 dbSNP
rs924664513 389 dbSNP
rs1182440184 401 dbSNP
rs539501969 404 dbSNP
rs1361221226 406 dbSNP
rs1029427828 415 dbSNP
rs938731944 417 dbSNP
rs1380330833 421 dbSNP
rs1418734463 422 dbSNP
rs994299259 428 dbSNP
rs1156389780 442 dbSNP
rs1359105319 452 dbSNP
rs896884980 455 dbSNP
rs931606726 458 dbSNP
rs188012780 469 dbSNP
rs1379042388 484 dbSNP
rs746088605 487 dbSNP
rs1394761359 489 dbSNP
rs1311588731 492 dbSNP
rs1377670397 493 dbSNP
rs1239698572 495 dbSNP
rs898761653 495 dbSNP
rs1349858487 496 dbSNP
rs1210534295 497 dbSNP
rs1255377279 498 dbSNP
rs1482251403 500 dbSNP
rs577534272 517 dbSNP
rs1055938301 522 dbSNP
rs928819182 523 dbSNP
rs1438538563 532 dbSNP
rs983330909 533 dbSNP
rs1176460489 542 dbSNP
rs1396489559 546 dbSNP
rs1435324443 549 dbSNP
rs866853633 549 dbSNP
rs1177289037 560 dbSNP
rs1358899285 575 dbSNP
rs752826255 579 dbSNP
rs1302975328 588 dbSNP
rs937518463 593 dbSNP
rs1005170238 627 dbSNP
rs536598233 631 dbSNP
rs1423156613 632 dbSNP
rs1367642376 640 dbSNP
rs928682844 641 dbSNP
rs139111531 643 dbSNP
rs1369956786 647 dbSNP
rs765422426 661 dbSNP
rs1300354083 663 dbSNP
rs1310156629 664 dbSNP
rs1229612100 670 dbSNP
rs1258621450 679 dbSNP
rs1456971351 681 dbSNP
rs528240109 682 dbSNP
rs759519018 683 dbSNP
rs569772258 686 dbSNP
rs1160225969 687 dbSNP
rs907334158 693 dbSNP
rs1431797909 694 dbSNP
rs74438618 698 dbSNP
rs1424940439 702 dbSNP
rs1465204450 711 dbSNP
rs1029335321 717 dbSNP
rs1196964855 720 dbSNP
rs766479007 722 dbSNP
rs946143597 727 dbSNP
rs913306102 734 dbSNP
rs990182922 744 dbSNP
rs1278814799 749 dbSNP
rs1214700587 753 dbSNP
rs935983755 756 dbSNP
rs551151056 759 dbSNP
rs1285794088 775 dbSNP
rs1225950633 783 dbSNP
rs985752768 792 dbSNP
rs565845402 795 dbSNP
rs1321727390 798 dbSNP
rs1283242041 800 dbSNP
rs1244606155 802 dbSNP
rs746808435 806 dbSNP
rs552432726 814 dbSNP
rs1303969756 815 dbSNP
rs1264297571 816 dbSNP
rs1477791604 819 dbSNP
rs773517907 824 dbSNP
rs533039203 825 dbSNP
rs1406015985 830 dbSNP
rs1164411815 840 dbSNP
rs972579248 841 dbSNP
rs961147926 842 dbSNP
rs1402040094 849 dbSNP
rs1298606606 853 dbSNP
rs1339536160 860 dbSNP
rs1398077372 865 dbSNP
rs1016639322 873 dbSNP
rs184002013 897 dbSNP
rs762242553 898 dbSNP
rs563725578 903 dbSNP
rs1056453075 910 dbSNP
rs1034576271 911 dbSNP
rs774718154 915 dbSNP
rs766647238 918 dbSNP
rs1287202762 923 dbSNP
rs1001654198 931 dbSNP
rs907430911 943 dbSNP
rs1191749444 944 dbSNP
rs1239704479 958 dbSNP
rs1473191825 959 dbSNP
rs1046348875 965 dbSNP
rs543847728 971 dbSNP
rs1181390800 982 dbSNP
rs1010395370 996 dbSNP
rs1411664425 1000 dbSNP
rs1481285320 1001 dbSNP
rs1421768607 1002 dbSNP
rs907414075 1010 dbSNP
rs1429816164 1017 dbSNP
rs1185540319 1020 dbSNP
rs1336143012 1021 dbSNP
rs769407120 1025 dbSNP
rs946157699 1027 dbSNP
rs1281946289 1030 dbSNP
rs1378396224 1032 dbSNP
rs191753633 1032 dbSNP
rs1240423342 1040 dbSNP
rs1308068053 1042 dbSNP
rs1243509680 1048 dbSNP
rs758296711 1056 dbSNP
rs1281121466 1060 dbSNP
rs913322934 1061 dbSNP
rs1209965254 1065 dbSNP
rs561593375 1071 dbSNP
rs1441621888 1085 dbSNP
rs1460490888 1087 dbSNP
rs1054503856 1091 dbSNP
rs552513504 1096 dbSNP
rs11420452 1106 dbSNP
rs911202737 1106 dbSNP
rs757377562 1109 dbSNP
rs1332032769 1113 dbSNP
rs1049733305 1115 dbSNP
rs1446863666 1118 dbSNP
rs933930013 1122 dbSNP
rs911752345 1123 dbSNP
rs922539325 1123 dbSNP
rs1276987123 1126 dbSNP
rs973020306 1127 dbSNP
rs1214185248 1128 dbSNP
rs1261804310 1130 dbSNP
rs961157807 1131 dbSNP
rs1459185484 1137 dbSNP
rs909645349 1143 dbSNP
rs1290858141 1152 dbSNP
rs541691918 1161 dbSNP
rs1405509070 1162 dbSNP
rs780942362 1162 dbSNP
rs1334598398 1163 dbSNP
rs959047518 1178 dbSNP
rs1477571504 1179 dbSNP
rs1174257458 1180 dbSNP
rs1425650294 1187 dbSNP
rs376207934 1201 dbSNP
rs1466041052 1206 dbSNP
rs770655244 1215 dbSNP
rs1397428359 1223 dbSNP
rs1406514078 1226 dbSNP
rs1169418944 1231 dbSNP
rs186958865 1242 dbSNP
rs547349223 1247 dbSNP
rs994473522 1248 dbSNP
rs959336174 1262 dbSNP
rs972091005 1270 dbSNP
rs1421120075 1274 dbSNP
rs1257515588 1280 dbSNP
rs1024557946 1288 dbSNP
rs181482220 1289 dbSNP
rs1034598953 1295 dbSNP
rs545624915 1296 dbSNP
rs1211926000 1306 dbSNP
rs930266065 1315 dbSNP
rs1186757990 1316 dbSNP
rs1010410618 1318 dbSNP
rs891934905 1319 dbSNP
rs1265002874 1326 dbSNP
rs142174850 1328 dbSNP
rs1169792057 1330 dbSNP
rs758261285 1355 dbSNP
rs1000306008 1356 dbSNP
rs1010371579 1356 dbSNP
rs556595575 1362 dbSNP
rs1389532608 1366 dbSNP
rs1257123868 1374 dbSNP
rs1050224369 1377 dbSNP
rs1342702683 1378 dbSNP
rs140569924 1403 dbSNP
rs752737175 1406 dbSNP
rs1306137522 1407 dbSNP
rs934007788 1415 dbSNP
rs1324820280 1418 dbSNP
rs1145207 1424 dbSNP
rs936010606 1426 dbSNP
rs921958010 1432 dbSNP
rs1220461730 1434 dbSNP
rs1038951744 1438 dbSNP
rs1382081668 1449 dbSNP
rs944582716 1452 dbSNP
rs531033855 1453 dbSNP
rs1383384387 1459 dbSNP
rs983250586 1471 dbSNP
rs939868286 1472 dbSNP
rs909693102 1474 dbSNP
rs534901535 1501 dbSNP
rs565783758 1503 dbSNP
rs1362921661 1505 dbSNP
rs1420677636 1511 dbSNP
rs1288845186 1524 dbSNP
rs1356121297 1535 dbSNP
rs1398257107 1536 dbSNP
rs1313550332 1549 dbSNP
rs920353614 1552 dbSNP
rs937788456 1554 dbSNP
rs1311728933 1556 dbSNP
rs1170705576 1579 dbSNP
rs926384722 1582 dbSNP
rs552352573 1584 dbSNP
rs1215590984 1587 dbSNP
rs532307076 1588 dbSNP
rs139027464 1589 dbSNP
rs550273151 1592 dbSNP
rs1184854603 1593 dbSNP
rs1254872162 1596 dbSNP
rs1459585283 1603 dbSNP
rs190140935 1608 dbSNP
rs1380505605 1613 dbSNP
rs1033327802 1616 dbSNP
rs1158874587 1633 dbSNP
rs376026847 1634 dbSNP
rs1257402662 1641 dbSNP
rs981758668 1654 dbSNP
rs1177190788 1657 dbSNP
rs1024984074 1664 dbSNP
rs866766464 1679 dbSNP
rs1450520059 1692 dbSNP
rs1333666614 1693 dbSNP
rs1024518198 1695 dbSNP
rs989040369 1696 dbSNP
rs1223379937 1699 dbSNP
rs1479858147 1701 dbSNP
rs1304612617 1702 dbSNP
rs1017242786 1703 dbSNP
rs1206110614 1704 dbSNP
rs1459627556 1705 dbSNP
rs5795054 1705 dbSNP
rs1289902810 1709 dbSNP
rs1199946655 1715 dbSNP
rs11820014 1717 dbSNP
rs1322423208 1719 dbSNP
rs201579941 1722 dbSNP
rs1389670136 1723 dbSNP
rs554134911 1724 dbSNP
rs1429167386 1725 dbSNP
rs1435266057 1725 dbSNP
rs1375217793 1727 dbSNP
rs1172939226 1728 dbSNP
rs1401045995 1728 dbSNP
rs1441754025 1729 dbSNP
rs1296660290 1730 dbSNP
rs1298588689 1734 dbSNP
rs541403547 1735 dbSNP
rs527981030 1737 dbSNP
rs565390373 1738 dbSNP
rs1258150624 1739 dbSNP
rs1316745112 1739 dbSNP
rs552161209 1739 dbSNP
rs545591493 1740 dbSNP
rs1192172258 1741 dbSNP
rs576195260 1742 dbSNP
rs1165094057 1745 dbSNP
rs1424722731 1746 dbSNP
rs1479748882 1746 dbSNP
rs1362776733 1748 dbSNP
rs1424501463 1748 dbSNP
rs1242808634 1749 dbSNP
rs1409435191 1749 dbSNP
rs1302332164 1750 dbSNP
rs1458565767 1750 dbSNP
rs1158975016 1751 dbSNP
rs1343338880 1754 dbSNP
rs1401842839 1755 dbSNP
rs1417902574 1755 dbSNP
rs1212268982 1756 dbSNP
rs1291359536 1756 dbSNP
rs371090973 1756 dbSNP
rs1221206512 1757 dbSNP
rs1253311880 1757 dbSNP
rs1477168 1758 dbSNP
rs1183294873 1759 dbSNP
rs1291506233 1759 dbSNP
rs1163171454 1761 dbSNP
rs1219502563 1761 dbSNP
rs1264497778 1761 dbSNP
rs1363549562 1761 dbSNP
rs11300154 1762 dbSNP
rs1344573281 1762 dbSNP
rs1421265616 1762 dbSNP
rs398017702 1762 dbSNP
rs1285466084 1764 dbSNP
rs1364613219 1764 dbSNP
rs1428497618 1764 dbSNP
rs1379172807 1765 dbSNP
rs1195357585 1766 dbSNP
rs1244872040 1766 dbSNP
rs1312439595 1766 dbSNP
rs1242729819 1767 dbSNP
rs1354158158 1767 dbSNP
rs1491171268 1767 dbSNP
rs867278091 1767 dbSNP
rs1239354954 1768 dbSNP
rs1245101459 1768 dbSNP
rs1441738931 1768 dbSNP
rs1461817804 1768 dbSNP
rs1491112809 1768 dbSNP
rs1159054625 1769 dbSNP
rs1490289808 1769 dbSNP
rs1336084110 1770 dbSNP
rs1398889092 1770 dbSNP
rs1359291808 1771 dbSNP
rs1266967072 1772 dbSNP
rs1334326730 1772 dbSNP
rs1240356951 1773 dbSNP
rs1280518052 1773 dbSNP
rs1350325939 1773 dbSNP
rs1378694367 1773 dbSNP
rs201786898 1773 dbSNP
rs1281322398 1774 dbSNP
rs1324418251 1775 dbSNP
rs1225076136 1776 dbSNP
rs1491497182 1777 dbSNP
rs533629651 1777 dbSNP
rs868566733 1777 dbSNP
rs1173660736 1778 dbSNP
rs1174294238 1778 dbSNP
rs1182722199 1778 dbSNP
rs1232153566 1778 dbSNP
rs1468393894 1778 dbSNP
rs1491403603 1778 dbSNP
rs201144269 1778 dbSNP
rs1327752341 1779 dbSNP
rs1440433088 1779 dbSNP
rs1276935506 1780 dbSNP
rs1357140672 1780 dbSNP
rs1346724186 1781 dbSNP
rs867907239 1781 dbSNP
rs1261349242 1782 dbSNP
rs1320093157 1783 dbSNP
rs77356018 1783 dbSNP
rs1272529582 1784 dbSNP
rs1236769534 1785 dbSNP
rs1435904412 1786 dbSNP
rs868079975 1787 dbSNP
rs1197108753 1788 dbSNP
rs1269272441 1788 dbSNP
rs1288950932 1788 dbSNP
rs1425231077 1788 dbSNP
rs1462031850 1789 dbSNP
rs1167006334 1793 dbSNP
rs1222607263 1795 dbSNP
rs1406692181 1795 dbSNP
rs1343467607 1797 dbSNP
rs1404954856 1798 dbSNP
rs1281911179 1799 dbSNP
rs1342500501 1799 dbSNP
rs1228204657 1800 dbSNP
rs556657996 1800 dbSNP
rs1211798531 1801 dbSNP
rs1337719954 1801 dbSNP
rs1220228343 1804 dbSNP
rs1292235090 1804 dbSNP
rs1387031504 1804 dbSNP
rs754883415 1805 dbSNP
rs1429011656 1806 dbSNP
rs1191876543 1807 dbSNP
rs1286559593 1809 dbSNP
rs1454921703 1812 dbSNP
rs1010403359 1815 dbSNP
rs1163827485 1815 dbSNP
rs1424395950 1815 dbSNP
rs1473579259 1815 dbSNP
rs1301876060 1818 dbSNP
rs1365990246 1819 dbSNP
rs1383216564 1821 dbSNP
rs1317739603 1824 dbSNP
rs1324690867 1832 dbSNP
rs1247343461 1836 dbSNP
rs1250541583 1847 dbSNP
rs1315978105 1850 dbSNP
rs1358515562 1853 dbSNP
rs1243539111 1858 dbSNP
rs1000358627 1863 dbSNP
rs1287834298 1872 dbSNP
rs1160568802 1879 dbSNP
rs138230029 1882 dbSNP
rs1427719417 1883 dbSNP
rs1259142489 1884 dbSNP
rs1443632894 1894 dbSNP
rs891995070 1901 dbSNP
rs1384184927 1902 dbSNP
rs1028371226 1909 dbSNP
rs1452459280 1910 dbSNP
rs998604070 1911 dbSNP
rs901145840 1914 dbSNP
rs1036926680 1920 dbSNP
rs1261329880 1921 dbSNP
rs939962970 1929 dbSNP
rs1204903002 1930 dbSNP
rs1486894733 1932 dbSNP
rs1000714136 1933 dbSNP
rs1337425706 1944 dbSNP
rs900603020 1948 dbSNP
rs1039023846 1951 dbSNP
rs1311195724 1957 dbSNP
rs1317293546 1970 dbSNP
rs944698717 1975 dbSNP
rs1258874450 1981 dbSNP
rs1203784886 1982 dbSNP
rs1241930022 1983 dbSNP
rs890339082 1986 dbSNP
rs1047714942 1989 dbSNP
rs1253187465 1991 dbSNP
rs888348573 1996 dbSNP
rs5795052 2000 dbSNP
rs201618058 2016 dbSNP
rs1048246778 2020 dbSNP
rs1471214938 2022 dbSNP
rs745402761 2025 dbSNP
rs920452100 2028 dbSNP
rs1405359082 2029 dbSNP
rs1294655137 2031 dbSNP
rs1383355797 2032 dbSNP
rs937843881 2033 dbSNP
rs1321803705 2046 dbSNP
rs926368501 2058 dbSNP
rs1390569406 2063 dbSNP
rs981849580 2099 dbSNP
rs949085228 2101 dbSNP
rs1404336742 2106 dbSNP
rs973156684 2112 dbSNP
rs1223978732 2114 dbSNP
rs574129418 2119 dbSNP
rs1174631263 2121 dbSNP
rs1320789433 2134 dbSNP
rs554546586 2138 dbSNP
rs937732278 2150 dbSNP
rs1251505117 2151 dbSNP
rs150447472 2158 dbSNP
rs1177011541 2159 dbSNP
rs1248791733 2160 dbSNP
rs987793896 2172 dbSNP
rs185331810 2175 dbSNP
rs766611475 2176 dbSNP
rs1024506471 2179 dbSNP
rs1172863520 2192 dbSNP
rs978930576 2202 dbSNP
rs1355364953 2209 dbSNP
rs1248763107 2212 dbSNP
rs1461623123 2214 dbSNP
rs563449020 2227 dbSNP
rs1202930316 2231 dbSNP
rs370677292 2234 dbSNP
rs1028841401 2236 dbSNP
rs558539235 2245 dbSNP
rs1033572774 2248 dbSNP
rs998259638 2250 dbSNP
rs1000382256 2256 dbSNP
rs1215782562 2259 dbSNP
rs1459885743 2265 dbSNP
rs1264960451 2275 dbSNP
rs140670344 2287 dbSNP
rs1015575157 2290 dbSNP
rs1321234963 2292 dbSNP
rs1338519516 2296 dbSNP
rs1250048885 2300 dbSNP
rs1490939898 2317 dbSNP
rs1004159706 2318 dbSNP
rs888402614 2323 dbSNP
rs750792606 2324 dbSNP
rs1008899212 2335 dbSNP
rs1479717732 2335 dbSNP
rs545210818 2335 dbSNP
rs1420241156 2351 dbSNP
rs372743927 2357 dbSNP
rs550336036 2359 dbSNP
rs745618626 2360 dbSNP
rs929237440 2366 dbSNP
rs949193081 2371 dbSNP
rs899097583 2380 dbSNP
rs1037907857 2382 dbSNP
rs1360658045 2393 dbSNP
rs913633660 2405 dbSNP
rs1449863725 2410 dbSNP
rs369270469 2412 dbSNP
rs1336725761 2418 dbSNP
rs1450404933 2420 dbSNP
rs936284581 2434 dbSNP
rs1242840490 2444 dbSNP
rs1396305444 2446 dbSNP
rs1166335393 2448 dbSNP
rs34734730 2448 dbSNP
rs981861956 2449 dbSNP
rs536737067 2451 dbSNP
rs574701440 2465 dbSNP
rs1383082117 2471 dbSNP
rs978981361 2478 dbSNP
rs180924037 2483 dbSNP
rs547769658 2484 dbSNP
rs921464388 2488 dbSNP
rs578045890 2496 dbSNP
rs1188233901 2514 dbSNP
rs965522563 2517 dbSNP
rs926234107 2525 dbSNP
rs527643906 2533 dbSNP
rs1015627490 2536 dbSNP
rs565585912 2537 dbSNP
rs964916000 2539 dbSNP
rs1017693121 2540 dbSNP
rs1009013744 2542 dbSNP
rs551758701 2548 dbSNP
rs952680713 2549 dbSNP
rs774975012 2550 dbSNP
rs1206939588 2551 dbSNP
rs1244982428 2552 dbSNP
rs531814094 2556 dbSNP
rs1026707529 2559 dbSNP
rs1241106232 2566 dbSNP
rs746726011 2567 dbSNP
rs993523574 2569 dbSNP
rs1177753163 2571 dbSNP
rs899042883 2572 dbSNP
rs1398834611 2577 dbSNP
rs1406098122 2581 dbSNP
rs1469033955 2584 dbSNP
rs1243052358 2586 dbSNP
rs1360997899 2590 dbSNP
rs1286458730 2591 dbSNP
rs1339131953 2596 dbSNP
rs1449447412 2598 dbSNP
rs1444778002 2600 dbSNP
rs1335519523 2606 dbSNP
rs1327210101 2608 dbSNP
rs188063299 2612 dbSNP
rs1001986373 2613 dbSNP
rs905065393 2620 dbSNP
rs1324355372 2621 dbSNP
rs1203327228 2622 dbSNP
rs1046262646 2626 dbSNP
rs543152327 2634 dbSNP
rs1307579837 2638 dbSNP
rs1013835303 2641 dbSNP
rs1439732023 2649 dbSNP
rs892223394 2650 dbSNP
rs574198743 2654 dbSNP
rs936336994 2655 dbSNP
rs1201500567 2659 dbSNP
rs113819550 2662 dbSNP
rs1231130249 2668 dbSNP
rs1184034658 2670 dbSNP
rs1483264790 2677 dbSNP
rs1398223826 2679 dbSNP
rs541037763 2680 dbSNP
rs1050498112 2685 dbSNP
rs1329975337 2687 dbSNP
rs932945637 2691 dbSNP
rs1052496890 2692 dbSNP
rs921505054 2694 dbSNP
rs1219877037 2696 dbSNP
rs976984745 2699 dbSNP
rs1285724027 2700 dbSNP
rs571919687 2701 dbSNP
rs908641330 2702 dbSNP
rs979070358 2712 dbSNP
rs964860142 2715 dbSNP
rs1196540052 2719 dbSNP
rs145161719 2722 dbSNP
rs1481944788 2725 dbSNP
rs1224696663 2727 dbSNP
rs1269477038 2729 dbSNP
rs1350535769 2735 dbSNP
rs1278297084 2741 dbSNP
rs376034441 2742 dbSNP
rs987656428 2744 dbSNP
rs1475575310 2746 dbSNP
rs1166946074 2749 dbSNP
rs1389998178 2750 dbSNP
rs77823321 2756 dbSNP
rs758338896 2758 dbSNP
rs1230556804 2780 dbSNP
rs1351547922 2781 dbSNP
rs1366754889 2784 dbSNP
rs952733079 2789 dbSNP
rs1404811808 2791 dbSNP
rs954746660 2793 dbSNP
rs1026404409 2795 dbSNP
rs540628987 2796 dbSNP
rs1002608468 2797 dbSNP
rs1269807895 2809 dbSNP
rs1016584293 2815 dbSNP
rs141469619 2819 dbSNP
rs576348606 2822 dbSNP
rs1358659367 2825 dbSNP
rs556393417 2827 dbSNP
rs1046188804 2828 dbSNP
rs1263295605 2828 dbSNP
rs553666601 2828 dbSNP
rs1400226363 2830 dbSNP
rs1025273106 2836 dbSNP
rs1446027853 2844 dbSNP
rs1165873742 2846 dbSNP
rs1386176517 2850 dbSNP
rs1161303933 2857 dbSNP
rs1457905569 2859 dbSNP
rs1161967583 2868 dbSNP
rs746722403 2869 dbSNP
rs1428425383 2881 dbSNP
rs567756385 2886 dbSNP
rs1478776542 2889 dbSNP
rs547538390 2892 dbSNP
rs1454730479 2893 dbSNP
rs534219258 2895 dbSNP
rs1214372255 2901 dbSNP
rs571527906 2917 dbSNP
rs1315477255 2924 dbSNP
rs1052203702 2925 dbSNP
rs1444791604 2932 dbSNP
rs936328068 2932 dbSNP
rs1282751636 2933 dbSNP
rs779042625 2935 dbSNP
rs1204057598 2938 dbSNP
rs185684376 2939 dbSNP
rs1462378702 2952 dbSNP
rs903591694 2953 dbSNP
rs1244199955 2955 dbSNP
rs1330204170 2959 dbSNP
rs772984545 2960 dbSNP
rs1043310435 2961 dbSNP
rs1369953778 2962 dbSNP
rs1275670361 2963 dbSNP
rs943578017 2964 dbSNP
rs1454718626 2973 dbSNP
rs1386457226 2974 dbSNP
rs182351794 2974 dbSNP
rs565507424 2974 dbSNP
rs910817675 2974 dbSNP
rs931635144 2975 dbSNP
rs1394102103 2979 dbSNP
rs562796334 2981 dbSNP
rs549175216 2982 dbSNP
rs1041658866 2986 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.668 6.3e-3 0.720 2.8e-3 13 Click to see details
GSE21032 Prostate cancer 0.266 7.5e-3 0.267 7.3e-3 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.461 1.0e-2 0.516 4.1e-3 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.728 1.3e-2 0.350 1.8e-1 9 Click to see details
GSE42095 Differentiated embryonic stem cells -0.425 2.2e-2 -0.441 1.8e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.402 2.6e-2 -0.257 1.1e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.382 3.0e-2 -0.308 6.7e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.387 4.6e-2 -0.277 1.2e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.422 5.2e-2 -0.426 5.0e-2 16 Click to see details
GSE28544 Breast cancer 0.322 6.2e-2 0.190 1.9e-1 24 Click to see details
GSE21849 B cell lymphoma -0.227 1.2e-1 -0.239 1.1e-1 29 Click to see details
GSE17498 Multiple myeloma 0.158 1.7e-1 0.113 2.4e-1 40 Click to see details
GSE17306 Multiple myeloma -0.124 2.0e-1 -0.163 1.3e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.07 2.9e-1 0.057 3.3e-1 64 Click to see details
GSE38226 Liver fibrosis -0.081 3.6e-1 -0.252 1.4e-1 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.083 3.6e-1 0.113 3.2e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.061 3.7e-1 -0.068 3.6e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.026 4.0e-1 0.087 2.1e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.073 4.1e-1 0.035 4.6e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.015 4.5e-1 0.075 2.6e-1 79 Click to see details
GSE19536 Breast cancer 0.012 4.5e-1 0.024 4.1e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.578 0 -0.551 0 32 Click to see details
ESCA -0.695 0.01 -0.745 0 11 Click to see details
BLCA -0.565 0.01 -0.586 0.01 17 Click to see details
PRAD -0.264 0.03 -0.266 0.03 50 Click to see details
KIRC -0.203 0.05 -0.237 0.03 68 Click to see details
PAAD 0.894 0.05 0.800 0.1 4 Click to see details
BRCA -0.178 0.05 -0.193 0.04 83 Click to see details
LUAD -0.484 0.06 -0.364 0.12 12 Click to see details
UCEC 0.356 0.07 0.218 0.18 19 Click to see details
THCA 0.176 0.09 0.162 0.11 59 Click to see details
KICH -0.244 0.12 -0.223 0.14 25 Click to see details
PCPG 0.794 0.21 0.500 0.33 3 Click to see details
CHOL 0.191 0.31 0.200 0.3 9 Click to see details
KIRP -0.065 0.36 -0.058 0.38 32 Click to see details
CESC 0.22 0.43 0.500 0.33 3 Click to see details
LIHC 0.021 0.44 0.069 0.32 49 Click to see details
HNSC -0.006 0.48 0.055 0.36 42 Click to see details
LUSC -0.002 0.5 -0.057 0.37 38 Click to see details
LUSC -0.002 0.5 -0.057 0.37 38 Click to see details
373 hsa-miR-454-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007251 SMAD4 SMAD family member 4 5 8
MIRT039219 KCTD12 potassium channel tetramerization domain containing 12 1 1
MIRT039220 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT039221 ZBTB4 zinc finger and BTB domain containing 4 2 7
MIRT039222 SPTSSA serine palmitoyltransferase small subunit A 1 1
MIRT039223 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT039224 METTL2A methyltransferase like 2A 1 1
MIRT039225 C6orf120 chromosome 6 open reading frame 120 1 1
MIRT039226 CSPP1 centrosome and spindle pole associated protein 1 1 1
MIRT039227 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT039228 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT039229 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT039230 RPL4 ribosomal protein L4 1 1
MIRT039231 POLR2A RNA polymerase II subunit A 1 1
MIRT039232 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT039233 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT039234 SIK3 SIK family kinase 3 1 1
MIRT039235 ZNF805 zinc finger protein 805 1 1
MIRT039236 TET1 tet methylcytosine dioxygenase 1 1 1
MIRT039237 HMGXB3 HMG-box containing 3 1 1
MIRT039238 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT039239 PCSK6 proprotein convertase subtilisin/kexin type 6 1 1
MIRT039240 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT039241 MED12 mediator complex subunit 12 1 1
MIRT039242 FLNC filamin C 1 1
MIRT039243 STK38 serine/threonine kinase 38 1 1
MIRT039244 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT039245 TP53 tumor protein p53 1 1
MIRT039246 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT039247 PPP1R7 protein phosphatase 1 regulatory subunit 7 1 1
MIRT039248 GID4 GID complex subunit 4 homolog 1 1
MIRT039249 PHF12 PHD finger protein 12 2 3
MIRT039250 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT057500 CEP55 centrosomal protein 55 2 4
MIRT060511 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT061519 OTUD3 OTU deubiquitinase 3 2 2
MIRT061804 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT062715 MLEC malectin 2 4
MIRT063602 FBXO28 F-box protein 28 2 2
MIRT064810 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT065626 CLIC4 chloride intracellular channel 4 2 4
MIRT065898 RAB5B RAB5B, member RAS oncogene family 2 8
MIRT071011 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT071920 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT075119 C16ORF70 chromosome 16 open reading frame 70 2 4
MIRT076031 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 6
MIRT079272 NPTX1 neuronal pentraxin 1 2 2
MIRT079362 CCDC137 coiled-coil domain containing 137 2 2
MIRT081131 LDLR low density lipoprotein receptor 2 6
MIRT083130 BTBD3 BTB domain containing 3 2 12
MIRT083156 SEC23B Sec23 homolog B, coat complex II component 2 4
MIRT086442 NABP1 nucleic acid binding protein 1 2 6
MIRT087868 CBY1 chibby family member 1, beta catenin antagonist 2 4
MIRT088348 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT090809 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT090904 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT091219 USP13 ubiquitin specific peptidase 13 2 2
MIRT091700 TGFBR2 transforming growth factor beta receptor 2 2 6
MIRT092494 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT095388 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096901 ERBB2IP erbb2 interacting protein 2 2
MIRT097422 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT097465 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT099324 QKI QKI, KH domain containing RNA binding 2 4
MIRT099841 SOX4 SRY-box 4 2 10
MIRT100782 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT101821 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT102154 POP7 POP7 homolog, ribonuclease P/MRP subunit 2 4
MIRT102235 HBP1 HMG-box transcription factor 1 2 2
MIRT102624 UBN2 ubinuclein 2 2 8
MIRT105313 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT105436 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT105807 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT107283 FAM73B mitoguardin 2 2 2
MIRT108268 HABP4 hyaluronan binding protein 4 2 4
MIRT108885 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT109677 KLHL15 kelch like family member 15 2 6
MIRT109831 MID1IP1 MID1 interacting protein 1 2 8
MIRT123867 FZD6 frizzled class receptor 6 2 8
MIRT126574 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT130148 TXNIP thioredoxin interacting protein 2 6
MIRT132502 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT134787 CCND2 cyclin D2 2 2
MIRT139885 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT142443 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT154001 PRNP prion protein 2 2
MIRT162279 LMLN leishmanolysin like peptidase 2 4
MIRT164540 MSMO1 methylsterol monooxygenase 1 2 2
MIRT178076 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT178935 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT179073 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT180851 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 4
MIRT182976 TROVE2 TROVE domain family member 2 2 2
MIRT193030 TMOD3 tropomodulin 3 2 8
MIRT195765 ATMIN ATM interactor 2 6
MIRT196627 TAOK1 TAO kinase 1 2 6
MIRT212153 CLCN3 chloride voltage-gated channel 3 2 4
MIRT217615 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT220701 MTPN myotrophin 2 4
MIRT222278 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT223641 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 4
MIRT224762 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT227998 NFIB nuclear factor I B 2 4
MIRT230983 PRRG4 proline rich and Gla domain 4 2 2
MIRT242671 SALL3 spalt like transcription factor 3 2 4
MIRT243099 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT244079 EDN1 endothelin 1 2 2
MIRT246462 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT248079 SLC38A2 solute carrier family 38 member 2 2 4
MIRT270943 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT295182 ZNF317 zinc finger protein 317 2 4
MIRT296535 STX16 syntaxin 16 2 2
MIRT301578 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT316378 PPP1R14C protein phosphatase 1 regulatory inhibitor subunit 14C 2 2
MIRT323697 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT327914 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT367113 ZNF711 zinc finger protein 711 2 4
MIRT368759 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT407342 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT448324 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448957 CDK19 cyclin dependent kinase 19 2 4
MIRT449145 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT454117 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT459833 TPP1 tripeptidyl peptidase 1 2 2
MIRT460418 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT461658 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT462949 ZNF800 zinc finger protein 800 2 12
MIRT463646 YY1 YY1 transcription factor 2 8
MIRT464853 RPS27A ribosomal protein S27a 2 12
MIRT464873 UBB ubiquitin B 2 8
MIRT466321 THRA thyroid hormone receptor, alpha 2 2
MIRT466828 STX6 syntaxin 6 2 6
MIRT467415 SNTB1 syntrophin beta 1 2 4
MIRT467456 SNAPIN SNAP associated protein 2 2
MIRT468561 SERINC3 serine incorporator 3 2 10
MIRT469808 RAB14 RAB14, member RAS oncogene family 2 2
MIRT469869 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470335 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473777 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474740 KIF13A kinesin family member 13A 2 6
MIRT474957 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT475482 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT476297 GMFB glia maturation factor beta 2 10
MIRT477365 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477491 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478112 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479819 CCNA2 cyclin A2 2 6
MIRT480020 CAPRIN2 caprin family member 2 2 4
MIRT480841 BLCAP bladder cancer associated protein 2 10
MIRT481612 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT481871 ANKRD50 ankyrin repeat domain 50 2 2
MIRT484940 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485124 SECISBP2L SECIS binding protein 2 like 2 4
MIRT485438 KLF6 Kruppel like factor 6 2 2
MIRT485572 FOXQ1 forkhead box Q1 2 2
MIRT485647 DICER1 dicer 1, ribonuclease III 2 8
MIRT486744 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT490885 OSBP oxysterol binding protein 2 2
MIRT491424 PDZD11 PDZ domain containing 11 2 4
MIRT491646 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491792 ZNF24 zinc finger protein 24 2 2
MIRT492269 SIK1 salt inducible kinase 1 2 6
MIRT493093 MMGT1 membrane magnesium transporter 1 2 12
MIRT498068 SNX5 sorting nexin 5 2 6
MIRT498875 ZNF12 zinc finger protein 12 2 10
MIRT499895 KIAA1191 KIAA1191 2 4
MIRT500406 ZMAT3 zinc finger matrin-type 3 2 10
MIRT500732 TRIM37 tripartite motif containing 37 2 2
MIRT500921 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT501472 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 8
MIRT501552 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501785 NRBF2 nuclear receptor binding factor 2 2 6
MIRT501993 MAPK1 mitogen-activated protein kinase 1 2 10
MIRT502012 MAP7 microtubule associated protein 7 2 8
MIRT502417 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT502517 ESR1 estrogen receptor 1 2 2
MIRT502758 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT503052 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 2 2
MIRT503473 ZNF154 zinc finger protein 154 2 6
MIRT503676 SLC46A1 solute carrier family 46 member 1 2 2
MIRT504270 PARP1 poly(ADP-ribose) polymerase 1 2 6
MIRT504554 ZNF417 zinc finger protein 417 2 6
MIRT504683 ATP6V0D1 ATPase H+ transporting V0 subunit d1 2 6
MIRT505250 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT505876 POLR1B RNA polymerase I subunit B 2 4
MIRT506465 NACC2 NACC family member 2 2 4
MIRT506506 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506690 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT507905 CALM2 calmodulin 2 2 6
MIRT509659 ZNF354B zinc finger protein 354B 2 10
MIRT510724 SPG20 spartin 2 6
MIRT510863 RAN RAN, member RAS oncogene family 2 8
MIRT511092 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511247 KLHL36 kelch like family member 36 2 6
MIRT513212 RFT1 RFT1 homolog 2 2
MIRT513618 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT513716 RBM20 RNA binding motif protein 20 2 4
MIRT513910 GRB10 growth factor receptor bound protein 10 2 6
MIRT514366 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT517865 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT521314 RRAGD Ras related GTP binding D 2 4
MIRT521697 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 8
MIRT521771 PPIG peptidylprolyl isomerase G 2 8
MIRT524502 CEP170 centrosomal protein 170 2 4
MIRT527459 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT530125 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530844 RAG1 recombination activating 1 2 4
MIRT531099 PEX13 peroxisomal biogenesis factor 13 2 2
MIRT533490 TRIM71 tripartite motif containing 71 2 2
MIRT534267 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534718 RFX7 regulatory factor X7 2 2
MIRT535265 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 4
MIRT536337 LEFTY1 left-right determination factor 1 2 2
MIRT536405 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT538270 CUL3 cullin 3 2 4
MIRT538411 COX20 COX20, cytochrome c oxidase assembly factor 2 2
MIRT539457 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT540445 RBM43 RNA binding motif protein 43 2 2
MIRT541131 RAB34 RAB34, member RAS oncogene family 2 2
MIRT543568 RPF2 ribosome production factor 2 homolog 2 4
MIRT544105 IPMK inositol polyphosphate multikinase 2 2
MIRT544487 TRIM4 tripartite motif containing 4 2 2
MIRT544690 ZNF224 zinc finger protein 224 2 4
MIRT544986 MFF mitochondrial fission factor 2 4
MIRT546273 TMEM30A transmembrane protein 30A 2 4
MIRT546562 SATB2 SATB homeobox 2 2 2
MIRT546654 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT546774 RLIM ring finger protein, LIM domain interacting 2 2
MIRT546956 SFTPA1 surfactant protein A1 2 2
MIRT547040 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547494 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547911 HOXA5 homeobox A5 2 2
MIRT548401 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548479 EGLN3 egl-9 family hypoxia inducible factor 3 2 2
MIRT548645 DAPK1 death associated protein kinase 1 2 2
MIRT548852 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT548889 CHEK2 checkpoint kinase 2 2 4
MIRT549138 BRWD1 bromodomain and WD repeat domain containing 1 2 4
MIRT549183 BMP3 bone morphogenetic protein 3 2 2
MIRT549335 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549433 ACVR1 activin A receptor type 1 2 2
MIRT549463 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549491 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT550212 MAVS mitochondrial antiviral signaling protein 2 4
MIRT551702 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT552152 DAD1 defender against cell death 1 2 2
MIRT552358 ZNF620 zinc finger protein 620 2 2
MIRT552521 ZIC5 Zic family member 5 2 2
MIRT552848 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT552885 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553307 TSPAN3 tetraspanin 3 2 2
MIRT553347 TRPC3 transient receptor potential cation channel subfamily C member 3 5 4
MIRT553714 TCF7L2 transcription factor 7 like 2 2 2
MIRT553895 SUN2 Sad1 and UNC84 domain containing 2 2 4
MIRT554851 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT555078 PURG purine rich element binding protein G 2 2
MIRT555198 PRUNE2 prune homolog 2 2 2
MIRT556193 MCC mutated in colorectal cancers 2 2
MIRT556224 MB21D2 Mab-21 domain containing 2 2 2
MIRT556482 LIPA lipase A, lysosomal acid type 2 2
MIRT556965 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT557022 HOXD11 homeobox D11 2 2
MIRT557076 HOXB3 homeobox B3 2 2
MIRT557580 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT558280 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT558415 DEPDC1 DEP domain containing 1 2 2
MIRT558769 CFL2 cofilin 2 2 2
MIRT559632 AKIRIN2 akirin 2 2 2
MIRT560230 KLHL21 kelch like family member 21 2 4
MIRT560649 ZNF107 zinc finger protein 107 2 2
MIRT560931 CDK2AP2 cyclin dependent kinase 2 associated protein 2 2 2
MIRT563754 ZNF678 zinc finger protein 678 2 2
MIRT566007 RNF11 ring finger protein 11 2 2
MIRT566158 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT566692 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT567065 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567532 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567767 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT567831 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT571621 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT573076 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT610908 NF2 neurofibromin 2 2 2
MIRT620056 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT623177 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT627016 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627082 SF3A1 splicing factor 3a subunit 1 2 2
MIRT628280 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629099 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629239 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629415 ADM2 adrenomedullin 2 2 2
MIRT629590 RFC2 replication factor C subunit 2 2 2
MIRT629643 WDR31 WD repeat domain 31 2 2
MIRT629804 GPR82 G protein-coupled receptor 82 2 2
MIRT629878 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629922 POLR2D RNA polymerase II subunit D 2 2
MIRT629987 NARS asparaginyl-tRNA synthetase 2 2
MIRT630048 TERF2 telomeric repeat binding factor 2 2 2
MIRT630066 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630161 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630256 SMTNL2 smoothelin like 2 2 2
MIRT630286 PSMB5 proteasome subunit beta 5 2 2
MIRT630350 NKAP NFKB activating protein 2 2
MIRT630500 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT632051 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT632476 RPS15A ribosomal protein S15a 2 2
MIRT632603 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632999 DUSP18 dual specificity phosphatase 18 2 2
MIRT633086 CXorf21 chromosome X open reading frame 21 2 2
MIRT635056 MYH11 myosin heavy chain 11 2 2
MIRT635949 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636660 CDK4 cyclin dependent kinase 4 2 2
MIRT637191 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637930 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT641813 USP32 ubiquitin specific peptidase 32 2 2
MIRT642648 PTGR2 prostaglandin reductase 2 2 2
MIRT644240 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644669 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645097 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645997 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646512 FAM217B family with sequence similarity 217 member B 2 2
MIRT646778 IL23R interleukin 23 receptor 2 2
MIRT648519 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT651469 XIAP X-linked inhibitor of apoptosis 2 2
MIRT654353 RBM27 RNA binding motif protein 27 2 2
MIRT660831 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT661183 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT661244 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662847 OMD osteomodulin 2 2
MIRT662922 MED18 mediator complex subunit 18 2 2
MIRT663549 CCR6 C-C motif chemokine receptor 6 2 2
MIRT664360 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT666085 SSTR2 somatostatin receptor 2 2 2
MIRT666261 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666681 RBM23 RNA binding motif protein 23 2 2
MIRT667233 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667760 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669264 C4orf36 chromosome 4 open reading frame 36 2 2
MIRT671480 FLYWCH2 FLYWCH family member 2 2 2
MIRT671502 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671930 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672297 GP2 glycoprotein 2 2 2
MIRT672608 IRF1 interferon regulatory factor 1 2 2
MIRT674033 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674225 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674535 PRR23A proline rich 23A 2 2
MIRT675107 SNTB2 syntrophin beta 2 2 2
MIRT675273 ZNF431 zinc finger protein 431 2 2
MIRT684270 PRPF4 pre-mRNA processing factor 4 2 2
MIRT694280 ZNF529 zinc finger protein 529 2 4
MIRT698253 TMEM2 transmembrane protein 2 2 2
MIRT699912 RUNDC1 RUN domain containing 1 2 2
MIRT702594 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT705199 BTG1 BTG anti-proliferation factor 1 2 2
MIRT706927 THAP6 THAP domain containing 6 2 2
MIRT708878 MOCS2 molybdenum cofactor synthesis 2 2 2
MIRT709115 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709615 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT710589 CDCA4 cell division cycle associated 4 2 2
MIRT710793 IFNLR1 interferon lambda receptor 1 2 2
MIRT711775 RFXAP regulatory factor X associated protein 2 2
MIRT713336 KLRD1 killer cell lectin like receptor D1 2 2
MIRT713633 MED8 mediator complex subunit 8 2 2
MIRT713907 IGF2R insulin like growth factor 2 receptor 2 2
MIRT715061 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715178 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT715196 FKTN fukutin 2 2
MIRT715272 RNF125 ring finger protein 125 2 2
MIRT717800 FAM114A1 family with sequence similarity 114 member A1 2 2
MIRT720536 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT736758 TSPAN1 tetraspanin 1 4 0
MIRT736759 FAM83A family with sequence similarity 83 member A 4 0
MIRT736761 SBF2 SET binding factor 2 3 0
MIRT736853 FRZB frizzled-related protein 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-454 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-454-3p 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-454-3p Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-454-3p Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-454 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-454 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-454-3p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-(benzyloxy)cyclopentyl)methanol 385240 NSC676353 sensitive
hsa-miR-454-3p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-454-3p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-454-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-454-3p (2e)-5,6-dimethoxy-2-[(3-phenacyloxyphenyl)methylidene]-3h-inden-1-one 45028869 NSC744650 sensitive
hsa-miR-454-3p (3S,8R,9S,10R,13S,14S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthrene-3,17-diol 24204037 NSC730478 resistant
hsa-miR-454-3p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-454-3p (4-(1,3-dihydro-2h-pyrrolo[3,4-b]quinolin-2-ylcarbonyl)-2-oxotetrahydro-3-furanyl)methyl acetate 283490 NSC138333 sensitive
hsa-miR-454-3p (4E,5Z)-4,5-bis[(6-bromoquinazolin-4-yl)hydrazinylidene]pentane-1,2,3-triol 54611941 NSC716031 sensitive
hsa-miR-454-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-454-3p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-454-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-454-3p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-454-3p (5e)-2-[[5-methyl-4-[5-methyl-2-[[(5e)-5-[(4-methylphenyl)methylidene]-4-oxo-1,3-thiazol-2-yl]amino]-1,3-thiazol-4-yl]-1,3-thiazol-2-yl]amino]-5-[(4-methylphenyl)methylidene]-1,3-thiazol-4-one NSC730523 resistant
hsa-miR-454-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-454-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-454-3p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-454-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-454-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-454-3p (E)-3-(4-phenylphenyl)-1-thiophen-2-ylprop-2-en-1-one 5782484 NSC700125 sensitive
hsa-miR-454-3p (e)-5-morpholin-4-yl-1,2-diphenylpent-1-en-3-one;hydrochloride 5386798 NSC617826 sensitive
hsa-miR-454-3p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 sensitive
hsa-miR-454-3p (z)-1-(5-chloro-2-hydroxyphenyl)-3-quinolin-2-ylprop-2-en-1-one NSC71097 sensitive
hsa-miR-454-3p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 sensitive
hsa-miR-454-3p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-454-3p [(2r,3s,4r,5r)-5-(6-chloropurin-9-yl)-4-hydroxy-2-(trityloxymethyl)oxolan-3-yl] benzoate 401669 NSC715399 sensitive
hsa-miR-454-3p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-454-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-454-3p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24204032 NSC730473 resistant
hsa-miR-454-3p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 sensitive
hsa-miR-454-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 sensitive
hsa-miR-454-3p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 sensitive
hsa-miR-454-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-454-3p [2-[[5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-3-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 6712908 NSC719661 sensitive
hsa-miR-454-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-454-3p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-454-3p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 sensitive
hsa-miR-454-3p 1-(3-chlorophenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5494177 NSC668335 sensitive
hsa-miR-454-3p 1-(4-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465916 NSC668325 sensitive
hsa-miR-454-3p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-454-3p 1-[(E)-(5-hydroxypyridin-2-yl)methylideneamino]-3-pyridin-3-ylthiourea 135443616 NSC185065 sensitive
hsa-miR-454-3p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-454-3p 1-[(E)-1H-indol-3-ylmethylideneamino]-2-phenylguanidine;nitric acid 135439995 NSC644582 resistant
hsa-miR-454-3p 1-[(z)-(2-oxoindolin-3-ylidene)amino]-3-(2-pyridylmethyl)thiourea 3005083 NSC670961 sensitive
hsa-miR-454-3p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-454-3p 1-[2-(2-pyridyl)ethyl]-3-[(e)-2-pyridylmethyleneamino]thiourea 9571904 NSC670779 sensitive
hsa-miR-454-3p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-454-3p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 resistant
hsa-miR-454-3p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 sensitive
hsa-miR-454-3p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]thiourea 5871897 NSC689540 sensitive
hsa-miR-454-3p 11-[(E)-2-(dimethylamino)ethenyl]pyrido[2,3-b]acridine-5,12-dione 5468977 NSC680733 resistant
hsa-miR-454-3p 11-[2-(dimethylamino)ethyl]pyrido[2,3-b]acridine-5,12-dione 387193 NSC680734 resistant
hsa-miR-454-3p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-454-3p 12-iminodaunorubicin hcl 72400 NSC254681 sensitive
hsa-miR-454-3p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-454-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-phenyl- 369537 NSC641394 sensitive
hsa-miR-454-3p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-454-3p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 sensitive
hsa-miR-454-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-454-3p 2-(3,5-bis(chloromethyl)-4-methoxyphenyl)-4h-thiochromen-4-one 355507 NSC609259 sensitive
hsa-miR-454-3p 2-(4-((oxiran-2-yl)methoxy)styryl)-4,5-dihydrooxazole 24206038 NSC737757 sensitive
hsa-miR-454-3p 2-(5-bromo-6-formyl-3-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2h)-yl)ethyl nitrate 383812 NSC672424 sensitive
hsa-miR-454-3p 2-(hydroxymethyl)-8-methyl-8-azabicyclo[3.2.1]octan-3-one NSC715572 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(4-methoxyphenyl)prop-2-en-1-one;hydrochloride 353911 NSC603553 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-454-3p 2-[(z)-2-(4-chlorophenyl)ethenyl]-1-methylquinolin-1-ium iodide 54598850 NSC10520 resistant
hsa-miR-454-3p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-454-3p 2-[[4-(1h-benzimidazol-2-yl)phenyl]iminomethyl]phenol 402059 NSC715755 sensitive
hsa-miR-454-3p 2-[[4-(2-dimethylaminoethylcarbamoyl)acridin-9-yl]amino]-3-sulfanyl-propanoic acid 392357 NSC692641 sensitive
hsa-miR-454-3p 2-[2-[4-(3-chloro-1,4-dihydroxy-5,8-dioxonaphthalen-2-yl)piperazin-1-yl]ethoxy]ethyl acetate 378769 NSC661939 sensitive
hsa-miR-454-3p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 sensitive
hsa-miR-454-3p 2-benzoyl-N-[(Z)-[[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-[(4-nitrophenyl)diazenyl]methylidene]amino]-5-chlorobenzamide 135493917 NSC681967 sensitive
hsa-miR-454-3p 2-bromo-5,8-dihydroxy-3-methyl-1,4-naphthoquinone 378912 NSC662383 sensitive
hsa-miR-454-3p 2-hydroxy discorhabdin d 362391 NSC626161 sensitive
hsa-miR-454-3p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 sensitive
hsa-miR-454-3p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-454-3p 2,2-dibutyl-7-methyl-1,3,2-benzodioxastannin-4-one 16683125 NSC628560 sensitive
hsa-miR-454-3p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 sensitive
hsa-miR-454-3p 2,6-bis((2-aminophenyl)thio)benzonitrile NSC679800 sensitive
hsa-miR-454-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-454-3p 2,6-bis(pyrrolidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 380174 NSC665622 sensitive
hsa-miR-454-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-454-3p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-454-3p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 sensitive
hsa-miR-454-3p 20-[3-[2-aminoethyl-[3-(15,16-dimethoxy-11,19-dioxo-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-20-yl)propyl]amino]propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8) 45027842 NSC727620 sensitive
hsa-miR-454-3p 3-(3,5-dimethoxyphenoxy)-2-phenyl-7-(trifluoromethyl)quinoxalin-5-amine 393436 NSC695323 sensitive
hsa-miR-454-3p 3-(4-nitrophenyl)-6-phenyl-cyclohex-4-ene-1,1,2,2-tetracarbonitrile 391620 NSC691106 sensitive
hsa-miR-454-3p 3-[(1Z)-1-(1-hydroxypyridin-2-ylidene)ethyl]imino-1,1-dimethylthiourea 44384025 NSC351078 sensitive
hsa-miR-454-3p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-454-3p 3-[[4-(3,4-dihydroxyphenyl)-1,3-thiazol-2-yl]iminomethyl]-4-hydroxychromen-2-one;hydrochloride 135403636 NSC659390 sensitive
hsa-miR-454-3p 3-bromoquinolin-8-ol 384167 NSC673458 sensitive
hsa-miR-454-3p 3-hydroxy-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohexa-2,5-diene-1,4-dione 178981 NSC697134 sensitive
hsa-miR-454-3p 4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione 25181424 NSC741898 sensitive
hsa-miR-454-3p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-454-3p 4-(furo[3,2-c]quinolin-4-ylamino)-n-(2-piperazin-1-ylethyl)benzamide 24204688 NSC732492 resistant
hsa-miR-454-3p 4-[(4e)-4-[(4-chlorophenyl)methylidene]-5-oxo-2-phenylimidazol-1-yl]-3-sulfanylidene-2h-1,2,4-triazin-5-one 5471340 NSC710587 sensitive
hsa-miR-454-3p 4-[(6-sulfanylidene-3,7-dihydropurin-8-yl)diazenyl]benzenesulfonamide 3246283 NSC75140 sensitive
hsa-miR-454-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-454-3p 4-hydroxy-3-[(E)-(4-phenyl-1,3-thiazol-2-yl)iminomethyl]chromen-2-one 135409113 NSC658343 sensitive
hsa-miR-454-3p 4-O-tert-butyl 1-O-propan-2-yl 2-[8-(hydroxymethyl)-12-methoxy-9-oxo-11H-indolizino[1,2-b]quinolin-7-yl]butanedioate 384499 NSC674347 sensitive
hsa-miR-454-3p 4,6-dimethyl-5-phenyl-2-[2-[4-[3-(trifluoromethyl)phenyl]piperazin-1-yl]ethyl]pyrrolo[3,4-c]pyrrole-1,3-dione 401045 NSC713750 sensitive
hsa-miR-454-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 sensitive
hsa-miR-454-3p 5-(1-adamantyl)-2-benzyloxy-1h-benzimidazole 394400 NSC697859 sensitive
hsa-miR-454-3p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5h-benzo[b]carbazole-6,11-dione 404489 NSC720725 resistant
hsa-miR-454-3p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 sensitive
hsa-miR-454-3p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 sensitive
hsa-miR-454-3p 5-chloro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572096 NSC703111 sensitive
hsa-miR-454-3p 5-fluoro-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572046 NSC693634 sensitive
hsa-miR-454-3p 5-hp 135453292 NSC107392 sensitive
hsa-miR-454-3p 5-methyl-n-[(e)-1-pyridin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572094 NSC703109 sensitive
hsa-miR-454-3p 5-nitro-n-[(e)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519692 NSC693620 sensitive
hsa-miR-454-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-454-3p 5,7-bis(trifluoromethyl)-2,3-dihydro-[1,2]thiazolo[2,3-a]azepine 1,1-dioxide 354292 NSC605440 sensitive
hsa-miR-454-3p 6-(3-aminopropyl)-9-methoxyindeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 17755854 NSC736988 sensitive
hsa-miR-454-3p 6h-purine-6-thione, 1,7-dihydro-, mercury complex (9ci) NSC68294 sensitive
hsa-miR-454-3p 7-[3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-3h-thieno[3,4-d]pyrimidine-4-thione 3005067 NSC670036 sensitive
hsa-miR-454-3p 7-[4,5-bis(4-methylphenoxy)oxolan-2-yl]-6-chloropurine 389531 NSC685828 sensitive
hsa-miR-454-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-454-3p 7-methoxy-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 373631 NSC650351 sensitive
hsa-miR-454-3p 7,8-dichloro-10-[3-(dimethylamino)propyl]benzo[g]pteridine-2,4-dione;hydrochloride 24185927 NSC44684 sensitive
hsa-miR-454-3p 72i9a2i712 221812 NSC6883 sensitive
hsa-miR-454-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-454-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-454-3p 8-phenyl-7,8,9,10-tetrahydropyrimido[4,5-c]isoquinoline-1,3-diamine 401168 NSC714364 resistant
hsa-miR-454-3p 8455ab 1549990 NSC24189 sensitive
hsa-miR-454-3p 9-((2-chloroethyl)thio)-2,7-dimethoxyacridine 395389 NSC699925 sensitive
hsa-miR-454-3p 9-(3-chloro-2-hydroxy-propyl)-1,3-dimethyl-purino[7,8-a]pyrimidine-2,4,8-trione 392199 NSC692332 sensitive
hsa-miR-454-3p 9-(4-sulfamoylanilino)-n-(4-sulfamoylphenyl)acridine-4-carboxamide 365396 NSC633016 sensitive
hsa-miR-454-3p 9-ethylsulfinyl-2,7-dimethoxy-acridine 395385 NSC699921 sensitive
hsa-miR-454-3p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 resistant
hsa-miR-454-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 5-methoxy- 388732 NSC683785 resistant
hsa-miR-454-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-454-3p Alatolid 5359051 NSC295426 sensitive
hsa-miR-454-3p Amonafide 50515 NSC308847 sensitive
hsa-miR-454-3p Antineoplastic-654379 NSC654379 sensitive
hsa-miR-454-3p Antineoplastic-690271 391308 NSC690271 sensitive
hsa-miR-454-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-454-3p Azane;[4-[(dithiocarboxyamino)methyl]cyclohexyl]methylcarbamodithioic acid 54600120 NSC136468 sensitive
hsa-miR-454-3p Benzofurazan, 5-nitro-6-(1-piperidinyl)-, 1-oxide 313603 NSC228132 sensitive
hsa-miR-454-3p Bromocopper;(dipyridin-2-ylmethylideneamino)-[methylsulfanyl(sulfoniumylidene)methyl]azanide 4318826 NSC321206 sensitive
hsa-miR-454-3p Bromocopper;1,1-dimethyl-3-[(E)-1-pyridin-2-ylethylideneamino]thiourea 9578864 NSC635448 sensitive
hsa-miR-454-3p C18281 361185 NSC624114 resistant
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-454-3p Chlorobis(4-ethyltropolonato)bismuth(iii) NSC634368 sensitive
hsa-miR-454-3p Chlorocopper(1+); n-[(e)-1-(2-pyridyl)ethylideneamino]azepane-1-carbothioamide 9578866 NSC635450 sensitive
hsa-miR-454-3p Chlorocopper;1,1-dipropyl-3-[(E)-1-pyridin-2-ylethylideneamino]thiourea 9578865 NSC635449 sensitive
hsa-miR-454-3p Crotonosid 223996 NSC12161 sensitive
hsa-miR-454-3p Cryptophycin b 5468424 NSC670038 resistant
hsa-miR-454-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-454-3p Cyclohexanone, 2,6-bis(piperidinomethyl)- 236587 NSC39202 sensitive
hsa-miR-454-3p Deoxyartemisitene 6712468 NSC690035 sensitive
hsa-miR-454-3p Dianhydrogalactitol 31789 NSC132313 sensitive
hsa-miR-454-3p Diethyl (Z)-2-[3-(2-ethoxy-2-oxoethyl)-2,4-dioxopyrimidin-1-yl]but-2-enedioate 5468905 NSC679002 sensitive
hsa-miR-454-3p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 resistant
hsa-miR-454-3p Dimethyl 5-benzoyl-1-[(Z)-2-[(Z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1-phenylethenyl]-2,3-dihydropyrrolo[1,2-a]imidazole-6,7-dicarboxylate 5468047 NSC663245 sensitive
hsa-miR-454-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-454-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-454-3p Ethyl (E)-3-[(1S,3R)-2-(4-chlorobenzoyl)-3-[(E)-1,3-diethoxy-3-oxoprop-1-enyl]cyclopropyl]-3-ethoxyprop-2-enoate 5469838 NSC693207 sensitive
hsa-miR-454-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-454-3p Ethyl 4-(5-cyano-2-methyl-1-phenyl-6-thioxo-pyrimidin-4-yl)piperazine-1-carboxylate 388267 NSC682881 sensitive
hsa-miR-454-3p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 sensitive
hsa-miR-454-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-454-3p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 resistant
hsa-miR-454-3p Ethyl 8-(4-chlorophenyl)-4-methyl-2-oxo-6-thiophen-2-yl-4a,7-dihydrochromene-3-carboxylate 392311 NSC692587 sensitive
hsa-miR-454-3p Fastigilin c 261577 NSC176507 sensitive
hsa-miR-454-3p Gw814408x 9604912 NSC756377 resistant
hsa-miR-454-3p Haterumalide na methyl esters 24204452 NSC731928 resistant
hsa-miR-454-3p Herbimycin 6436247 NSC305978 sensitive
hsa-miR-454-3p Idebenone 12881464 NSC759228 approved sensitive
hsa-miR-454-3p Incomptina b 5459288 NSC685707 sensitive
hsa-miR-454-3p Indenoisoquinoline derivative 329826 NSC314622 sensitive
hsa-miR-454-3p Inosine dialdehyde 135400916 NSC118994 sensitive
hsa-miR-454-3p Kinamycin c NSC138425 sensitive
hsa-miR-454-3p Kkiqvsbzfbkasx-uhfffaoysa-n 381513 NSC668269 sensitive
hsa-miR-454-3p Laurusin 135476719 NSC106486 sensitive
hsa-miR-454-3p Ls-144122 135408600 NSC52427 sensitive
hsa-miR-454-3p Ls-28225 16683189 NSC643845 sensitive
hsa-miR-454-3p Maxima isoflavone d 343081 NSC382028 resistant
hsa-miR-454-3p Methyl (2e)-2-[[3-(furan-2-carbonyl)-2-sulfanylideneimidazolidin-1-yl]methylidene]-3-oxobutanoate 24203795 NSC729527 resistant
hsa-miR-454-3p Methyl 4-[(2,5-dihydroxyphenyl)methylamino]-2-hydroxybenzoate 390508 NSC687945 sensitive
hsa-miR-454-3p Methyl 5-methyl-2-[(e)-(7-methyl-1-oxo-indan-2-ylidene)methyl]benzoate 6284987 NSC678362 sensitive
hsa-miR-454-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-454-3p Methyl(2r,3as)-2-[(4-hydroxyphenyl)methyl]-1,3,3a,4-tetrahydropyrazolo[1,5-a]indole-2-carboxylate 398179 NSC707774 sensitive
hsa-miR-454-3p N'-((6-methyl-2-pyridinyl)methylene)-1-azepanecarbothiohydrazide 9554750 NSC667876 sensitive
hsa-miR-454-3p N'-(cyano(2-hydroxyphenyl)methyl)-2-phenylacetohydrazide 374997 NSC653823 sensitive
hsa-miR-454-3p N',N'-diethyl-N-(7-nitro-1,4-dioxido-1,2,4-benzotriazine-1,4-diium-3-yl)ethane-1,2-diamine 135426847 NSC628917 sensitive
hsa-miR-454-3p N',N'-diethyl-N-(7-nitro-1,4-dioxido-1,2,4-benzotriazine-1,4-diium-3-yl)ethane-1,2-diamine;hydrochloride 135488943 NSC628918 sensitive
hsa-miR-454-3p N-((3-benzoyl-2-thioxo-1-imidazolidinyl)carbothioyl)-n-phenylbenzamide 396960 NSC704180 sensitive
hsa-miR-454-3p N-(dipyridin-2-ylmethylideneamino)-1,3-benzoxazol-2-amine 404079 NSC720200 sensitive
hsa-miR-454-3p N-[(e)-(2-phenyl-1-pyridin-2-ylethylidene)amino]-1h-benzimidazol-2-amine NSC720194 sensitive
hsa-miR-454-3p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 sensitive
hsa-miR-454-3p N-[(e)-[3-(dimethylamino)-1-phenylpropylidene]amino]aniline;hydrochloride 9569913 NSC625220 sensitive
hsa-miR-454-3p N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine;zinc 9578819 NSC625544 sensitive
hsa-miR-454-3p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-4-pyridin-2-ylpiperazine-1-carbothioamide 9554702 NSC335787 sensitive
hsa-miR-454-3p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 sensitive
hsa-miR-454-3p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 sensitive
hsa-miR-454-3p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 sensitive
hsa-miR-454-3p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 sensitive
hsa-miR-454-3p N-[(E)-1-pyrimidin-4-ylethylideneamino]-1,3-benzothiazol-2-amine 5351439 NSC693632 sensitive
hsa-miR-454-3p N-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]piperidine-1-carbothioamide 5494336 NSC668300 sensitive
hsa-miR-454-3p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 sensitive
hsa-miR-454-3p N-[2-(dimethylamino)ethyl]-9-nitrodibenzo-p-dioxin-1-carboxamide;hydrochloride 370721 NSC644221 sensitive
hsa-miR-454-3p N-[2-[6-amino-3-(chloromethyl)-2,3-dihydroindole-1-carbonyl]-1H-indol-5-yl]-1-benzofuran-2-carboxamide 394235 NSC697539 sensitive
hsa-miR-454-3p N-[2-acetamido-6-[[(2r,3s)-2-(dibenzylamino)-3-hydroxyhexyl]amino]pyrimidin-4-yl]acetamide 396448 NSC702421 sensitive
hsa-miR-454-3p N-[4-[(2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl)oxy]butyl]-1h-indole-2-carboxamide 20826874 NSC726365 sensitive
hsa-miR-454-3p N-[5-[(e)-3-[8-(chloromethyl)-1-methyl-4-phenylmethoxy-7,8-dihydro-3h-pyrrolo[3,2-e]indol-6-yl]-3-oxoprop-1-enyl]-1-methylpyrrol-3-yl]butanamide 5469857 NSC693563 sensitive
hsa-miR-454-3p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-454-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-454-3p None 12201866 NSC179207 sensitive
hsa-miR-454-3p NSC294526 NSC294526 sensitive
hsa-miR-454-3p NSC374998 NSC374998 sensitive
hsa-miR-454-3p NSC605607 NSC605607 sensitive
hsa-miR-454-3p NSC664558 NSC664558 sensitive
hsa-miR-454-3p NSC688995 NSC688995 resistant
hsa-miR-454-3p NSC716032 NSC716032 sensitive
hsa-miR-454-3p NSC751830 NSC751830 resistant
hsa-miR-454-3p NSC762149 NSC762149 resistant
hsa-miR-454-3p O-aminoazotoluene 7340 NSC1797 sensitive
hsa-miR-454-3p Pada 81528 NSC9358 sensitive
hsa-miR-454-3p Pectenotoxin ii 5468320 NSC668555 resistant
hsa-miR-454-3p Pirarubicin hcl 11970024 NSC654509 sensitive
hsa-miR-454-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-454-3p Razoxane 30623 NSC129943 sensitive
hsa-miR-454-3p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 sensitive
hsa-miR-454-3p Salarin c 24867082 NSC750154 resistant
hsa-miR-454-3p Selendale 54601159 NSC347466 resistant
hsa-miR-454-3p Stk849915 NSC691081 sensitive
hsa-miR-454-3p Stl434863 394348 NSC697730 sensitive
hsa-miR-454-3p Tert-butyl 2,6-dioxo-4-[1,2,3,4-tetrakis(phenylmethoxy)butyl]piperidine-3-carboxylate 386078 NSC677666 sensitive
hsa-miR-454-3p Tert-butyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386493 NSC678637 sensitive
hsa-miR-454-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-454-3p Thiosemicarbazone r NSC319725 sensitive
hsa-miR-454-3p Thujaplicin mixture 252101 NSC73300 sensitive
hsa-miR-454-3p Trans-bis(acetato)amminepyridineplatinum(ii) NSC722781 sensitive
hsa-miR-454-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-454-3p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 sensitive
hsa-miR-454-3p Veracoquinazole 135416663 NSC601852 sensitive
hsa-miR-454-3p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-454-3p Z1603789400 236065 NSC38090 sensitive
hsa-miR-454-3p Z734296158 391673 NSC691215 sensitive
hsa-miR-454-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Vincristine 5978 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Daunorubicin 30323 NSC82151 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p L-Asparaginase sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Prednisolone 5755 NSC9120 approved sensitive High Lymphoblastic Leukemia tissue
hsa-miR-454-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (PC-3)
hsa-miR-454-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-454-3p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-454-3p Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-454-3p Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-miR-454-3p Temozolomide 5394 NSC362856 approved resistant High Glioma tissue
hsa-miR-454-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, SKOV3)
hsa-miR-454-3p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma tissue
hsa-miR-454-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive Low Nasopharyngeal Cancer cell line (5-8F, SUNE-1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (IGROV-1, W1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-454-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-454-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-454-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-454-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-454-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-454-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-454-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-454-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-454-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-454-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-454-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-454-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-454-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-454-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-454-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-454-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-454-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-454-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission