miRTarBase - #MIRT041080


—
pre-miRNA Information
pre-miRNA hsa-mir-504   
Genomic Coordinates chrX: 138667711 - 138667793
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1297440872 6 dbSNP
rs1429220261 12 dbSNP
rs745623382 14 dbSNP
rs770027520 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HNRNPAB   
Synonyms ABBP1, HNRPAB
Description heterogeneous nuclear ribonucleoprotein A/B
Transcript NM_004499   
Other Transcripts NM_031266   
Expression
Putative miRNA Targets on HNRNPAB
3'UTR of HNRNPAB
(miRNA target sites are highlighted)		 
>HNRNPAB|NM_004499|3'UTR
   1 GGCGGCAGCAGGAGCGACCAACTGATCGCACACATGCTTTGTTTGGATATGGAGTGAACACAATTATGTACCAAATTTAA
  81 CTTGGCAAACTTTCTATTGCCTGTCCCATGTGCATCTTATTTAAAATTTCCCCCATGGAAATCACTCTCCTGTTGACTAT
 161 TTCCAGAGCTCTAGGTGTTTAGGCAGCGTGTGGTGTCTGAGAGGCCATAGCGCCATCATGGGCTGATTTTTATTACCAGG
 241 TCCCCCAGAAGCAGGTGGGAGGCTCTGCTTCCTGCTGCCGCTCTGCAGCCTGGACCTGTGGACCCTGGTTGTAAAGAGTA
 321 AATTGTATCTTAGGAAACCAGTGTCACCTTTTTTTCACCTTTTAATTTTATATTATTTGCGTCATACATTTCCTGTAACG
 401 GAAGTGTTAATTTTACTGTACTTTTTGGTACCTTTTGGGAATCTAATGTATTGTAAGGTATTTTACACGTGTCCTGATTT
 481 TGCCACAACCTGGATATTGAAGCTATCCAAGCTTTTGAAATAAAATTTAAAAACCCCCAAGCCTGGGTGAGTGTGGGATA
 561 AAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuaucucaCGUCUGGUCCCAGa 5'
                  | | ||||| ||| 
Target 5' gtatcttaGGAAACCAGTGTCa 3'
 325 - 346 122.00 -9.30
2 
miRNA  3' cuAUCU-CACGUCUGGUCCCAga 5'
            |||: || :||: ||| ||  
Target 5' tcTAGGTGTTTAGG-CAGCGTgt 3'
 170 - 191 107.00 -8.41
3 
miRNA  3' cuaucucacGUCUGGUCCCAga 5'
                   || :|| ||||  
Target 5' aaaaaccccCAAGCCTGGGTga 3'
 529 - 550 101.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30492806 22 COSMIC
COSN30492809 23 COSMIC
COSN28855831 28 COSMIC
COSN26979096 51 COSMIC
COSN31523944 65 COSMIC
COSN31587344 72 COSMIC
COSN31525589 127 COSMIC
COSN30135695 132 COSMIC
COSN31568156 140 COSMIC
COSN1312689 142 COSMIC
COSN31591723 213 COSMIC
COSN28790607 259 COSMIC
COSN30543592 289 COSMIC
COSN31589070 377 COSMIC
COSN26669613 381 COSMIC
COSN15098405 437 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs982397142 2 dbSNP
rs374005803 4 dbSNP
rs200876071 5 dbSNP
rs1433900238 7 dbSNP
rs1275134593 10 dbSNP
rs146209319 11 dbSNP
rs370621026 12 dbSNP
rs764344268 14 dbSNP
rs754179252 16 dbSNP
rs757096275 17 dbSNP
rs1392398669 19 dbSNP
rs1411340727 19 dbSNP
rs765120408 22 dbSNP
rs750218559 23 dbSNP
rs1463872021 25 dbSNP
rs569849823 28 dbSNP
rs375570673 29 dbSNP
rs1186616929 30 dbSNP
rs555561048 31 dbSNP
rs754554188 32 dbSNP
rs1253130639 34 dbSNP
rs763377195 34 dbSNP
rs199969475 35 dbSNP
rs368576624 37 dbSNP
rs768890464 38 dbSNP
rs774905734 38 dbSNP
rs774938329 38 dbSNP
rs1386165246 42 dbSNP
rs1399911100 48 dbSNP
rs77837239 51 dbSNP
rs1300385631 53 dbSNP
rs1226907333 56 dbSNP
rs1051705081 61 dbSNP
rs1294251711 62 dbSNP
rs1265739332 63 dbSNP
rs778261912 64 dbSNP
rs1435380389 65 dbSNP
rs1323173639 68 dbSNP
rs977977512 75 dbSNP
rs1391831526 76 dbSNP
rs1166604819 77 dbSNP
rs1425244375 77 dbSNP
rs770486669 78 dbSNP
rs1487224010 79 dbSNP
rs1245729278 82 dbSNP
rs1205457343 83 dbSNP
rs1483574470 84 dbSNP
rs1277267022 86 dbSNP
rs1039093260 87 dbSNP
rs1033203458 90 dbSNP
rs1472010372 91 dbSNP
rs1156498589 94 dbSNP
rs1274461121 95 dbSNP
rs1346530494 101 dbSNP
rs1372173789 102 dbSNP
rs1306021773 107 dbSNP
rs957347961 110 dbSNP
rs1026785910 114 dbSNP
rs1359607988 115 dbSNP
rs1178178842 117 dbSNP
rs1430903596 121 dbSNP
rs752013182 122 dbSNP
rs1182414439 128 dbSNP
rs915670561 131 dbSNP
rs1292680827 133 dbSNP
rs949684474 134 dbSNP
rs1203372256 136 dbSNP
rs1480528636 137 dbSNP
rs1257045558 141 dbSNP
rs530965685 141 dbSNP
rs1035139789 146 dbSNP
rs554325892 149 dbSNP
rs1278084099 151 dbSNP
rs981092143 156 dbSNP
rs959651392 158 dbSNP
rs1408954335 160 dbSNP
rs968756173 164 dbSNP
rs1304491490 165 dbSNP
rs1464519163 165 dbSNP
rs1358068784 169 dbSNP
rs908439025 171 dbSNP
rs924332868 176 dbSNP
rs1409261065 181 dbSNP
rs934409655 188 dbSNP
rs1418834534 189 dbSNP
rs772394722 191 dbSNP
rs1226583547 192 dbSNP
rs757835958 196 dbSNP
rs781650816 197 dbSNP
rs572538601 204 dbSNP
rs1482597687 206 dbSNP
rs943269075 209 dbSNP
rs781607455 212 dbSNP
rs898361764 216 dbSNP
rs932485587 219 dbSNP
rs1331358732 226 dbSNP
rs545872303 229 dbSNP
rs1258578556 232 dbSNP
rs1223859709 240 dbSNP
rs1238666502 243 dbSNP
rs899176116 244 dbSNP
rs1394082335 248 dbSNP
rs576448036 253 dbSNP
rs535990500 254 dbSNP
rs566365305 258 dbSNP
rs17759 259 dbSNP
rs1321174887 268 dbSNP
rs1436585245 270 dbSNP
rs769191106 274 dbSNP
rs1385863136 275 dbSNP
rs779714978 276 dbSNP
rs1179313940 279 dbSNP
rs187811984 280 dbSNP
rs1008871470 281 dbSNP
rs13972 286 dbSNP
rs1163697155 287 dbSNP
rs1366485754 290 dbSNP
rs768343357 291 dbSNP
rs1018984126 293 dbSNP
rs1466291692 295 dbSNP
rs1246308989 298 dbSNP
rs903413085 300 dbSNP
rs1204770196 302 dbSNP
rs1426389441 303 dbSNP
rs895281718 306 dbSNP
rs1303542395 308 dbSNP
rs1012461534 313 dbSNP
rs1267460878 313 dbSNP
rs1358492979 313 dbSNP
rs1298208547 316 dbSNP
rs1249862466 317 dbSNP
rs1369815614 319 dbSNP
rs1407949126 320 dbSNP
rs774098333 327 dbSNP
rs191173707 330 dbSNP
rs1291465169 331 dbSNP
rs183455490 334 dbSNP
rs957529685 335 dbSNP
rs1374193675 336 dbSNP
rs1227941952 337 dbSNP
rs1451953504 337 dbSNP
rs761659349 338 dbSNP
rs991621810 340 dbSNP
rs1000294138 343 dbSNP
rs1362038161 344 dbSNP
rs1208337552 345 dbSNP
rs1247091266 347 dbSNP
rs1275167810 348 dbSNP
rs1022647485 349 dbSNP
rs1031326437 349 dbSNP
rs772030365 350 dbSNP
rs971134903 352 dbSNP
rs1332341020 358 dbSNP
rs1365338812 360 dbSNP
rs1404000572 360 dbSNP
rs987180273 360 dbSNP
rs1309084099 362 dbSNP
rs575338189 363 dbSNP
rs1369201934 366 dbSNP
rs964510207 366 dbSNP
rs1207280491 371 dbSNP
rs974673405 372 dbSNP
rs1480705848 376 dbSNP
rs981061131 381 dbSNP
rs930562251 382 dbSNP
rs1481969411 383 dbSNP
rs908225886 385 dbSNP
rs773032032 387 dbSNP
rs939923551 395 dbSNP
rs544736115 400 dbSNP
rs1427714016 401 dbSNP
rs766278503 407 dbSNP
rs939443088 410 dbSNP
rs1056442453 413 dbSNP
rs1289864990 416 dbSNP
rs1355177171 418 dbSNP
rs1334402397 426 dbSNP
rs1328730456 432 dbSNP
rs1415609606 435 dbSNP
rs759624713 438 dbSNP
rs1174291818 441 dbSNP
rs1469357810 443 dbSNP
rs1412925635 444 dbSNP
rs765256984 446 dbSNP
rs549466724 447 dbSNP
rs1232129599 448 dbSNP
rs1471475441 448 dbSNP
rs895331070 451 dbSNP
rs1444125369 452 dbSNP
rs187429047 457 dbSNP
rs1202414947 458 dbSNP
rs1329259780 459 dbSNP
rs932448877 461 dbSNP
rs541261231 465 dbSNP
rs193159828 469 dbSNP
rs763237455 470 dbSNP
rs1449229313 474 dbSNP
rs944793717 477 dbSNP
rs1040394486 478 dbSNP
rs1342714019 484 dbSNP
rs1050988 486 dbSNP
rs1335357986 488 dbSNP
rs903219433 491 dbSNP
rs1297273742 497 dbSNP
rs10408 500 dbSNP
rs1389535911 501 dbSNP
rs1161607682 503 dbSNP
rs1399247383 505 dbSNP
rs1163568252 509 dbSNP
rs1473660031 510 dbSNP
rs1340544906 512 dbSNP
rs1366591939 518 dbSNP
rs999271614 519 dbSNP
rs1216816940 526 dbSNP
rs370133205 529 dbSNP
rs533096658 530 dbSNP
rs1312125603 531 dbSNP
rs1208743603 533 dbSNP
rs1260730023 534 dbSNP
rs764479233 535 dbSNP
rs1290152734 536 dbSNP
rs1229206528 539 dbSNP
rs1462342503 539 dbSNP
rs1183859812 540 dbSNP
rs1023118520 541 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuaucucacgUCUGGUCCCaga 5'
                    |||:|||||   
Target 5' ---gaggaaaAGATCAGGGagt 3'
 		1 - 19
2 
miRNA  3' cuaUCUCA------CG-UCUGGUCCCAGa 5'
             :||||      || || :::|||   
Target 5' cagGGAGTACTTTGGCGAGTTTGGGGAGa 3'
 		12 - 40
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.351 0.01 0.288 0.03 43 Click to see details
KICH 0.327 0.06 0.402 0.02 25 Click to see details
LUAD 0.496 0.06 0.582 0.03 11 Click to see details
COAD -0.72 0.09 -0.600 0.14 5 Click to see details
STAD 0.28 0.09 0.197 0.18 24 Click to see details
ESCA 0.636 0.12 0.400 0.25 5 Click to see details
PAAD -0.701 0.15 -1.000 0.5 4 Click to see details
HNSC 0.203 0.15 0.131 0.25 28 Click to see details
THCA -0.122 0.2 -0.104 0.24 49 Click to see details
KIRP 0.154 0.22 0.222 0.13 28 Click to see details
BLCA 0.133 0.33 0.279 0.17 14 Click to see details
KIRC 0.049 0.37 0.049 0.37 51 Click to see details
PRAD 0.045 0.38 0.042 0.39 50 Click to see details
BRCA -0.028 0.41 0.014 0.46 65 Click to see details
CHOL -0.041 0.47 0.250 0.29 7 Click to see details
UCEC 0.02 0.47 -0.132 0.32 15 Click to see details
LUSC -0.007 0.49 -0.031 0.44 29 Click to see details
LUSC -0.007 0.49 -0.031 0.44 29 Click to see details
LUSC -0.007 0.49 -0.031 0.44 29 Click to see details
LUSC -0.007 0.49 -0.031 0.44 29 Click to see details
LUSC -0.007 0.49 -0.031 0.44 29 Click to see details
101 hsa-miR-504-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT016251 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT016252 FAS Fas cell surface death receptor 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A like 1 2 1
MIRT016256 MDM2 MDM2 proto-oncogene 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1 H2A family member c 1 1
MIRT041076 FEM1A fem-1 homolog A 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208 member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L mitochondrial elongation factor 1 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domain containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b subunit 1 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT448052 SFRP1 secreted frizzled related protein 1 2 2
MIRT457649 ZNF69 zinc finger protein 69 2 2
MIRT458626 TRIM72 tripartite motif containing 72 2 2
MIRT466176 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT472583 NACC1 nucleus accumbens associated 1 2 2
MIRT473576 MAT2A methionine adenosyltransferase 2A 2 6
MIRT485155 RASL10B RAS like family 10 member B 2 2
MIRT490063 PRRT2 proline rich transmembrane protein 2 2 2
MIRT493015 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT499425 PLCG2 phospholipase C gamma 2 2 11
MIRT506956 HOXB3 homeobox B3 2 4
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508101 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT522215 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT530327 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531042 ZNF502 zinc finger protein 502 2 2
MIRT532580 GSS glutathione synthetase 2 2
MIRT534841 RAB15 RAB15, member RAS oncogene family 2 2
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT538303 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT546344 TFAP2C transcription factor AP-2 gamma 2 2
MIRT546704 RORA RAR related orphan receptor A 2 4
MIRT549222 BCL2L11 BCL2 like 11 2 4
MIRT549623 TMEM101 transmembrane protein 101 2 2
MIRT549931 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550163 ZNF223 zinc finger protein 223 2 4
MIRT550555 ARSK arylsulfatase family member K 2 2
MIRT553402 TRIM2 tripartite motif containing 2 2 4
MIRT554084 SNX4 sorting nexin 4 2 4
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT558525 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT558565 CRLF3 cytokine receptor like factor 3 2 4
MIRT560946 TPM4 tropomyosin 4 2 4
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT562174 HOXA13 homeobox A13 2 2
MIRT568635 ACVR2A activin A receptor type 2A 2 2
MIRT574908 Plcg2 phospholipase C, gamma 2 2 7
MIRT575177 Atg9a autophagy related 9A 2 2
MIRT611972 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT635830 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 4
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 4
MIRT643205 JAK3 Janus kinase 3 2 2
MIRT650232 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT655940 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT662021 ZNF445 zinc finger protein 445 2 2
MIRT662037 FUT2 fucosyltransferase 2 2 2
MIRT666873 POU2F2 POU class 2 homeobox 2 2 2
MIRT684310 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT687333 OSMR oncostatin M receptor 2 2
MIRT689008 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT695137 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695154 PRY PTPN13-like, Y-linked 2 2
MIRT700695 POLR3D RNA polymerase III subunit D 2 2
MIRT703269 GNL3L G protein nucleolar 3 like 2 2
MIRT708941 CRY2 cryptochrome circadian clock 2 2 2
MIRT709200 SAPCD2 suppressor APC domain containing 2 2 2
MIRT709572 PDE4A phosphodiesterase 4A 2 2
MIRT711295 PSME3 proteasome activator subunit 3 2 2
MIRT712425 MACROD2 MACRO domain containing 2 2 2
MIRT713941 PIGR polymeric immunoglobulin receptor 2 2
MIRT714124 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714630 KIAA1143 KIAA1143 2 2
MIRT724046 SMIM14 small integral membrane protein 14 2 2
MIRT724649 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725476 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-504 Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-504 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-504 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-504-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-504-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-504-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-504-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-504-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-504-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission