miRTarBase - #MIRT041079


—
pre-miRNA Information
pre-miRNA hsa-mir-504   
Genomic Coordinates chrX: 138667711 - 138667793
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1297440872 6 dbSNP
rs1429220261 12 dbSNP
rs745623382 14 dbSNP
rs770027520 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SRRM2   
Synonyms 300-KD, CWF21, Cwc21, HSPC075, SRL300, SRm300
Description serine/arginine repetitive matrix 2
Transcript NM_016333   
Expression
Putative miRNA Targets on SRRM2
3'UTR of SRRM2
(miRNA target sites are highlighted)		 
>SRRM2|NM_016333|3'UTR
   1 ATTGTCTTTGGGGGATTCCACCACACCCAATGCTCTGGAGCCACAAGGAGTGTCCCTTCTTCCCCAGCAGAGCCGTGGGA
  81 GGGTCCTTGTCTGCTCTCCTTTGAACCTTGGCAGCCCTTGGATGGAGGGCTCCCTTTCCCTCCCCTTTTTTTTTTCTTTG
 161 TTCCTGTGAAATGTTAATCTCCGTGAGTTCTTCCTGGTTCATGTGTTCTGGGGGGTTTGGGGTGGGAGGGAATGCAGATG
 241 GGAGTTGGGGGAGGGGAGGATACAGTTCAGGATACCCCAGCCTGGAGTCAGGGCCAGGGAGGCATGGCCCCACTTGTATC
 321 CAGAAGTTCCCAGGGGTGATTGTGATGGTGGTTGGGACTGGAGGTTGTATAAGGTGTTCTTGGAAGGAAGGGGCAGGAGT
 401 TGGAATTAGTTGGTCCCTACTGTCCCCCATGAGGTTGTGAACCCCTCCCCCCAACTTTTCATGTTTCTTAAAGGCATTTT
 481 GGTTTTTTAAAATCTGTACAGCAAGAGCAACTTTTTCTGTCAAATAAAAATGAGAAATGCAGGAAAAAAAAAAAAAAAAA
 561 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuAUCUCACGUCUGGUCCCaga 5'
            |:||||  :|:||||||   
Target 5' ccTGGAGTCAGGGCCAGGGagg 3'
 281 - 302 132.00 -21.32
2 
miRNA  3' cuaUCUC-ACGUCUGGUCCCAGa 5'
             ||||  |::|:  |||||| 
Target 5' agcAGAGCCGTGGG--AGGGTCc 3'
 66 - 86 126.00 -16.20
3 
miRNA  3' cuAUCUCACGUCU-----GGUCCCaga 5'
            | |  | ||||     ||||||   
Target 5' acTTGTATCCAGAAGTTCCCAGGGgtg 3'
 312 - 338 112.00 -12.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16129232 5 COSMIC
COSN30471837 7 COSMIC
COSN30467695 11 COSMIC
COSN17153908 15 COSMIC
COSN31556372 18 COSMIC
COSN31538261 75 COSMIC
COSN31605307 76 COSMIC
COSN31568335 97 COSMIC
COSN18739429 156 COSMIC
COSN20112556 156 COSMIC
COSN32069611 161 COSMIC
COSN8231398 163 COSMIC
COSN32069612 168 COSMIC
COSN31574960 180 COSMIC
COSN32069737 185 COSMIC
COSN20507790 224 COSMIC
COSN25859828 228 COSMIC
COSN30763045 256 COSMIC
COSN24295431 344 COSMIC
COSN26497278 370 COSMIC
COSN30182808 471 COSMIC
COSN31535549 485 COSMIC
COSN1081618 488 COSMIC
COSN31560120 495 COSMIC
COSN20078458 537 COSMIC
COSN13663606 541 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774353066 3 dbSNP
rs755966286 4 dbSNP
rs749288174 6 dbSNP
rs370538116 7 dbSNP
rs375312805 9 dbSNP
rs986898476 9 dbSNP
rs1468201060 10 dbSNP
rs761019260 10 dbSNP
rs1050134 15 dbSNP
rs772132063 18 dbSNP
rs1401808815 19 dbSNP
rs1039133675 20 dbSNP
rs1364169147 22 dbSNP
rs191241080 25 dbSNP
rs760909959 27 dbSNP
rs368630823 28 dbSNP
rs1432987923 29 dbSNP
rs759496090 31 dbSNP
rs1237100335 32 dbSNP
rs534870872 33 dbSNP
rs372896865 34 dbSNP
rs369220618 36 dbSNP
rs760067458 37 dbSNP
rs1288690090 38 dbSNP
rs1490796384 41 dbSNP
rs555264865 43 dbSNP
rs369931529 44 dbSNP
rs757194436 45 dbSNP
rs1183460220 46 dbSNP
rs767940066 47 dbSNP
rs1472175157 50 dbSNP
rs201582275 51 dbSNP
rs745890617 52 dbSNP
rs1426988622 55 dbSNP
rs1430925267 56 dbSNP
rs772226945 56 dbSNP
rs760744883 57 dbSNP
rs1396169546 60 dbSNP
rs1168099529 61 dbSNP
rs1356216580 62 dbSNP
rs753011475 62 dbSNP
rs1003676803 63 dbSNP
rs780111055 65 dbSNP
rs1413229910 66 dbSNP
rs1336504781 69 dbSNP
rs769001794 73 dbSNP
rs762175067 75 dbSNP
rs770236809 76 dbSNP
rs1164975353 77 dbSNP
rs773799714 84 dbSNP
rs1461877215 86 dbSNP
rs1416608275 89 dbSNP
rs1459446077 90 dbSNP
rs756482818 90 dbSNP
rs1273664975 91 dbSNP
rs1337125104 92 dbSNP
rs374321308 93 dbSNP
rs537484544 98 dbSNP
rs774993882 99 dbSNP
rs768088201 100 dbSNP
rs1212200879 106 dbSNP
rs760472912 107 dbSNP
rs918787206 108 dbSNP
rs1336088083 110 dbSNP
rs763843417 114 dbSNP
rs1231529350 116 dbSNP
rs557390123 117 dbSNP
rs753482239 119 dbSNP
rs962341650 120 dbSNP
rs757144915 122 dbSNP
rs1430224684 127 dbSNP
rs538739186 128 dbSNP
rs761728679 131 dbSNP
rs758389045 132 dbSNP
rs780243592 133 dbSNP
rs747061247 135 dbSNP
rs1294764210 138 dbSNP
rs1324526605 139 dbSNP
rs1419559008 140 dbSNP
rs138948846 141 dbSNP
rs781412381 142 dbSNP
rs1474208438 143 dbSNP
rs1265693212 144 dbSNP
rs1491534387 145 dbSNP
rs1309364494 146 dbSNP
rs372487257 146 dbSNP
rs745412857 146 dbSNP
rs756915314 146 dbSNP
rs748471139 147 dbSNP
rs770183962 149 dbSNP
rs1201330000 151 dbSNP
rs1337695340 153 dbSNP
rs539949164 154 dbSNP
rs758319615 156 dbSNP
rs78617860 156 dbSNP
rs11551731 157 dbSNP
rs1261629778 161 dbSNP
rs1407922452 161 dbSNP
rs1426829929 163 dbSNP
rs1427161662 164 dbSNP
rs771480215 165 dbSNP
rs1394814579 166 dbSNP
rs1373957559 167 dbSNP
rs572229640 170 dbSNP
rs1174459530 171 dbSNP
rs767369845 173 dbSNP
rs766726779 176 dbSNP
rs1288266110 177 dbSNP
rs1382649817 180 dbSNP
rs1383805615 182 dbSNP
rs760276685 183 dbSNP
rs763793877 184 dbSNP
rs1346937564 185 dbSNP
rs902545465 186 dbSNP
rs1284804854 188 dbSNP
rs1242297447 191 dbSNP
rs1373957281 192 dbSNP
rs1297465290 193 dbSNP
rs1323701470 194 dbSNP
rs1237679802 199 dbSNP
rs796518195 201 dbSNP
rs1260695739 202 dbSNP
rs776457758 205 dbSNP
rs1207361006 209 dbSNP
rs1231066114 210 dbSNP
rs1433679747 210 dbSNP
rs796238811 210 dbSNP
rs902388364 211 dbSNP
rs1000705525 212 dbSNP
rs1465639031 214 dbSNP
rs1259671233 219 dbSNP
rs1388079146 219 dbSNP
rs1307497236 223 dbSNP
rs1228989886 224 dbSNP
rs1256021905 225 dbSNP
rs1457285574 228 dbSNP
rs1032146027 230 dbSNP
rs111748580 233 dbSNP
rs1204282270 234 dbSNP
rs1306227473 238 dbSNP
rs1244732652 239 dbSNP
rs1356856995 240 dbSNP
rs534163723 247 dbSNP
rs75586278 248 dbSNP
rs1019638025 249 dbSNP
rs1420514559 252 dbSNP
rs1430335128 253 dbSNP
rs374491040 257 dbSNP
rs1168471409 259 dbSNP
rs965750135 260 dbSNP
rs1420188456 262 dbSNP
rs1188739091 269 dbSNP
rs1255681669 270 dbSNP
rs1056739347 271 dbSNP
rs1486089991 273 dbSNP
rs1259896647 274 dbSNP
rs1213614990 275 dbSNP
rs1336835143 275 dbSNP
rs972880083 276 dbSNP
rs1232166514 277 dbSNP
rs1025685470 279 dbSNP
rs1470574253 281 dbSNP
rs1339337326 283 dbSNP
rs112074102 286 dbSNP
rs1404354965 287 dbSNP
rs1288644667 290 dbSNP
rs1447765970 293 dbSNP
rs952764141 302 dbSNP
rs765440975 304 dbSNP
rs895288847 310 dbSNP
rs1362252474 311 dbSNP
rs1461003759 312 dbSNP
rs1383373935 313 dbSNP
rs574378496 317 dbSNP
rs149417935 323 dbSNP
rs562945467 324 dbSNP
rs1253572175 327 dbSNP
rs531940765 328 dbSNP
rs552264300 330 dbSNP
rs1212947997 331 dbSNP
rs1224045097 334 dbSNP
rs375134620 336 dbSNP
rs1252534756 339 dbSNP
rs927441987 342 dbSNP
rs1292914683 345 dbSNP
rs1016670065 348 dbSNP
rs755835089 349 dbSNP
rs917626988 362 dbSNP
rs993799594 363 dbSNP
rs183204995 368 dbSNP
rs1388728651 370 dbSNP
rs1042019388 379 dbSNP
rs1462746519 380 dbSNP
rs1372736447 382 dbSNP
rs8843 384 dbSNP
rs1455446562 386 dbSNP
rs1197606119 389 dbSNP
rs1395427180 389 dbSNP
rs1431686918 395 dbSNP
rs761673342 397 dbSNP
rs765132684 398 dbSNP
rs754379091 403 dbSNP
rs1053639407 404 dbSNP
rs766748614 406 dbSNP
rs1195875733 408 dbSNP
rs1455293766 413 dbSNP
rs1289311527 414 dbSNP
rs758284820 415 dbSNP
rs766239205 418 dbSNP
rs557345201 420 dbSNP
rs751586611 421 dbSNP
rs1484509832 423 dbSNP
rs1006840763 424 dbSNP
rs768578100 424 dbSNP
rs964192291 425 dbSNP
rs1413151141 426 dbSNP
rs755080591 427 dbSNP
rs1329851744 428 dbSNP
rs199911255 429 dbSNP
rs901049246 430 dbSNP
rs748417915 434 dbSNP
rs756456422 437 dbSNP
rs1161658600 438 dbSNP
rs776637620 440 dbSNP
rs915288816 440 dbSNP
rs1436796786 442 dbSNP
rs778267591 443 dbSNP
rs771413323 444 dbSNP
rs1182373161 445 dbSNP
rs1457599935 447 dbSNP
rs749512557 447 dbSNP
rs771108224 447 dbSNP
rs1271441915 448 dbSNP
rs1025570820 449 dbSNP
rs774744347 450 dbSNP
rs746481039 451 dbSNP
rs768325100 453 dbSNP
rs779574869 456 dbSNP
rs776404858 459 dbSNP
rs761619874 462 dbSNP
rs769332048 463 dbSNP
rs1050195 468 dbSNP
rs1343255732 469 dbSNP
rs1263050151 470 dbSNP
rs1240350872 472 dbSNP
rs772997892 473 dbSNP
rs762675808 474 dbSNP
rs1441044868 477 dbSNP
rs766297537 480 dbSNP
rs751536870 481 dbSNP
rs759588581 483 dbSNP
rs1374951885 489 dbSNP
rs767641625 490 dbSNP
rs1310676579 492 dbSNP
rs1386814500 495 dbSNP
rs1412566286 495 dbSNP
rs1470729410 495 dbSNP
rs1382732089 500 dbSNP
rs1244355092 502 dbSNP
rs188485694 506 dbSNP
rs1034509145 509 dbSNP
rs756293780 511 dbSNP
rs116928678 515 dbSNP
rs754184213 518 dbSNP
rs748721409 519 dbSNP
rs1189440043 520 dbSNP
rs757597303 521 dbSNP
rs779446788 522 dbSNP
rs1256397888 531 dbSNP
rs1185287839 533 dbSNP
rs1385642201 538 dbSNP
rs959120163 540 dbSNP
rs1441088198 545 dbSNP
rs895417957 546 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuaucucacgUCUGGUC-CCAGa 5'
                    ||:|||| |||| 
Target 5' -------cagAGGCCAGCGGTCa 3'
 		1 - 16
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.382 0 -0.422 0 65 Click to see details
ESCA -0.947 0.01 -0.900 0.02 5 Click to see details
PRAD 0.292 0.02 0.307 0.02 50 Click to see details
PAAD 0.921 0.04 0.800 0.1 4 Click to see details
STAD -0.318 0.06 -0.344 0.05 24 Click to see details
UCEC -0.28 0.16 -0.207 0.23 15 Click to see details
LUSC 0.172 0.19 0.314 0.05 29 Click to see details
KIRC 0.111 0.22 0.093 0.26 51 Click to see details
BLCA -0.21 0.24 -0.182 0.27 14 Click to see details
CHOL 0.31 0.25 0.036 0.47 7 Click to see details
LIHC -0.078 0.31 -0.014 0.46 43 Click to see details
THCA 0.07 0.32 0.140 0.17 49 Click to see details
KICH -0.064 0.38 -0.032 0.44 25 Click to see details
COAD 0.128 0.42 -0.100 0.44 5 Click to see details
KIRP 0.032 0.44 0.120 0.27 28 Click to see details
HNSC 0.013 0.47 0.057 0.39 28 Click to see details
LUAD 0.02 0.48 0.073 0.42 11 Click to see details
LUAD 0.02 0.48 0.073 0.42 11 Click to see details
LUAD 0.02 0.48 0.073 0.42 11 Click to see details
LUAD 0.02 0.48 0.073 0.42 11 Click to see details
LUAD 0.02 0.48 0.073 0.42 11 Click to see details
101 hsa-miR-504-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT016251 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT016252 FAS Fas cell surface death receptor 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A like 1 2 1
MIRT016256 MDM2 MDM2 proto-oncogene 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1 H2A family member c 1 1
MIRT041076 FEM1A fem-1 homolog A 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208 member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L mitochondrial elongation factor 1 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domain containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b subunit 1 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT448052 SFRP1 secreted frizzled related protein 1 2 2
MIRT457649 ZNF69 zinc finger protein 69 2 2
MIRT458626 TRIM72 tripartite motif containing 72 2 2
MIRT466176 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT472583 NACC1 nucleus accumbens associated 1 2 2
MIRT473576 MAT2A methionine adenosyltransferase 2A 2 6
MIRT485155 RASL10B RAS like family 10 member B 2 2
MIRT490063 PRRT2 proline rich transmembrane protein 2 2 2
MIRT493015 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT499425 PLCG2 phospholipase C gamma 2 2 11
MIRT506956 HOXB3 homeobox B3 2 4
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508101 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT522215 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT530327 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531042 ZNF502 zinc finger protein 502 2 2
MIRT532580 GSS glutathione synthetase 2 2
MIRT534841 RAB15 RAB15, member RAS oncogene family 2 2
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT538303 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT546344 TFAP2C transcription factor AP-2 gamma 2 2
MIRT546704 RORA RAR related orphan receptor A 2 4
MIRT549222 BCL2L11 BCL2 like 11 2 4
MIRT549623 TMEM101 transmembrane protein 101 2 2
MIRT549931 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550163 ZNF223 zinc finger protein 223 2 4
MIRT550555 ARSK arylsulfatase family member K 2 2
MIRT553402 TRIM2 tripartite motif containing 2 2 4
MIRT554084 SNX4 sorting nexin 4 2 4
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT558525 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT558565 CRLF3 cytokine receptor like factor 3 2 4
MIRT560946 TPM4 tropomyosin 4 2 4
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT562174 HOXA13 homeobox A13 2 2
MIRT568635 ACVR2A activin A receptor type 2A 2 2
MIRT574908 Plcg2 phospholipase C, gamma 2 2 7
MIRT575177 Atg9a autophagy related 9A 2 2
MIRT611972 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT635830 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 4
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 4
MIRT643205 JAK3 Janus kinase 3 2 2
MIRT650232 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT655940 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT662021 ZNF445 zinc finger protein 445 2 2
MIRT662037 FUT2 fucosyltransferase 2 2 2
MIRT666873 POU2F2 POU class 2 homeobox 2 2 2
MIRT684310 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT687333 OSMR oncostatin M receptor 2 2
MIRT689008 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT695137 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695154 PRY PTPN13-like, Y-linked 2 2
MIRT700695 POLR3D RNA polymerase III subunit D 2 2
MIRT703269 GNL3L G protein nucleolar 3 like 2 2
MIRT708941 CRY2 cryptochrome circadian clock 2 2 2
MIRT709200 SAPCD2 suppressor APC domain containing 2 2 2
MIRT709572 PDE4A phosphodiesterase 4A 2 2
MIRT711295 PSME3 proteasome activator subunit 3 2 2
MIRT712425 MACROD2 MACRO domain containing 2 2 2
MIRT713941 PIGR polymeric immunoglobulin receptor 2 2
MIRT714124 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714630 KIAA1143 KIAA1143 2 2
MIRT724046 SMIM14 small integral membrane protein 14 2 2
MIRT724649 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725476 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-504 Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-504 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-504 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-504-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-504-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-504-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-504-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-504-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-504-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission