miRTarBase - #MIRT039238


—
pre-miRNA Information
pre-miRNA hsa-mir-454   
Genomic Coordinates chr17: 59137758 - 59137872
Synonyms MIRN454, hsa-mir-454, MIR454
Description Homo sapiens miR-454 stem-loop
Comment The mature miRNA sequences were named miR-454-5p and miR-454-3p in .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-454-3p
Sequence 64| UAGUGCAAUAUUGCUUAUAGGGU |86
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30529712 20 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1391884708 2 dbSNP
rs772555392 4 dbSNP
rs555225543 7 dbSNP
rs1450965019 11 dbSNP
rs779514158 12 dbSNP
rs771457463 18 dbSNP
rs377123764 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POFUT2   
Synonyms C21orf80, FUT13
Description protein O-fucosyltransferase 2
Transcript NM_015227   
Other Transcripts NM_133635   
Expression
Putative miRNA Targets on POFUT2
3'UTR of POFUT2
(miRNA target sites are highlighted)		 
>POFUT2|NM_015227|3'UTR
   1 GTCTCCTGTAGCATCTGGTTCAGTGTTTCCCTGGGCTGAAGTTAATTGTTCATCTTGCCCCTTTAGTTCTCATGCACAGA
  81 ATTCCTCCATAGCAGGCTGTTGGCATAGCTGGCCTCGTCTCAGAACCTCTTCTTGTGTCGCATTTTCCCATCATTCCCGG
 161 TTTCTGCCCCTGTCTGCCCCCTGCCCTGAGAGTTGCCCGTGCCCTGGACTTGGGCATGTCCTTGTTGCTGTGTTGTTGAG
 241 CATCCGTGAGCGTCCCCGAGGCCGGGAGCGTGGGCCCTCGTGTGATCATTCTCGTGGGGCTGCCATGAGCGTCCCCAAGG
 321 CTGGGAGCATGGGCCCTCGTGTGATCGTTCTTGTGGGGCTGCCGTGAGCGTCCCCGAGGCCGGGAGCGTGGGCCCTCGTG
 401 TGATCATTCTCGTGGGGCTGCCGTGAGCGTCCCAGAGGCCGGGAGCGTGGGCCCTGCGTGCAGTCATTCCTCTGGGGTTG
 481 CTGTGGGAGGTACGCCTGGGCCTCTGTTCCTCCAAAGACCTGCCTGCCCATCTGCATAGGAGATGAAGGCTGGGGTTAGG
 561 GTGAAACGGTTTGAGTTAAATGGAAAATGAAAGTAGAGGGAATGATCTTCCCCGTGGTTAGCACTGTGCACACGCGTGCG
 641 TCTCTGTGGGTTAGTCTGTCTCTCTCCTGCCCGAGGAATGCTGAGCGCCCTGAGCCGGTGCCTCTTCACACATCTGCTAT
 721 TTCCTGTGGTGTTCTGGGCATGGTGTGTAAGACCCACAGAGGCTCCGGGTGATGCTGTCTGCTGGGTGTGGGTCCCTTTC
 801 CCTGTTAAGCAGACAGGATGCAGCGCTGACTTCTTAGGTCAGGGCGGAGGTGTGCAGGAGCCCAGTTACGAACTCACCCC
 881 TGCTTCTCAGGTGTGGCCTTGGGATTTTGACTGCGACCTTGGCGGTGCTGTCTCCGCAGCCCAGGAAGCCTGCTGTGGGG
 961 AGGCTTCGCACTGAGCTCTCAGCCTCCTGCCCTCAGCTGCGCGAAGCGCTCGGCCCAGCTCACTGAAGCTGCCCTGCCTC
1041 CGGGCCGGCGCGGCCTGCTCTGGCAGGCCCCTGTGTGTGGGGTGGTGAGGGTCTCCCCACCAGTGCTGCACCCCGCAGCA
1121 GCATACAGGCCTGTGTGGCCTGCTGGCCCTGTGGCTCTGTGTACAGCGCTGTGCATGTTACATTTGCTCTGGAAACATCT
1201 CTGGGGTTTGCTTGTTCACGAAGTTCATGAAGTGCCGCTGGAGAGCCAGAGACCAGCTGCGCAGGAGCCGGAGGAACGGG
1281 CAGGCCGCTGACCTGAGGTCTGGAGAAACCCCTGGAGAAGGGTGTCCCCACCAGCCCATACAGCGTGTGTGTGGAGGGGG
1361 CCTTGACCTCCGTGATGTCTACTGTGCCTCAGGATAAGGACCCGCCATGCCCTGGCTAGACAGTGTGTGGTTAGTAGGAA
1441 TCTCTCATTGTTCACCATGTGACCCCCAGGAGGTATTCGACCTGCACTGGCGTGCCTGGCCTGGGATTTGGTGACGGAGA
1521 GGAGGGCTCCCAGGGGGACATGCGGTGGGACAGGAGCGTGGCGGCTGCTGACTGTGGGGTGTGGATGGGGCTGCAGCACC
1601 AGGCAGAGCCCCTCAGGGCGCCGATGTCGAGGGCACCTGAGCGAGGGGTGCCAGCAAGGGGGCGGCCGGCTGGTGGGTGC
1681 TCGGGGGACGGCCGTGTTGGTTCCATGTAACTGTGGAACTCATTTCACTCAGCTGCTCCTCTCAGTTCTCCCTGACTCTG
1761 GAACCTCTGTGACGCCAGTTCTCCCTGACTCTGGAACCTCTGTGATCCTTTGCAGGTTTTTTATTGGCACCTCAGTCTCA
1841 ACATTTTCTTTTCGGATTCATGAGGAAAGAGAAATCCTGGGGTTGGACCCCAAGACGACGTACAACAGGTTCTGCGGAGA
1921 CCAAGAGAAGGCGTGTGAGCAACCCACCCACTGGAAGATCACCTACTGAGGAGGATCCTCCAGGGCCGCTCCCCGGACCC
2001 GACAGGCGCGGGTGGATGCAGGTTCTGTCGCCGTGGAGTCACCGTCTACTGCCAGCCGGGAGCTGGGCGGACAGGACCGT
2081 CCCTCGCAGGGTCCCAGGCCCAGAAGAGGCCCCACGCCTCTAGAGCTGGGCTCCGTCCTCGGCGTTGCCAGCCGCCATGG
2161 CTGATGAAGAGGCTCCGCTGCTCTCGGGGGTGGCGGTTGTTTTCAGGCAGCGTCTGTGAACCCACAGCTCGGTTGCCAGC
2241 AGTGCCCGCGTGGTGACCCAGAAGCAGGAGTGTTTGTCAGGCTCCCGCTCTGGCCTTTCCAGCCACCTTTCATGTCTTCA
2321 TATTTTAAGTGCATTGAGGATAGATGCAGGCGGGTGAGCTGCCCTCCGTCAGGTGGACCCGGGCTGACATTTCCCTGGGA
2401 GCTGGTGCAAGGAGAAGCGTCATTTTAAATGTCTGCAGAGCGACCAGGGGCCTCATGAATCTCTCCGTTGCCCTCCGCGC
2481 AGCAGGAGGCTGCCTGTGTGTTTCCTCCTGGGATGCGTGCAAGGCAGACCTGGTGCTGCAAAGGAAAGGGCCTGAGGCCT
2561 CAGGGAGCCCCGTGGAGGGATGACAGTTCAGGCCCTACTGCTGGCACGTCAGAGCACTGGGAAGTTTTTCAGTGACGTCT
2641 CTGGGGCACTCAGTGGATTGTCTGTAGGAAACTTGCAGCTCTGCTCCTCACACCAGGCCCGGCTGGCCACCCACCCTCGC
2721 CCCCACTGGCCACCCCTCCCTCGCCCCGACTGCCCCGCCCCACCCTCACCCCGACTGCCCCGCCCTCGCCCGGCTGGCCG
2801 TCCCTGCCCTCGCCCCGGCTGGCAGGTGCACATGGGGCCTCCAGGTCTGCCATTCGCTATTGAGAACTAGAAATGAGGAA
2881 GGACAGTTACGCTAACTCCAAAAGGCTGTCTAGGATGAGCTGCTTTATCAGGGAGCTCCTTGTACCCATTTTACAGAAAT
2961 CATTTTTAGGTCTTTGTGCCACCACCACGAGGGGCATCTGCAAAGAGGGCAACGCTAGACACAGAATCCGTGGAAGGTGC
3041 AGCAGTGCCTCAGGGGTCCTCAGGGTCAGGGAGCCCCCCTCACCCTCTTGGCCCGTTACCCTTTGTGACTTTCCACCATG
3121 GTGTCGTGTGACCCTCAGTCAGGTTGGTGGGGGCTGAGTCCTCACTGAGCAGCCACTTTCCACATCTGCTAGAGGAACAG
3201 TGACATGGACACCTGTGACAGAGAGAGGACAGTTAGGAGGGACAGACAGCTCTTCCTTTCGGAGCCTGGCTAGTCTAGGA
3281 CATCACCTTGCTGTGTCTTCTCAAGCTTTTAAAATTGACCCTGAACGTGTGACAGGGTCCTATGGTGTTACTCAAAGCTG
3361 TGCAGGGTAAATGATGACATATTTATTCTTTTTCCATTTGTTCTAGAAACAGTGCCTTTTTCATCAGTTGCATTTTCCAG
3441 GCTGAGAGCTGTATAAAACATTTTGGACTGTGACCATGTACCTTCCTTTTTAAGAAAAATAAACTGCTTTATGGAAGTTG
3521 GTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugGGAUAUUCGUUAUAACGUGAu 5'
            ::| | | ||  :|||||:| 
Target 5' ccTTTTTCATCA--GTTGCATTt 3'
 3415 - 3435 133.00 -7.70
2 
miRNA  3' ugGGAUAUUCGUUAUAACGU-GAu 5'
            :||:||:| ||  ||||| || 
Target 5' tgTCTGTAGG-AAACTTGCAGCTc 3'
 2659 - 2681 132.00 -11.20
3 
miRNA  3' ugggAUAUUCGUUAUAACGUGAu 5'
              |||||   || ||| ||| 
Target 5' gctgTATAAAACATTTTGGACTg 3'
 3448 - 3470 131.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
727489 1816 ClinVar
COSN30120478 34 COSMIC
COSN8611809 45 COSMIC
COSN30131436 52 COSMIC
COSN31508315 103 COSMIC
COSN30164219 199 COSMIC
COSN23596813 270 COSMIC
COSN23438044 434 COSMIC
COSN23193375 450 COSMIC
COSN23192486 455 COSMIC
COSN10027385 552 COSMIC
COSN19126315 714 COSMIC
COSN30208010 1007 COSMIC
COSN22588212 1042 COSMIC
COSN30178672 1079 COSMIC
COSN20079877 1083 COSMIC
COSN30530761 1109 COSMIC
COSN30492993 1138 COSMIC
COSN31508640 1164 COSMIC
COSN31527284 1166 COSMIC
COSN26989740 1169 COSMIC
COSN31522560 1170 COSMIC
COSN31503814 1199 COSMIC
COSN26989738 1215 COSMIC
COSN22691963 1217 COSMIC
COSN28852817 1218 COSMIC
COSN26989737 1219 COSMIC
COSN23015628 1229 COSMIC
COSN30505499 1270 COSMIC
COSN31496049 1278 COSMIC
COSN30640180 1286 COSMIC
COSN30154375 1290 COSMIC
COSN30187713 1297 COSMIC
COSN19349032 1400 COSMIC
COSN31562802 1456 COSMIC
COSN28832763 1457 COSMIC
COSN30132041 1515 COSMIC
COSN1257629 1564 COSMIC
COSN30133567 1622 COSMIC
COSN30455992 1739 COSMIC
COSN26960639 1743 COSMIC
COSN30522466 1748 COSMIC
COSN30528010 1755 COSMIC
COSN30154374 1771 COSMIC
COSN28717102 1774 COSMIC
COSN31781883 1793 COSMIC
COSM8085465 1808 COSMIC
COSM9002010 1816 COSMIC
COSM1714088 1818 COSMIC
COSM3972822 1821 COSMIC
COSM8329773 1822 COSMIC
COSM8884961 1846 COSMIC
COSM1221412 1848 COSMIC
COSM8143450 1848 COSMIC
COSM8027030 1850 COSMIC
COSM1414478 1853 COSMIC
COSM9031912 1854 COSMIC
COSM9707432 1876 COSMIC
COSM1031418 1881 COSMIC
COSM7927798 1881 COSMIC
COSM6483362 1885 COSMIC
COSM2821649 1887 COSMIC
COSM3551570 1889 COSMIC
COSM5600259 1891 COSMIC
COSM9927603 1896 COSMIC
COSM3799976 1897 COSMIC
COSM2821648 1900 COSMIC
COSM3551569 1912 COSMIC
COSM7505594 1915 COSMIC
COSM4716346 1916 COSMIC
COSM9073694 1927 COSMIC
COSM6004690 1932 COSMIC
COSM6267551 1945 COSMIC
COSM9134960 1950 COSMIC
COSM4943640 1964 COSMIC
COSN30476307 1974 COSMIC
COSN30110869 1987 COSMIC
COSN16635229 1988 COSMIC
COSN30108592 1992 COSMIC
COSN26507038 1999 COSMIC
COSN30101374 2008 COSMIC
COSN30141082 2009 COSMIC
COSN18743578 2016 COSMIC
COSN30470310 2025 COSMIC
COSN18743570 2035 COSMIC
COSN30117300 2041 COSMIC
COSN31535800 2051 COSMIC
COSN30126419 2055 COSMIC
COSN30504137 2056 COSMIC
COSN31961931 2078 COSMIC
COSN30501530 2090 COSMIC
COSN31508390 2098 COSMIC
COSN31538669 2135 COSMIC
COSN23015627 2191 COSMIC
COSN32066032 2762 COSMIC
COSN15663007 2799 COSMIC
COSN1257628 2927 COSMIC
COSN17182254 2962 COSMIC
COSN8012124 3082 COSMIC
COSN20117085 3234 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1340898437 3 dbSNP
rs891245445 4 dbSNP
rs751375418 6 dbSNP
rs763832357 12 dbSNP
rs1481903077 14 dbSNP
rs758332205 18 dbSNP
rs1051169636 19 dbSNP
rs1324089329 21 dbSNP
rs921517777 22 dbSNP
rs368255659 23 dbSNP
rs765076657 24 dbSNP
rs1169560215 25 dbSNP
rs759155865 28 dbSNP
rs374350727 30 dbSNP
rs1424424972 31 dbSNP
rs930156681 37 dbSNP
rs962655446 38 dbSNP
rs766184916 45 dbSNP
rs1221069674 46 dbSNP
rs760356241 46 dbSNP
rs774888173 47 dbSNP
rs1297190852 48 dbSNP
rs370898437 51 dbSNP
rs1311164201 52 dbSNP
rs1436789765 53 dbSNP
rs1038649323 57 dbSNP
rs1444397599 61 dbSNP
rs941554680 63 dbSNP
rs1358726639 65 dbSNP
rs982846624 69 dbSNP
rs569698985 74 dbSNP
rs1403225091 78 dbSNP
rs534145428 81 dbSNP
rs566792741 88 dbSNP
rs951553145 90 dbSNP
rs908885197 92 dbSNP
rs552164323 99 dbSNP
rs1194902542 105 dbSNP
rs1013833741 106 dbSNP
rs960552971 107 dbSNP
rs1184692602 112 dbSNP
rs1241980651 113 dbSNP
rs991596365 116 dbSNP
rs1387512357 117 dbSNP
rs1460746493 122 dbSNP
rs1167573292 133 dbSNP
rs754853048 136 dbSNP
rs751128391 139 dbSNP
rs928404194 140 dbSNP
rs1382098548 149 dbSNP
rs1374596839 158 dbSNP
rs556182049 159 dbSNP
rs1324490003 170 dbSNP
rs1226343625 171 dbSNP
rs1341115861 172 dbSNP
rs375530874 172 dbSNP
rs1198353823 174 dbSNP
rs1262015189 175 dbSNP
rs1204891096 181 dbSNP
rs1245451007 182 dbSNP
rs1427118164 192 dbSNP
rs1193006551 193 dbSNP
rs1373983754 196 dbSNP
rs1474858890 197 dbSNP
rs967203570 198 dbSNP
rs765870398 199 dbSNP
rs1442614886 203 dbSNP
rs1249468316 217 dbSNP
rs1405479648 224 dbSNP
rs1009286145 227 dbSNP
rs1338635942 239 dbSNP
rs1382608981 241 dbSNP
rs892204031 243 dbSNP
rs1050906638 245 dbSNP
rs1327952918 246 dbSNP
rs1011458896 247 dbSNP
rs1282194922 249 dbSNP
rs1323645867 251 dbSNP
rs1219728867 252 dbSNP
rs145343605 256 dbSNP
rs575014964 257 dbSNP
rs1205039836 258 dbSNP
rs1262917600 261 dbSNP
rs1018190684 263 dbSNP
rs1039906453 264 dbSNP
rs1007328437 266 dbSNP
rs184105028 268 dbSNP
rs1051626681 269 dbSNP
rs994228141 270 dbSNP
rs1453024265 273 dbSNP
rs909848597 280 dbSNP
rs544326006 288 dbSNP
rs1386901591 291 dbSNP
rs191187084 294 dbSNP
rs1224954052 297 dbSNP
rs558594098 299 dbSNP
rs534210962 305 dbSNP
rs1315780253 309 dbSNP
rs150022991 310 dbSNP
rs1261775876 311 dbSNP
rs1356309235 313 dbSNP
rs941501007 316 dbSNP
rs1362725683 317 dbSNP
rs992940544 319 dbSNP
rs1179146783 322 dbSNP
rs1439215904 329 dbSNP
rs1240387183 336 dbSNP
rs554082427 338 dbSNP
rs960501216 339 dbSNP
rs1199702890 344 dbSNP
rs535376893 346 dbSNP
rs377032096 347 dbSNP
rs1230540479 352 dbSNP
rs1357058776 353 dbSNP
rs1279067016 355 dbSNP
rs1365941822 355 dbSNP
rs1406434979 363 dbSNP
rs1237096419 364 dbSNP
rs568298136 369 dbSNP
rs1055363133 370 dbSNP
rs867278277 375 dbSNP
rs928297643 376 dbSNP
rs1291566673 379 dbSNP
rs1360575001 380 dbSNP
rs866421977 381 dbSNP
rs1249781869 382 dbSNP
rs1439987349 384 dbSNP
rs1177925223 386 dbSNP
rs549981968 387 dbSNP
rs967069161 388 dbSNP
rs912978272 397 dbSNP
rs989983218 398 dbSNP
rs1009646032 399 dbSNP
rs892157388 400 dbSNP
rs1462174040 406 dbSNP
rs1156350678 409 dbSNP
rs867387929 411 dbSNP
rs139364735 412 dbSNP
rs1470939256 413 dbSNP
rs1451143476 415 dbSNP
rs570571133 423 dbSNP
rs1384013681 428 dbSNP
rs997907011 431 dbSNP
rs34750865 434 dbSNP
rs955573486 434 dbSNP
rs1307195631 439 dbSNP
rs1454063819 440 dbSNP
rs373592975 441 dbSNP
rs1260123008 443 dbSNP
rs1460007019 445 dbSNP
rs1202984544 446 dbSNP
rs1243620349 447 dbSNP
rs1029627030 448 dbSNP
rs1251524900 449 dbSNP
rs151265728 457 dbSNP
rs371055071 458 dbSNP
rs1017026902 470 dbSNP
rs1283623912 472 dbSNP
rs1403303679 489 dbSNP
rs1468785690 493 dbSNP
rs1203513100 494 dbSNP
rs548895801 495 dbSNP
rs762114190 499 dbSNP
rs1310343190 501 dbSNP
rs530306047 504 dbSNP
rs751197932 511 dbSNP
rs1361662594 520 dbSNP
rs941564322 524 dbSNP
rs1055804243 529 dbSNP
rs888692154 536 dbSNP
rs1222908997 538 dbSNP
rs113996077 540 dbSNP
rs1444120999 541 dbSNP
rs1437078112 543 dbSNP
rs906871268 543 dbSNP
rs1241343192 544 dbSNP
rs1344574665 545 dbSNP
rs917270255 545 dbSNP
rs1315604001 546 dbSNP
rs1045409397 552 dbSNP
rs536395896 554 dbSNP
rs776985707 555 dbSNP
rs1479905264 557 dbSNP
rs945714924 559 dbSNP
rs937412392 567 dbSNP
rs913008042 568 dbSNP
rs989847379 570 dbSNP
rs1316803906 571 dbSNP
rs926411489 573 dbSNP
rs535038671 578 dbSNP
rs144746148 584 dbSNP
rs967947792 585 dbSNP
rs911032431 587 dbSNP
rs985782045 600 dbSNP
rs1393604665 604 dbSNP
rs769297673 612 dbSNP
rs956548610 613 dbSNP
rs761247879 614 dbSNP
rs1242112585 616 dbSNP
rs567354635 617 dbSNP
rs972768117 625 dbSNP
rs1191102976 631 dbSNP
rs1029285261 632 dbSNP
rs567963442 633 dbSNP
rs549787198 634 dbSNP
rs1210394123 635 dbSNP
rs1017057956 636 dbSNP
rs1468114487 637 dbSNP
rs1157356654 638 dbSNP
rs549806666 639 dbSNP
rs2838862 640 dbSNP
rs1033819375 641 dbSNP
rs564232367 650 dbSNP
rs1424307031 654 dbSNP
rs868130295 657 dbSNP
rs114724649 658 dbSNP
rs1332925369 660 dbSNP
rs754309762 662 dbSNP
rs554651266 663 dbSNP
rs1374046212 667 dbSNP
rs1042603419 672 dbSNP
rs945746276 673 dbSNP
rs866089090 675 dbSNP
rs1222799614 682 dbSNP
rs764592085 686 dbSNP
rs1435575355 687 dbSNP
rs1054149705 696 dbSNP
rs1232940202 697 dbSNP
rs1432455845 705 dbSNP
rs1440899776 709 dbSNP
rs535771055 712 dbSNP
rs1383811285 719 dbSNP
rs1424365845 726 dbSNP
rs911051366 732 dbSNP
rs552370458 733 dbSNP
rs985344803 736 dbSNP
rs574798742 739 dbSNP
rs1401090121 742 dbSNP
rs1448952629 743 dbSNP
rs2838861 747 dbSNP
rs1381785147 749 dbSNP
rs1245164136 754 dbSNP
rs1285728579 756 dbSNP
rs1479108338 766 dbSNP
rs9979823 767 dbSNP
rs956655906 768 dbSNP
rs961388664 769 dbSNP
rs1016906282 777 dbSNP
rs1241771628 792 dbSNP
rs1444400907 803 dbSNP
rs549478622 808 dbSNP
rs1211099367 811 dbSNP
rs1474574143 812 dbSNP
rs1306637776 815 dbSNP
rs1192950249 817 dbSNP
rs1270661346 822 dbSNP
rs1220335946 824 dbSNP
rs73907300 825 dbSNP
rs1292101998 840 dbSNP
rs1412458573 844 dbSNP
rs533635189 845 dbSNP
rs1335987493 846 dbSNP
rs1324434437 849 dbSNP
rs1303011748 852 dbSNP
rs1278380184 858 dbSNP
rs6518221 867 dbSNP
rs970859101 869 dbSNP
rs6518220 872 dbSNP
rs1025815295 878 dbSNP
rs530065587 882 dbSNP
rs1467612937 885 dbSNP
rs1201499542 888 dbSNP
rs759877889 895 dbSNP
rs1258743691 896 dbSNP
rs994793718 897 dbSNP
rs754976586 898 dbSNP
rs896063538 900 dbSNP
rs1264090067 904 dbSNP
rs1478923555 911 dbSNP
rs1174444572 913 dbSNP
rs529609134 914 dbSNP
rs891463400 915 dbSNP
rs905894056 923 dbSNP
rs1382536036 924 dbSNP
rs569219624 930 dbSNP
rs1054090535 934 dbSNP
rs1182626861 935 dbSNP
rs915022985 936 dbSNP
rs1000259810 937 dbSNP
rs1312223897 941 dbSNP
rs550816377 949 dbSNP
rs1049924441 952 dbSNP
rs1258229870 957 dbSNP
rs922504008 958 dbSNP
rs933868365 968 dbSNP
rs922400419 970 dbSNP
rs1036954213 976 dbSNP
rs976665570 980 dbSNP
rs939886442 984 dbSNP
rs757925356 986 dbSNP
rs532613923 987 dbSNP
rs1231394093 989 dbSNP
rs1361921115 990 dbSNP
rs959619613 996 dbSNP
rs926757807 998 dbSNP
rs140693437 1000 dbSNP
rs970887395 1001 dbSNP
rs952503673 1002 dbSNP
rs1025850195 1003 dbSNP
rs1021038910 1005 dbSNP
rs865985759 1007 dbSNP
rs1009779913 1008 dbSNP
rs958314765 1009 dbSNP
rs1387937792 1012 dbSNP
rs972924344 1013 dbSNP
rs1334574467 1015 dbSNP
rs960219675 1016 dbSNP
rs1035932469 1023 dbSNP
rs1356247006 1025 dbSNP
rs1220564028 1029 dbSNP
rs1265024524 1031 dbSNP
rs1033002523 1032 dbSNP
rs905842158 1038 dbSNP
rs999888136 1041 dbSNP
rs188044022 1046 dbSNP
rs1012022839 1047 dbSNP
rs770646230 1048 dbSNP
rs1053634857 1049 dbSNP
rs528557944 1050 dbSNP
rs111570998 1051 dbSNP
rs1350178344 1052 dbSNP
rs1459111183 1053 dbSNP
rs1036900297 1064 dbSNP
rs939833996 1071 dbSNP
rs1395107255 1073 dbSNP
rs1446734728 1076 dbSNP
rs1310567870 1080 dbSNP
rs559406601 1083 dbSNP
rs1180264818 1084 dbSNP
rs1312446371 1085 dbSNP
rs561407909 1096 dbSNP
rs763417204 1098 dbSNP
rs749045020 1099 dbSNP
rs543051726 1104 dbSNP
rs1249728965 1106 dbSNP
rs1440014517 1111 dbSNP
rs749909204 1112 dbSNP
rs183836567 1114 dbSNP
rs909825998 1115 dbSNP
rs764800271 1118 dbSNP
rs773056639 1118 dbSNP
rs556542598 1119 dbSNP
rs1207951424 1121 dbSNP
rs1425232258 1126 dbSNP
rs373433173 1130 dbSNP
rs931013979 1133 dbSNP
rs918326093 1138 dbSNP
rs1332635495 1140 dbSNP
rs1403164690 1151 dbSNP
rs938040986 1152 dbSNP
rs926595908 1159 dbSNP
rs116817686 1161 dbSNP
rs1265495949 1163 dbSNP
rs1380306751 1165 dbSNP
rs970751269 1167 dbSNP
rs913978306 1168 dbSNP
rs577143214 1170 dbSNP
rs1035881638 1171 dbSNP
rs778678910 1174 dbSNP
rs369215335 1176 dbSNP
rs1219404984 1177 dbSNP
rs776130409 1177 dbSNP
rs1280330665 1181 dbSNP
rs376456175 1185 dbSNP
rs770168067 1188 dbSNP
rs1366614657 1189 dbSNP
rs746006949 1190 dbSNP
rs781081001 1191 dbSNP
rs1237875728 1193 dbSNP
rs771170960 1196 dbSNP
rs1184417127 1198 dbSNP
rs747164084 1198 dbSNP
rs1330023513 1200 dbSNP
rs777562203 1201 dbSNP
rs1402110060 1202 dbSNP
rs1173778633 1204 dbSNP
rs758250604 1206 dbSNP
rs752434085 1210 dbSNP
rs1424845473 1212 dbSNP
rs778952132 1215 dbSNP
rs533959235 1219 dbSNP
rs1236867361 1220 dbSNP
rs147254759 1224 dbSNP
rs754870370 1228 dbSNP
rs891818730 1233 dbSNP
rs756875200 1234 dbSNP
rs1208222550 1235 dbSNP
rs377065031 1236 dbSNP
rs765947807 1237 dbSNP
rs1287481187 1239 dbSNP
rs760409220 1243 dbSNP
rs1371170859 1245 dbSNP
rs750158162 1249 dbSNP
rs767274001 1251 dbSNP
rs763414491 1253 dbSNP
rs372766016 1260 dbSNP
rs554609794 1261 dbSNP
rs1358957606 1262 dbSNP
rs759917320 1263 dbSNP
rs770936034 1264 dbSNP
rs747082635 1268 dbSNP
rs764546497 1269 dbSNP
rs369518397 1270 dbSNP
rs376967713 1277 dbSNP
rs374166306 1278 dbSNP
rs369710371 1279 dbSNP
rs1196545130 1280 dbSNP
rs143722016 1286 dbSNP
rs1268038453 1287 dbSNP
rs1185870054 1289 dbSNP
rs1157284865 1300 dbSNP
rs1048815777 1309 dbSNP
rs1420576446 1310 dbSNP
rs1300224631 1313 dbSNP
rs1225015928 1321 dbSNP
rs1486981510 1328 dbSNP
rs930983654 1332 dbSNP
rs1343732427 1334 dbSNP
rs1287576804 1341 dbSNP
rs1435762724 1344 dbSNP
rs568510342 1345 dbSNP
rs550906346 1349 dbSNP
rs1221983006 1354 dbSNP
rs1216821919 1357 dbSNP
rs532654103 1365 dbSNP
rs1255737661 1369 dbSNP
rs1218364558 1372 dbSNP
rs905199221 1373 dbSNP
rs1231614312 1377 dbSNP
rs1333322150 1381 dbSNP
rs1221738494 1388 dbSNP
rs953434798 1400 dbSNP
rs571841453 1402 dbSNP
rs972487721 1404 dbSNP
rs1177274367 1407 dbSNP
rs949382670 1408 dbSNP
rs1440637651 1410 dbSNP
rs1338472286 1412 dbSNP
rs914011205 1417 dbSNP
rs980261389 1421 dbSNP
rs970235656 1423 dbSNP
rs748058080 1425 dbSNP
rs780724423 1426 dbSNP
rs1351657298 1431 dbSNP
rs1444510743 1432 dbSNP
rs988171922 1434 dbSNP
rs1377371860 1442 dbSNP
rs113143657 1447 dbSNP
rs2256000 1457 dbSNP
rs1170577157 1458 dbSNP
rs990819682 1463 dbSNP
rs956041977 1465 dbSNP
rs1197320049 1468 dbSNP
rs1435520125 1468 dbSNP
rs925419611 1475 dbSNP
rs1032092243 1478 dbSNP
rs112847906 1479 dbSNP
rs1180958903 1481 dbSNP
rs1377992760 1482 dbSNP
rs561226731 1488 dbSNP
rs543139095 1491 dbSNP
rs1017683943 1492 dbSNP
rs1164009278 1509 dbSNP
rs1416077857 1510 dbSNP
rs1264678396 1515 dbSNP
rs976439306 1516 dbSNP
rs889647545 1526 dbSNP
rs1354986178 1533 dbSNP
rs1485137867 1534 dbSNP
rs1448875669 1536 dbSNP
rs530966153 1537 dbSNP
rs563657908 1543 dbSNP
rs771118435 1544 dbSNP
rs1285533710 1545 dbSNP
rs1315534532 1549 dbSNP
rs896781618 1551 dbSNP
rs1003942784 1557 dbSNP
rs544546350 1558 dbSNP
rs1201038807 1562 dbSNP
rs1027198528 1563 dbSNP
rs577084548 1574 dbSNP
rs1239502103 1577 dbSNP
rs1218513688 1579 dbSNP
rs1424385811 1583 dbSNP
rs1467152812 1585 dbSNP
rs558780144 1589 dbSNP
rs1044203906 1613 dbSNP
rs1414760254 1614 dbSNP
rs905146311 1615 dbSNP
rs1338039643 1617 dbSNP
rs1398978595 1619 dbSNP
rs1046279185 1620 dbSNP
rs949415491 1622 dbSNP
rs892438037 1623 dbSNP
rs540064599 1628 dbSNP
rs193215157 1629 dbSNP
rs936711750 1642 dbSNP
rs534088791 1643 dbSNP
rs1487454016 1644 dbSNP
rs535932829 1649 dbSNP
rs932152184 1650 dbSNP
rs1297440353 1661 dbSNP
rs752004684 1663 dbSNP
rs976305179 1664 dbSNP
rs1007604799 1667 dbSNP
rs1463970806 1668 dbSNP
rs115382616 1673 dbSNP
rs1298376047 1676 dbSNP
rs746756233 1677 dbSNP
rs188799030 1680 dbSNP
rs573107162 1682 dbSNP
rs764718284 1683 dbSNP
rs952603806 1688 dbSNP
rs1442665149 1689 dbSNP
rs1306129316 1690 dbSNP
rs571864666 1693 dbSNP
rs1002467807 1694 dbSNP
rs34183280 1694 dbSNP
rs373542427 1700 dbSNP
rs1456823680 1707 dbSNP
rs1024861510 1724 dbSNP
rs1044129629 1737 dbSNP
rs1013431991 1738 dbSNP
rs1200856787 1745 dbSNP
rs892468950 1754 dbSNP
rs1052420694 1757 dbSNP
rs534951129 1765 dbSNP
rs779724689 1767 dbSNP
rs375980197 1768 dbSNP
rs1461744422 1770 dbSNP
rs1327625690 1771 dbSNP
rs749921173 1773 dbSNP
rs1006887 1774 dbSNP
rs779861972 1774 dbSNP
rs756013901 1775 dbSNP
rs1355273556 1776 dbSNP
rs201457475 1776 dbSNP
rs1312203888 1777 dbSNP
rs1394929183 1780 dbSNP
rs201490263 1780 dbSNP
rs750320338 1782 dbSNP
rs764134560 1786 dbSNP
rs1450690976 1787 dbSNP
rs1358968965 1789 dbSNP
rs1158605831 1791 dbSNP
rs1420772974 1792 dbSNP
rs1274039124 1793 dbSNP
rs1382260842 1798 dbSNP
rs375160164 1806 dbSNP
rs536535871 1806 dbSNP
rs1162841238 1807 dbSNP
rs1423315160 1809 dbSNP
rs756809004 1810 dbSNP
rs924863175 1815 dbSNP
rs112907087 1816 dbSNP
rs765450097 1817 dbSNP
rs752954380 1823 dbSNP
rs760098333 1825 dbSNP
rs777184465 1831 dbSNP
rs766870946 1832 dbSNP
rs932156597 1835 dbSNP
rs377229910 1846 dbSNP
rs868752404 1848 dbSNP
rs1215501669 1850 dbSNP
rs1321768975 1853 dbSNP
rs773256059 1854 dbSNP
rs772363641 1855 dbSNP
rs146674072 1859 dbSNP
rs1457258399 1861 dbSNP
rs774201346 1868 dbSNP
rs1179075750 1872 dbSNP
rs1400978975 1873 dbSNP
rs142106415 1877 dbSNP
rs749090325 1879 dbSNP
rs756732634 1880 dbSNP
rs1457515486 1881 dbSNP
rs1369085335 1883 dbSNP
rs908114725 1893 dbSNP
rs149288381 1896 dbSNP
rs756097099 1897 dbSNP
rs1194171663 1898 dbSNP
rs144948414 1899 dbSNP
rs149920239 1900 dbSNP
rs1209108960 1903 dbSNP
rs1488525033 1904 dbSNP
rs1266655545 1905 dbSNP
rs919696458 1906 dbSNP
rs980517133 1915 dbSNP
rs756936451 1916 dbSNP
rs1306879352 1917 dbSNP
rs765419850 1919 dbSNP
rs751110915 1924 dbSNP
rs763784657 1926 dbSNP
rs1299834193 1927 dbSNP
rs755369384 1931 dbSNP
rs754173879 1932 dbSNP
rs766924072 1933 dbSNP
rs761123971 1940 dbSNP
rs1372088439 1941 dbSNP
rs115550681 1942 dbSNP
rs767430817 1945 dbSNP
rs956661387 1947 dbSNP
rs762108988 1948 dbSNP
rs1411326081 1950 dbSNP
rs1375657276 1952 dbSNP
rs147423047 1957 dbSNP
rs768890239 1962 dbSNP
rs1001302516 1963 dbSNP
rs1176284134 1965 dbSNP
rs1199152031 1970 dbSNP
rs1183328356 1971 dbSNP
rs533319429 1974 dbSNP
rs1482121141 1977 dbSNP
rs1475511770 1981 dbSNP
rs775374899 1983 dbSNP
rs565037703 1987 dbSNP
rs745730019 1988 dbSNP
rs780764583 1989 dbSNP
rs1233182201 1990 dbSNP
rs756770316 1991 dbSNP
rs540518453 1994 dbSNP
rs199690917 1995 dbSNP
rs758049666 1999 dbSNP
rs368685176 2000 dbSNP
rs372886985 2001 dbSNP
rs367592691 2003 dbSNP
rs768056133 2005 dbSNP
rs374936952 2007 dbSNP
rs751636139 2008 dbSNP
rs370486874 2009 dbSNP
rs58387020 2010 dbSNP
rs778469737 2012 dbSNP
rs374968449 2014 dbSNP
rs769652085 2018 dbSNP
rs1276423358 2021 dbSNP
rs1339873068 2022 dbSNP
rs1156410570 2026 dbSNP
rs372678621 2029 dbSNP
rs1382529617 2030 dbSNP
rs944976424 2032 dbSNP
rs908147244 2033 dbSNP
rs910521928 2035 dbSNP
rs1191001777 2036 dbSNP
rs374080840 2043 dbSNP
rs930702952 2044 dbSNP
rs1187617901 2048 dbSNP
rs930986172 2052 dbSNP
rs919578024 2057 dbSNP
rs1431930994 2060 dbSNP
rs980932770 2063 dbSNP
rs527441350 2065 dbSNP
rs556606393 2068 dbSNP
rs961162399 2069 dbSNP
rs115440615 2070 dbSNP
rs991977493 2075 dbSNP
rs1271990413 2079 dbSNP
rs577561643 2085 dbSNP
rs756925203 2086 dbSNP
rs1301752454 2091 dbSNP
rs1349721430 2092 dbSNP
rs553428556 2094 dbSNP
rs1214016865 2104 dbSNP
rs1284781359 2105 dbSNP
rs1488409853 2112 dbSNP
rs75274352 2115 dbSNP
rs567886168 2116 dbSNP
rs1012994828 2120 dbSNP
rs1244452142 2129 dbSNP
rs182942870 2134 dbSNP
rs549487953 2135 dbSNP
rs1396085089 2138 dbSNP
rs1342774433 2140 dbSNP
rs114378659 2141 dbSNP
rs1379984908 2142 dbSNP
rs1437140784 2143 dbSNP
rs1320418719 2147 dbSNP
rs1339210080 2148 dbSNP
rs1348156690 2153 dbSNP
rs901965010 2153 dbSNP
rs753506266 2154 dbSNP
rs570171977 2157 dbSNP
rs1237771440 2160 dbSNP
rs1005081310 2169 dbSNP
rs113598166 2176 dbSNP
rs1360844068 2177 dbSNP
rs1287159875 2182 dbSNP
rs1160269218 2186 dbSNP
rs1221484165 2188 dbSNP
rs1414205364 2190 dbSNP
rs11558445 2191 dbSNP
rs1470212005 2192 dbSNP
rs1174790065 2194 dbSNP
rs930871167 2195 dbSNP
rs898163152 2196 dbSNP
rs930607521 2198 dbSNP
rs1160461127 2204 dbSNP
rs1411730939 2210 dbSNP
rs138600335 2211 dbSNP
rs760077798 2212 dbSNP
rs527436195 2216 dbSNP
rs991843258 2221 dbSNP
rs144651498 2229 dbSNP
rs1330474273 2230 dbSNP
rs560823152 2231 dbSNP
rs542432355 2233 dbSNP
rs575056463 2241 dbSNP
rs766453067 2247 dbSNP
rs1219712254 2248 dbSNP
rs763134400 2249 dbSNP
rs560386323 2250 dbSNP
rs1257841736 2258 dbSNP
rs957221429 2260 dbSNP
rs9985124 2264 dbSNP
rs1340611424 2272 dbSNP
rs1472583791 2276 dbSNP
rs1188806788 2281 dbSNP
rs1019051608 2286 dbSNP
rs182781685 2287 dbSNP
rs1018670782 2289 dbSNP
rs1357736794 2290 dbSNP
rs1336614295 2293 dbSNP
rs1331937127 2295 dbSNP
rs1339560161 2298 dbSNP
rs1414989605 2302 dbSNP
rs886608511 2312 dbSNP
rs1337711165 2314 dbSNP
rs375832408 2317 dbSNP
rs1217348197 2322 dbSNP
rs1423632136 2325 dbSNP
rs1168611391 2328 dbSNP
rs889292537 2329 dbSNP
rs1197984445 2334 dbSNP
rs1276916705 2339 dbSNP
rs1442100967 2345 dbSNP
rs1211815692 2348 dbSNP
rs1051078849 2350 dbSNP
rs995406208 2351 dbSNP
rs79644401 2352 dbSNP
rs746811209 2356 dbSNP
rs534294882 2367 dbSNP
rs575990719 2368 dbSNP
rs1170639366 2373 dbSNP
rs896133283 2381 dbSNP
rs1056146754 2389 dbSNP
rs1314262772 2395 dbSNP
rs1358075412 2401 dbSNP
rs1398920799 2415 dbSNP
rs935049974 2416 dbSNP
rs1238953571 2417 dbSNP
rs1036352939 2418 dbSNP
rs775205543 2419 dbSNP
rs1347548683 2430 dbSNP
rs928031729 2432 dbSNP
rs923681103 2441 dbSNP
rs574401617 2442 dbSNP
rs1200459090 2446 dbSNP
rs1262482908 2449 dbSNP
rs946522127 2452 dbSNP
rs771960407 2459 dbSNP
rs2838860 2462 dbSNP
rs991790679 2465 dbSNP
rs1311418098 2466 dbSNP
rs190774445 2467 dbSNP
rs957322193 2469 dbSNP
rs966050780 2476 dbSNP
rs1380943102 2477 dbSNP
rs370288697 2478 dbSNP
rs1453912745 2479 dbSNP
rs925888257 2481 dbSNP
rs1370904679 2482 dbSNP
rs756764987 2483 dbSNP
rs570260289 2484 dbSNP
rs950864360 2486 dbSNP
rs1028150885 2488 dbSNP
rs1355161838 2492 dbSNP
rs1261414867 2502 dbSNP
rs1352861969 2505 dbSNP
rs1207989229 2509 dbSNP
rs558010507 2510 dbSNP
rs995045472 2513 dbSNP
rs1008605535 2515 dbSNP
rs79725384 2516 dbSNP
rs1029176321 2517 dbSNP
rs995443981 2519 dbSNP
rs899397170 2520 dbSNP
rs1015631785 2530 dbSNP
rs78326210 2533 dbSNP
rs547793694 2537 dbSNP
rs1438778729 2540 dbSNP
rs1004878443 2542 dbSNP
rs1236167267 2544 dbSNP
rs906541030 2551 dbSNP
rs1328384961 2552 dbSNP
rs1480947477 2554 dbSNP
rs755772639 2561 dbSNP
rs948135726 2566 dbSNP
rs894268855 2570 dbSNP
rs1242770040 2571 dbSNP
rs1272598973 2572 dbSNP
rs1323133457 2572 dbSNP
rs529240392 2575 dbSNP
rs1055617647 2577 dbSNP
rs1014421394 2586 dbSNP
rs1255944107 2589 dbSNP
rs935854476 2590 dbSNP
rs3179812 2596 dbSNP
rs567234587 2607 dbSNP
rs548860088 2608 dbSNP
rs530656679 2611 dbSNP
rs1307588051 2612 dbSNP
rs563123701 2619 dbSNP
rs1056093490 2621 dbSNP
rs185918065 2631 dbSNP
rs1186280124 2636 dbSNP
rs1417904187 2639 dbSNP
rs1462451855 2648 dbSNP
rs1167663291 2649 dbSNP
rs146639561 2654 dbSNP
rs977317976 2655 dbSNP
rs1299084662 2667 dbSNP
rs945678803 2673 dbSNP
rs999597451 2685 dbSNP
rs1374777294 2688 dbSNP
rs1293000438 2691 dbSNP
rs1356115789 2692 dbSNP
rs1235074690 2693 dbSNP
rs1232392361 2698 dbSNP
rs987154649 2700 dbSNP
rs180866169 2701 dbSNP
rs1164406696 2708 dbSNP
rs895513218 2713 dbSNP
rs973594010 2717 dbSNP
rs1209650147 2718 dbSNP
rs1257622639 2719 dbSNP
rs776540213 2721 dbSNP
rs1475865765 2724 dbSNP
rs1055483069 2725 dbSNP
rs1418057216 2730 dbSNP
rs937586224 2732 dbSNP
rs1378225556 2733 dbSNP
rs868060626 2736 dbSNP
rs995179684 2736 dbSNP
rs910130452 2737 dbSNP
rs1160279395 2738 dbSNP
rs1048522760 2741 dbSNP
rs1296396984 2741 dbSNP
rs1015149632 2742 dbSNP
rs1005140131 2743 dbSNP
rs1310156504 2744 dbSNP
rs1233110061 2746 dbSNP
rs1280678593 2747 dbSNP
rs1213892121 2748 dbSNP
rs894165674 2748 dbSNP
rs559149460 2756 dbSNP
rs137877170 2757 dbSNP
rs1173401943 2762 dbSNP
rs1422114367 2762 dbSNP
rs1395971829 2767 dbSNP
rs1344631694 2768 dbSNP
rs1436783128 2768 dbSNP
rs774488429 2772 dbSNP
rs921735515 2781 dbSNP
rs1054316957 2782 dbSNP
rs565644510 2786 dbSNP
rs145290466 2787 dbSNP
rs944571198 2788 dbSNP
rs945982485 2791 dbSNP
rs911839988 2792 dbSNP
rs911804548 2793 dbSNP
rs1242838044 2796 dbSNP
rs768165293 2797 dbSNP
rs1467510073 2799 dbSNP
rs931680602 2800 dbSNP
rs1253975872 2809 dbSNP
rs1301106015 2810 dbSNP
rs950764339 2811 dbSNP
rs973568287 2812 dbSNP
rs1034067877 2816 dbSNP
rs556143287 2816 dbSNP
rs1369756712 2817 dbSNP
rs1460832881 2817 dbSNP
rs548637218 2824 dbSNP
rs1372852571 2828 dbSNP
rs973872930 2831 dbSNP
rs1278523814 2832 dbSNP
rs1373602329 2834 dbSNP
rs970254846 2838 dbSNP
rs140235453 2843 dbSNP
rs1213561016 2845 dbSNP
rs2838859 2849 dbSNP
rs1470050824 2852 dbSNP
rs1180098962 2855 dbSNP
rs1232578874 2856 dbSNP
rs1001378255 2857 dbSNP
rs1415721479 2859 dbSNP
rs960321504 2859 dbSNP
rs1474854732 2860 dbSNP
rs1165491650 2864 dbSNP
rs1396421009 2867 dbSNP
rs904338358 2877 dbSNP
rs1031868202 2882 dbSNP
rs1041521276 2890 dbSNP
rs1290925745 2890 dbSNP
rs781618265 2891 dbSNP
rs1010048978 2898 dbSNP
rs1294507340 2901 dbSNP
rs558309024 2903 dbSNP
rs1194484356 2907 dbSNP
rs1272708421 2908 dbSNP
rs12627534 2910 dbSNP
rs1434865932 2912 dbSNP
rs902145642 2932 dbSNP
rs1429335129 2934 dbSNP
rs890371332 2936 dbSNP
rs1192382829 2942 dbSNP
rs1188742615 2943 dbSNP
rs1474373346 2949 dbSNP
rs151105051 2956 dbSNP
rs3746978 2961 dbSNP
rs1419904327 2971 dbSNP
rs1011031698 2977 dbSNP
rs1264806972 2980 dbSNP
rs190519571 2983 dbSNP
rs1486374321 2986 dbSNP
rs931633031 2987 dbSNP
rs535461640 2988 dbSNP
rs150095145 2989 dbSNP
rs368585424 2989 dbSNP
rs1231680664 3002 dbSNP
rs1225830338 3010 dbSNP
rs944520455 3012 dbSNP
rs568102235 3013 dbSNP
rs548899063 3014 dbSNP
rs941787458 3024 dbSNP
rs752085063 3026 dbSNP
rs929341401 3029 dbSNP
rs1338523366 3030 dbSNP
rs1300207913 3031 dbSNP
rs1062955 3032 dbSNP
rs920553598 3035 dbSNP
rs1242490457 3037 dbSNP
rs766748671 3043 dbSNP
rs1300902357 3051 dbSNP
rs1467514513 3054 dbSNP
rs948853101 3055 dbSNP
rs915994567 3056 dbSNP
rs959380003 3059 dbSNP
rs1169884060 3063 dbSNP
rs868810086 3064 dbSNP
rs1381038836 3069 dbSNP
rs992982230 3071 dbSNP
rs1327527836 3076 dbSNP
rs879685284 3078 dbSNP
rs1031895875 3079 dbSNP
rs1301675987 3080 dbSNP
rs186327319 3084 dbSNP
rs966403785 3085 dbSNP
rs1193404798 3092 dbSNP
rs181475993 3094 dbSNP
rs115951229 3095 dbSNP
rs564993259 3109 dbSNP
rs1017347747 3110 dbSNP
rs1008748845 3113 dbSNP
rs1463044598 3116 dbSNP
rs1448635998 3118 dbSNP
rs890295723 3119 dbSNP
rs890270458 3121 dbSNP
rs1252100535 3123 dbSNP
rs1198584139 3125 dbSNP
rs559401637 3126 dbSNP
rs929181732 3130 dbSNP
rs1158629417 3131 dbSNP
rs1452514231 3131 dbSNP
rs1386376674 3132 dbSNP
rs1459257593 3133 dbSNP
rs1228381620 3134 dbSNP
rs900136487 3137 dbSNP
rs1340161743 3143 dbSNP
rs1037760086 3153 dbSNP
rs1334187910 3154 dbSNP
rs1238480603 3156 dbSNP
rs941698743 3157 dbSNP
rs1211692819 3160 dbSNP
rs899076067 3161 dbSNP
rs1272337518 3167 dbSNP
rs907621274 3167 dbSNP
rs540764368 3169 dbSNP
rs80011702 3173 dbSNP
rs1418130128 3176 dbSNP
rs1181955389 3177 dbSNP
rs1364989105 3187 dbSNP
rs1473865101 3195 dbSNP
rs1406564833 3198 dbSNP
rs1394384900 3201 dbSNP
rs745485268 3205 dbSNP
rs1462346732 3210 dbSNP
rs775328362 3217 dbSNP
rs561652794 3219 dbSNP
rs1464029023 3220 dbSNP
rs916027228 3221 dbSNP
rs375339993 3223 dbSNP
rs1352355827 3228 dbSNP
rs1401805130 3228 dbSNP
rs992841492 3230 dbSNP
rs73907296 3234 dbSNP
rs141862953 3236 dbSNP
rs140397390 3237 dbSNP
rs16663 3237 dbSNP
rs138271539 3238 dbSNP
rs991061047 3239 dbSNP
rs1168040608 3240 dbSNP
rs796268852 3240 dbSNP
rs200368913 3241 dbSNP
rs938869004 3241 dbSNP
rs959877843 3241 dbSNP
rs979840443 3242 dbSNP
rs1253348790 3243 dbSNP
rs544155896 3245 dbSNP
rs1186587883 3250 dbSNP
rs1417832022 3250 dbSNP
rs576832750 3260 dbSNP
rs1446760851 3266 dbSNP
rs1371646434 3275 dbSNP
rs573044150 3277 dbSNP
rs1298899142 3282 dbSNP
rs1372641478 3287 dbSNP
rs969409131 3293 dbSNP
rs986849924 3295 dbSNP
rs1030593176 3297 dbSNP
rs1178521207 3305 dbSNP
rs996052104 3306 dbSNP
rs1227881156 3311 dbSNP
rs1276404317 3320 dbSNP
rs1345264595 3322 dbSNP
rs1021874919 3323 dbSNP
rs1209576827 3326 dbSNP
rs1257554009 3327 dbSNP
rs1483875163 3329 dbSNP
rs1184043586 3336 dbSNP
rs989574389 3337 dbSNP
rs964361382 3342 dbSNP
rs1017383630 3350 dbSNP
rs558136595 3358 dbSNP
rs1196530444 3360 dbSNP
rs1016219068 3382 dbSNP
rs1005880289 3386 dbSNP
rs546389652 3388 dbSNP
rs1047473023 3403 dbSNP
rs1450146016 3412 dbSNP
rs1287110768 3416 dbSNP
rs1361166994 3431 dbSNP
rs1008612867 3432 dbSNP
rs1248475583 3433 dbSNP
rs1299505540 3440 dbSNP
rs1368368078 3441 dbSNP
rs896268253 3442 dbSNP
rs1308314617 3449 dbSNP
rs954536732 3456 dbSNP
rs1055686123 3458 dbSNP
rs183972694 3468 dbSNP
rs572503214 3472 dbSNP
rs1026601140 3477 dbSNP
rs938232985 3478 dbSNP
rs925519482 3480 dbSNP
rs1485816897 3490 dbSNP
rs1189657875 3492 dbSNP
rs1250245464 3494 dbSNP
rs1452834255 3495 dbSNP
rs1444450212 3496 dbSNP
rs753313961 3500 dbSNP
rs1193180876 3504 dbSNP
rs979662702 3512 dbSNP
rs2255774 3515 dbSNP
rs181561087 3517 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.328 1.2e-3 -0.227 2.0e-2 83 Click to see details
GSE21687 Ependynoma primary tumors 0.359 1.8e-3 0.300 8.0e-3 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.487 1.5e-2 -0.666 6.7e-4 20 Click to see details
GSE28544 Breast cancer 0.392 2.9e-2 0.518 4.8e-3 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.637 3.3e-2 0.350 1.8e-1 9 Click to see details
GSE28260 Renal cortex and medulla 0.452 6.0e-2 0.319 1.4e-1 13 Click to see details
GSE17498 Multiple myeloma -0.235 7.2e-2 -0.244 6.5e-2 40 Click to see details
GSE19783 ER+ ER+ breast cancer -0.304 9.6e-2 -0.319 8.5e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.273 9.8e-2 -0.181 2.0e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.267 1.1e-1 0.180 2.1e-1 23 Click to see details
GSE27834 Pluripotent stem cells 0.299 1.3e-1 0.488 2.8e-2 16 Click to see details
GSE19783 ER- ER- breast cancer 0.125 1.4e-1 -0.072 2.6e-1 79 Click to see details
GSE14794 Lymphoblastoid cells 0.104 1.6e-1 0.154 7.4e-2 90 Click to see details
GSE19350 CNS germ cell tumors -0.275 1.9e-1 -0.301 1.7e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.15 2.4e-1 0.058 3.9e-1 25 Click to see details
GSE19536 Breast cancer 0.07 2.4e-1 -0.107 1.4e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.104 3.1e-1 0.078 3.6e-1 25 Click to see details
GSE17306 Multiple myeloma -0.053 3.6e-1 -0.067 3.2e-1 49 Click to see details
GSE38226 Liver fibrosis 0.069 3.8e-1 -0.140 2.7e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.022 4.5e-1 -0.098 3.0e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.022 4.5e-1 -0.098 3.0e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.274 0.01 -0.290 0 83 Click to see details
KIRC 0.261 0.02 0.270 0.01 68 Click to see details
LIHC 0.292 0.02 0.321 0.01 49 Click to see details
LUAD 0.571 0.03 0.636 0.01 12 Click to see details
PCPG 0.955 0.1 0.500 0.33 3 Click to see details
STAD -0.22 0.11 -0.242 0.09 32 Click to see details
KICH -0.241 0.12 -0.208 0.16 25 Click to see details
THCA 0.126 0.17 0.150 0.13 59 Click to see details
PRAD 0.132 0.18 0.166 0.12 50 Click to see details
CESC -0.656 0.27 -0.500 0.33 3 Click to see details
LUSC -0.093 0.29 -0.099 0.28 38 Click to see details
BLCA -0.145 0.29 -0.203 0.22 17 Click to see details
HNSC 0.058 0.36 0.085 0.3 42 Click to see details
ESCA 0.121 0.36 0.064 0.43 11 Click to see details
PAAD 0.243 0.38 0.400 0.3 4 Click to see details
UCEC -0.075 0.38 -0.186 0.22 19 Click to see details
CHOL -0.111 0.39 -0.050 0.45 9 Click to see details
KIRP -0.029 0.44 0.047 0.4 32 Click to see details
KIRP -0.029 0.44 0.047 0.4 32 Click to see details
373 hsa-miR-454-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007251 SMAD4 SMAD family member 4 5 8
MIRT039219 KCTD12 potassium channel tetramerization domain containing 12 1 1
MIRT039220 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT039221 ZBTB4 zinc finger and BTB domain containing 4 2 7
MIRT039222 SPTSSA serine palmitoyltransferase small subunit A 1 1
MIRT039223 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT039224 METTL2A methyltransferase like 2A 1 1
MIRT039225 C6orf120 chromosome 6 open reading frame 120 1 1
MIRT039226 CSPP1 centrosome and spindle pole associated protein 1 1 1
MIRT039227 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT039228 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT039229 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT039230 RPL4 ribosomal protein L4 1 1
MIRT039231 POLR2A RNA polymerase II subunit A 1 1
MIRT039232 MRPL37 mitochondrial ribosomal protein L37 1 1
MIRT039233 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT039234 SIK3 SIK family kinase 3 1 1
MIRT039235 ZNF805 zinc finger protein 805 1 1
MIRT039236 TET1 tet methylcytosine dioxygenase 1 1 1
MIRT039237 HMGXB3 HMG-box containing 3 1 1
MIRT039238 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT039239 PCSK6 proprotein convertase subtilisin/kexin type 6 1 1
MIRT039240 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT039241 MED12 mediator complex subunit 12 1 1
MIRT039242 FLNC filamin C 1 1
MIRT039243 STK38 serine/threonine kinase 38 1 1
MIRT039244 MRPS35 mitochondrial ribosomal protein S35 1 1
MIRT039245 TP53 tumor protein p53 1 1
MIRT039246 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT039247 PPP1R7 protein phosphatase 1 regulatory subunit 7 1 1
MIRT039248 GID4 GID complex subunit 4 homolog 1 1
MIRT039249 PHF12 PHD finger protein 12 2 3
MIRT039250 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 1 1
MIRT057500 CEP55 centrosomal protein 55 2 4
MIRT060511 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT061519 OTUD3 OTU deubiquitinase 3 2 2
MIRT061804 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT062715 MLEC malectin 2 4
MIRT063602 FBXO28 F-box protein 28 2 2
MIRT064810 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT065626 CLIC4 chloride intracellular channel 4 2 4
MIRT065898 RAB5B RAB5B, member RAS oncogene family 2 8
MIRT071011 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT071920 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT075119 C16ORF70 chromosome 16 open reading frame 70 2 4
MIRT076031 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 6
MIRT079272 NPTX1 neuronal pentraxin 1 2 2
MIRT079362 CCDC137 coiled-coil domain containing 137 2 2
MIRT081131 LDLR low density lipoprotein receptor 2 6
MIRT083130 BTBD3 BTB domain containing 3 2 12
MIRT083156 SEC23B Sec23 homolog B, coat complex II component 2 4
MIRT086442 NABP1 nucleic acid binding protein 1 2 6
MIRT087868 CBY1 chibby family member 1, beta catenin antagonist 2 4
MIRT088348 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT090809 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT090904 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT091219 USP13 ubiquitin specific peptidase 13 2 2
MIRT091700 TGFBR2 transforming growth factor beta receptor 2 2 6
MIRT092494 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT095388 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096901 ERBB2IP erbb2 interacting protein 2 2
MIRT097422 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT097465 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT099324 QKI QKI, KH domain containing RNA binding 2 4
MIRT099841 SOX4 SRY-box 4 2 10
MIRT100782 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT101821 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT102154 POP7 POP7 homolog, ribonuclease P/MRP subunit 2 4
MIRT102235 HBP1 HMG-box transcription factor 1 2 2
MIRT102624 UBN2 ubinuclein 2 2 8
MIRT105313 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT105436 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT105807 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT107283 FAM73B mitoguardin 2 2 2
MIRT108268 HABP4 hyaluronan binding protein 4 2 4
MIRT108885 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT109677 KLHL15 kelch like family member 15 2 6
MIRT109831 MID1IP1 MID1 interacting protein 1 2 8
MIRT123867 FZD6 frizzled class receptor 6 2 8
MIRT126574 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT130148 TXNIP thioredoxin interacting protein 2 6
MIRT132502 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT134787 CCND2 cyclin D2 2 2
MIRT139885 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT142443 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT154001 PRNP prion protein 2 2
MIRT162279 LMLN leishmanolysin like peptidase 2 4
MIRT164540 MSMO1 methylsterol monooxygenase 1 2 2
MIRT178076 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT178935 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT179073 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT180851 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 4
MIRT182976 TROVE2 TROVE domain family member 2 2 2
MIRT193030 TMOD3 tropomodulin 3 2 8
MIRT195765 ATMIN ATM interactor 2 6
MIRT196627 TAOK1 TAO kinase 1 2 6
MIRT212153 CLCN3 chloride voltage-gated channel 3 2 4
MIRT217615 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT220701 MTPN myotrophin 2 4
MIRT222278 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT223641 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 4
MIRT224762 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT227998 NFIB nuclear factor I B 2 4
MIRT230983 PRRG4 proline rich and Gla domain 4 2 2
MIRT242671 SALL3 spalt like transcription factor 3 2 4
MIRT243099 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT244079 EDN1 endothelin 1 2 2
MIRT246462 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT248079 SLC38A2 solute carrier family 38 member 2 2 4
MIRT270943 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT295182 ZNF317 zinc finger protein 317 2 4
MIRT296535 STX16 syntaxin 16 2 2
MIRT301578 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT316378 PPP1R14C protein phosphatase 1 regulatory inhibitor subunit 14C 2 2
MIRT323697 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT327914 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT367113 ZNF711 zinc finger protein 711 2 4
MIRT368759 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT407342 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT448324 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448957 CDK19 cyclin dependent kinase 19 2 4
MIRT449145 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT454117 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT459833 TPP1 tripeptidyl peptidase 1 2 2
MIRT460418 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT461658 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT462949 ZNF800 zinc finger protein 800 2 12
MIRT463646 YY1 YY1 transcription factor 2 8
MIRT464853 RPS27A ribosomal protein S27a 2 12
MIRT464873 UBB ubiquitin B 2 8
MIRT466321 THRA thyroid hormone receptor, alpha 2 2
MIRT466828 STX6 syntaxin 6 2 6
MIRT467415 SNTB1 syntrophin beta 1 2 4
MIRT467456 SNAPIN SNAP associated protein 2 2
MIRT468561 SERINC3 serine incorporator 3 2 10
MIRT469808 RAB14 RAB14, member RAS oncogene family 2 2
MIRT469869 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470335 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473777 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474740 KIF13A kinesin family member 13A 2 6
MIRT474957 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT475482 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT476297 GMFB glia maturation factor beta 2 10
MIRT477365 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477491 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478112 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479819 CCNA2 cyclin A2 2 6
MIRT480020 CAPRIN2 caprin family member 2 2 4
MIRT480841 BLCAP bladder cancer associated protein 2 10
MIRT481612 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT481871 ANKRD50 ankyrin repeat domain 50 2 2
MIRT484940 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485124 SECISBP2L SECIS binding protein 2 like 2 4
MIRT485438 KLF6 Kruppel like factor 6 2 2
MIRT485572 FOXQ1 forkhead box Q1 2 2
MIRT485647 DICER1 dicer 1, ribonuclease III 2 8
MIRT486744 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT490885 OSBP oxysterol binding protein 2 2
MIRT491424 PDZD11 PDZ domain containing 11 2 4
MIRT491646 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491792 ZNF24 zinc finger protein 24 2 2
MIRT492269 SIK1 salt inducible kinase 1 2 6
MIRT493093 MMGT1 membrane magnesium transporter 1 2 12
MIRT498068 SNX5 sorting nexin 5 2 6
MIRT498875 ZNF12 zinc finger protein 12 2 10
MIRT499895 KIAA1191 KIAA1191 2 4
MIRT500406 ZMAT3 zinc finger matrin-type 3 2 10
MIRT500732 TRIM37 tripartite motif containing 37 2 2
MIRT500921 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT501472 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 8
MIRT501552 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501785 NRBF2 nuclear receptor binding factor 2 2 6
MIRT501993 MAPK1 mitogen-activated protein kinase 1 2 10
MIRT502012 MAP7 microtubule associated protein 7 2 8
MIRT502417 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT502517 ESR1 estrogen receptor 1 2 2
MIRT502758 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT503052 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 2 2
MIRT503473 ZNF154 zinc finger protein 154 2 6
MIRT503676 SLC46A1 solute carrier family 46 member 1 2 2
MIRT504270 PARP1 poly(ADP-ribose) polymerase 1 2 6
MIRT504554 ZNF417 zinc finger protein 417 2 6
MIRT504683 ATP6V0D1 ATPase H+ transporting V0 subunit d1 2 6
MIRT505250 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT505876 POLR1B RNA polymerase I subunit B 2 4
MIRT506465 NACC2 NACC family member 2 2 4
MIRT506506 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506690 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT507905 CALM2 calmodulin 2 2 6
MIRT509659 ZNF354B zinc finger protein 354B 2 10
MIRT510724 SPG20 spartin 2 6
MIRT510863 RAN RAN, member RAS oncogene family 2 8
MIRT511092 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511247 KLHL36 kelch like family member 36 2 6
MIRT513212 RFT1 RFT1 homolog 2 2
MIRT513618 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT513716 RBM20 RNA binding motif protein 20 2 4
MIRT513910 GRB10 growth factor receptor bound protein 10 2 6
MIRT514366 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT517865 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT521314 RRAGD Ras related GTP binding D 2 4
MIRT521697 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 8
MIRT521771 PPIG peptidylprolyl isomerase G 2 8
MIRT524502 CEP170 centrosomal protein 170 2 4
MIRT527459 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT530125 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530844 RAG1 recombination activating 1 2 4
MIRT531099 PEX13 peroxisomal biogenesis factor 13 2 2
MIRT533490 TRIM71 tripartite motif containing 71 2 2
MIRT534267 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534718 RFX7 regulatory factor X7 2 2
MIRT535265 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 4
MIRT536337 LEFTY1 left-right determination factor 1 2 2
MIRT536405 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT538270 CUL3 cullin 3 2 4
MIRT538411 COX20 COX20, cytochrome c oxidase assembly factor 2 2
MIRT539457 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT540445 RBM43 RNA binding motif protein 43 2 2
MIRT541131 RAB34 RAB34, member RAS oncogene family 2 2
MIRT543568 RPF2 ribosome production factor 2 homolog 2 4
MIRT544105 IPMK inositol polyphosphate multikinase 2 2
MIRT544487 TRIM4 tripartite motif containing 4 2 2
MIRT544690 ZNF224 zinc finger protein 224 2 4
MIRT544986 MFF mitochondrial fission factor 2 4
MIRT546273 TMEM30A transmembrane protein 30A 2 4
MIRT546562 SATB2 SATB homeobox 2 2 2
MIRT546654 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT546774 RLIM ring finger protein, LIM domain interacting 2 2
MIRT546956 SFTPA1 surfactant protein A1 2 2
MIRT547040 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547494 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547911 HOXA5 homeobox A5 2 2
MIRT548401 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548479 EGLN3 egl-9 family hypoxia inducible factor 3 2 2
MIRT548645 DAPK1 death associated protein kinase 1 2 2
MIRT548852 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT548889 CHEK2 checkpoint kinase 2 2 4
MIRT549138 BRWD1 bromodomain and WD repeat domain containing 1 2 4
MIRT549183 BMP3 bone morphogenetic protein 3 2 2
MIRT549335 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549433 ACVR1 activin A receptor type 1 2 2
MIRT549463 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549491 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT550212 MAVS mitochondrial antiviral signaling protein 2 4
MIRT551702 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT552152 DAD1 defender against cell death 1 2 2
MIRT552358 ZNF620 zinc finger protein 620 2 2
MIRT552521 ZIC5 Zic family member 5 2 2
MIRT552848 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT552885 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553307 TSPAN3 tetraspanin 3 2 2
MIRT553347 TRPC3 transient receptor potential cation channel subfamily C member 3 5 4
MIRT553714 TCF7L2 transcription factor 7 like 2 2 2
MIRT553895 SUN2 Sad1 and UNC84 domain containing 2 2 4
MIRT554851 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT555078 PURG purine rich element binding protein G 2 2
MIRT555198 PRUNE2 prune homolog 2 2 2
MIRT556193 MCC mutated in colorectal cancers 2 2
MIRT556224 MB21D2 Mab-21 domain containing 2 2 2
MIRT556482 LIPA lipase A, lysosomal acid type 2 2
MIRT556965 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT557022 HOXD11 homeobox D11 2 2
MIRT557076 HOXB3 homeobox B3 2 2
MIRT557580 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT558280 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT558415 DEPDC1 DEP domain containing 1 2 2
MIRT558769 CFL2 cofilin 2 2 2
MIRT559632 AKIRIN2 akirin 2 2 2
MIRT560230 KLHL21 kelch like family member 21 2 4
MIRT560649 ZNF107 zinc finger protein 107 2 2
MIRT560931 CDK2AP2 cyclin dependent kinase 2 associated protein 2 2 2
MIRT563754 ZNF678 zinc finger protein 678 2 2
MIRT566007 RNF11 ring finger protein 11 2 2
MIRT566158 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT566692 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT567065 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567532 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567767 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT567831 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT571621 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT573076 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT610908 NF2 neurofibromin 2 2 2
MIRT620056 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT623177 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT627016 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627082 SF3A1 splicing factor 3a subunit 1 2 2
MIRT628280 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629099 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629239 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629415 ADM2 adrenomedullin 2 2 2
MIRT629590 RFC2 replication factor C subunit 2 2 2
MIRT629643 WDR31 WD repeat domain 31 2 2
MIRT629804 GPR82 G protein-coupled receptor 82 2 2
MIRT629878 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629922 POLR2D RNA polymerase II subunit D 2 2
MIRT629987 NARS asparaginyl-tRNA synthetase 2 2
MIRT630048 TERF2 telomeric repeat binding factor 2 2 2
MIRT630066 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630161 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630256 SMTNL2 smoothelin like 2 2 2
MIRT630286 PSMB5 proteasome subunit beta 5 2 2
MIRT630350 NKAP NFKB activating protein 2 2
MIRT630500 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT632051 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT632476 RPS15A ribosomal protein S15a 2 2
MIRT632603 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632999 DUSP18 dual specificity phosphatase 18 2 2
MIRT633086 CXorf21 chromosome X open reading frame 21 2 2
MIRT635056 MYH11 myosin heavy chain 11 2 2
MIRT635949 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636660 CDK4 cyclin dependent kinase 4 2 2
MIRT637191 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637930 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT641813 USP32 ubiquitin specific peptidase 32 2 2
MIRT642648 PTGR2 prostaglandin reductase 2 2 2
MIRT644240 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644669 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645097 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645997 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646512 FAM217B family with sequence similarity 217 member B 2 2
MIRT646778 IL23R interleukin 23 receptor 2 2
MIRT648519 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT651469 XIAP X-linked inhibitor of apoptosis 2 2
MIRT654353 RBM27 RNA binding motif protein 27 2 2
MIRT660831 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT661183 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT661244 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662847 OMD osteomodulin 2 2
MIRT662922 MED18 mediator complex subunit 18 2 2
MIRT663549 CCR6 C-C motif chemokine receptor 6 2 2
MIRT664360 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT666085 SSTR2 somatostatin receptor 2 2 2
MIRT666261 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666681 RBM23 RNA binding motif protein 23 2 2
MIRT667233 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667760 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669264 C4orf36 chromosome 4 open reading frame 36 2 2
MIRT671480 FLYWCH2 FLYWCH family member 2 2 2
MIRT671502 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671930 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672297 GP2 glycoprotein 2 2 2
MIRT672608 IRF1 interferon regulatory factor 1 2 2
MIRT674033 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674225 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674535 PRR23A proline rich 23A 2 2
MIRT675107 SNTB2 syntrophin beta 2 2 2
MIRT675273 ZNF431 zinc finger protein 431 2 2
MIRT684270 PRPF4 pre-mRNA processing factor 4 2 2
MIRT694280 ZNF529 zinc finger protein 529 2 4
MIRT698253 TMEM2 transmembrane protein 2 2 2
MIRT699912 RUNDC1 RUN domain containing 1 2 2
MIRT702594 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT705199 BTG1 BTG anti-proliferation factor 1 2 2
MIRT706927 THAP6 THAP domain containing 6 2 2
MIRT708878 MOCS2 molybdenum cofactor synthesis 2 2 2
MIRT709115 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709615 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT710589 CDCA4 cell division cycle associated 4 2 2
MIRT710793 IFNLR1 interferon lambda receptor 1 2 2
MIRT711775 RFXAP regulatory factor X associated protein 2 2
MIRT713336 KLRD1 killer cell lectin like receptor D1 2 2
MIRT713633 MED8 mediator complex subunit 8 2 2
MIRT713907 IGF2R insulin like growth factor 2 receptor 2 2
MIRT715061 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715178 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT715196 FKTN fukutin 2 2
MIRT715272 RNF125 ring finger protein 125 2 2
MIRT717800 FAM114A1 family with sequence similarity 114 member A1 2 2
MIRT720536 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT736758 TSPAN1 tetraspanin 1 4 0
MIRT736759 FAM83A family with sequence similarity 83 member A 4 0
MIRT736761 SBF2 SET binding factor 2 3 0
MIRT736853 FRZB frizzled-related protein 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-454 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-454-3p 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-454-3p Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-454-3p Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-454 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-454 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-454 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-454-3p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-(benzyloxy)cyclopentyl)methanol 385240 NSC676353 sensitive
hsa-miR-454-3p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-454-3p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-454-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-454-3p (2e)-5,6-dimethoxy-2-[(3-phenacyloxyphenyl)methylidene]-3h-inden-1-one 45028869 NSC744650 sensitive
hsa-miR-454-3p (3S,8R,9S,10R,13S,14S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthrene-3,17-diol 24204037 NSC730478 resistant
hsa-miR-454-3p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-454-3p (4-(1,3-dihydro-2h-pyrrolo[3,4-b]quinolin-2-ylcarbonyl)-2-oxotetrahydro-3-furanyl)methyl acetate 283490 NSC138333 sensitive
hsa-miR-454-3p (4E,5Z)-4,5-bis[(6-bromoquinazolin-4-yl)hydrazinylidene]pentane-1,2,3-triol 54611941 NSC716031 sensitive
hsa-miR-454-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-454-3p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-454-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-454-3p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-454-3p (5e)-2-[[5-methyl-4-[5-methyl-2-[[(5e)-5-[(4-methylphenyl)methylidene]-4-oxo-1,3-thiazol-2-yl]amino]-1,3-thiazol-4-yl]-1,3-thiazol-2-yl]amino]-5-[(4-methylphenyl)methylidene]-1,3-thiazol-4-one NSC730523 resistant
hsa-miR-454-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-454-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-454-3p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-454-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-454-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-454-3p (E)-3-(4-phenylphenyl)-1-thiophen-2-ylprop-2-en-1-one 5782484 NSC700125 sensitive
hsa-miR-454-3p (e)-5-morpholin-4-yl-1,2-diphenylpent-1-en-3-one;hydrochloride 5386798 NSC617826 sensitive
hsa-miR-454-3p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 sensitive
hsa-miR-454-3p (z)-1-(5-chloro-2-hydroxyphenyl)-3-quinolin-2-ylprop-2-en-1-one NSC71097 sensitive
hsa-miR-454-3p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 sensitive
hsa-miR-454-3p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-454-3p [(2r,3s,4r,5r)-5-(6-chloropurin-9-yl)-4-hydroxy-2-(trityloxymethyl)oxolan-3-yl] benzoate 401669 NSC715399 sensitive
hsa-miR-454-3p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-454-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-454-3p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24204032 NSC730473 resistant
hsa-miR-454-3p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 sensitive
hsa-miR-454-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 sensitive
hsa-miR-454-3p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 sensitive
hsa-miR-454-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-454-3p [2-[[5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-3-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 6712908 NSC719661 sensitive
hsa-miR-454-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-454-3p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-454-3p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 sensitive
hsa-miR-454-3p 1-(3-chlorophenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5494177 NSC668335 sensitive
hsa-miR-454-3p 1-(4-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465916 NSC668325 sensitive
hsa-miR-454-3p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-454-3p 1-[(E)-(5-hydroxypyridin-2-yl)methylideneamino]-3-pyridin-3-ylthiourea 135443616 NSC185065 sensitive
hsa-miR-454-3p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 sensitive
hsa-miR-454-3p 1-[(E)-1H-indol-3-ylmethylideneamino]-2-phenylguanidine;nitric acid 135439995 NSC644582 resistant
hsa-miR-454-3p 1-[(z)-(2-oxoindolin-3-ylidene)amino]-3-(2-pyridylmethyl)thiourea 3005083 NSC670961 sensitive
hsa-miR-454-3p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-454-3p 1-[2-(2-pyridyl)ethyl]-3-[(e)-2-pyridylmethyleneamino]thiourea 9571904 NSC670779 sensitive
hsa-miR-454-3p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-454-3p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 resistant
hsa-miR-454-3p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 sensitive
hsa-miR-454-3p 1-cyclohexyl-3-[(e)-[phenyl(2-pyridyl)methylene]amino]thiourea 5871897 NSC689540 sensitive
hsa-miR-454-3p 11-[(E)-2-(dimethylamino)ethenyl]pyrido[2,3-b]acridine-5,12-dione 5468977 NSC680733 resistant
hsa-miR-454-3p 11-[2-(dimethylamino)ethyl]pyrido[2,3-b]acridine-5,12-dione 387193 NSC680734 resistant
hsa-miR-454-3p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-454-3p 12-iminodaunorubicin hcl 72400 NSC254681 sensitive
hsa-miR-454-3p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-454-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-phenyl- 369537 NSC641394 sensitive
hsa-miR-454-3p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 resistant
hsa-miR-454-3p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 sensitive
hsa-miR-454-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-454-3p 2-(3,5-bis(chloromethyl)-4-methoxyphenyl)-4h-thiochromen-4-one 355507 NSC609259 sensitive
hsa-miR-454-3p 2-(4-((oxiran-2-yl)methoxy)styryl)-4,5-dihydrooxazole 24206038 NSC737757 sensitive
hsa-miR-454-3p 2-(5-bromo-6-formyl-3-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2h)-yl)ethyl nitrate 383812 NSC672424 sensitive
hsa-miR-454-3p 2-(hydroxymethyl)-8-methyl-8-azabicyclo[3.2.1]octan-3-one NSC715572 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]-1-(4-methoxyphenyl)prop-2-en-1-one;hydrochloride 353911 NSC603553 sensitive
hsa-miR-454-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-454-3p 2-[(z)-2-(4-chlorophenyl)ethenyl]-1-methylquinolin-1-ium iodide 54598850 NSC10520 resistant
hsa-miR-454-3p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-454-3p 2-[[4-(1h-benzimidazol-2-yl)phenyl]iminomethyl]phenol 402059 NSC715755 sensitive
hsa-miR-454-3p 2-[[4-(2-dimethylaminoethylcarbamoyl)acridin-9-yl]amino]-3-sulfanyl-propanoic acid 392357 NSC692641 sensitive
hsa-miR-454-3p 2-[2-[4-(3-chloro-1,4-dihydroxy-5,8-dioxonaphthalen-2-yl)piperazin-1-yl]ethoxy]ethyl acetate 378769 NSC661939 sensitive
hsa-miR-454-3p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 sensitive
hsa-miR-454-3p 2-benzoyl-N-[(Z)-[[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-[(4-nitrophenyl)diazenyl]methylidene]amino]-5-chlorobenzamide 135493917 NSC681967 sensitive
hsa-miR-454-3p 2-bromo-5,8-dihydroxy-3-methyl-1,4-naphthoquinone 378912 NSC662383 sensitive
hsa-miR-454-3p 2-hydroxy discorhabdin d 362391 NSC626161 sensitive
hsa-miR-454-3p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 sensitive
hsa-miR-454-3p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-454-3p 2,2-dibutyl-7-methyl-1,3,2-benzodioxastannin-4-one 16683125 NSC628560 sensitive
hsa-miR-454-3p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 sensitive
hsa-miR-454-3p 2,6-bis((2-aminophenyl)thio)benzonitrile NSC679800 sensitive
hsa-miR-454-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-454-3p 2,6-bis(pyrrolidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 380174 NSC665622 sensitive
hsa-miR-454-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-454-3p 2,7-dicyanoxanthone 363841 NSC629107 resistant
hsa-miR-454-3p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 sensitive
hsa-miR-454-3p 20-[3-[2-aminoethyl-[3-(15,16-dimethoxy-11,19-dioxo-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-20-yl)propyl]amino]propyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8) 45027842 NSC727620 sensitive
hsa-miR-454-3p 3-(3,5-dimethoxyphenoxy)-2-phenyl-7-(trifluoromethyl)quinoxalin-5-amine 393436 NSC695323 sensitive
hsa-miR-454-3p 3-(4-nitrophenyl)-6-phenyl-cyclohex-4-ene-1,1,2,2-tetracarbonitrile 391620 NSC691106 sensitive
hsa-miR-454-3p 3-[(1Z)-1-(1-hydroxypyridin-2-ylidene)ethyl]imino-1,1-dimethylthiourea 44384025 NSC351078 sensitive
hsa-miR-454-3p 3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]-1,1-bis(pyridin-2-ylmethyl)thiourea 5466413 NSC689533 sensitive
hsa-miR-454-3p 3-[[4-(3,4-dihydroxyphenyl)-1,3-thiazol-2-yl]iminomethyl]-4-hydroxychromen-2-one;hydrochloride 135403636 NSC659390 sensitive
hsa-miR-454-3p 3-bromoquinolin-8-ol 384167 NSC673458 sensitive
hsa-miR-454-3p 3-hydroxy-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohexa-2,5-diene-1,4-dione 178981 NSC697134 sensitive
hsa-miR-454-3p 4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione 25181424 NSC741898 sensitive
hsa-miR-454-3p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-454-3p 4-(furo[3,2-c]quinolin-4-ylamino)-n-(2-piperazin-1-ylethyl)benzamide 24204688 NSC732492 resistant
hsa-miR-454-3p 4-[(4e)-4-[(4-chlorophenyl)methylidene]-5-oxo-2-phenylimidazol-1-yl]-3-sulfanylidene-2h-1,2,4-triazin-5-one 5471340 NSC710587 sensitive