miRTarBase - #MIRT041082


—
pre-miRNA Information
pre-miRNA hsa-mir-504   
Genomic Coordinates chrX: 138667711 - 138667793
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1297440872 6 dbSNP
rs1429220261 12 dbSNP
rs745623382 14 dbSNP
rs770027520 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM208B   
Synonyms C10orf18, bA318E3.2
Description family with sequence similarity 208 member B
Transcript NM_017782   
Expression
Putative miRNA Targets on FAM208B
3'UTR of FAM208B
(miRNA target sites are highlighted)		 
>FAM208B|NM_017782|3'UTR
   1 CTCAACTACAGCCTGCCTGGATATGGATGATGCCAATAAAAAATTAGTATTTTCCCTTTGGAAAACTTGTGAACATGTGA
  81 ATACACATGTGAACAGTCTTACATTTGAAAAACCAATGTTCTACAACTTGGAAAGTTTTCATTTTTTATATTTTGCTGAA
 161 ATATGTCACAGTGGCATTGCAGTTGTCTGTTAGCTTTGGGTTGCAGTGCTAGATATTGTTTTAAATTATTTTCATTTTAA
 241 ACAAGATGCCTTCTAAGCTATTGAGCTTATTAAAAATAATTTTACATGTTTACTTAGTTGGAGCAAAAATAAGTCTATTT
 321 TAACAAATAGCTTTGTTTTTGCATGCTAATGTCAGAAAGGCATACGATGCACATTATGCTCTGTTTTAAAGGTTTTACCA
 401 CCCTTGTAAAAACTATAATCTTAAATGGTTTTATTTGCTGTTACACAAACAACACTACATAAAACATTTTTTCCTAAATG
 481 GTACAAATTTATAAACTATCATTTTTCACTTACGGTATTTGTAAATACTACACTACAAAAATCAGCTTTCTGAGAAAGAA
 561 ATAATCATTTATTTATGATATTGAAAATTTCTACAGTAAACACTCAAAACCAAGCAAAAAACATTTGTAAGATACACGGT
 641 ATCTATTTGGAGCAACGGTTTTTGTAACTAATGTGTTTCATTTTTTAAATAAAGACAACTAAAAATAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuaucucACG-UCUG-GUCCCAga 5'
                 ||: |||: || |||  
Target 5' aaacattTGTAAGATACACGGTat 3'
 619 - 642 99.00 -5.90
2 
miRNA  3' cuaUCUCA-CGUCUGGUC-CCAGa 5'
             | ||| |||   |||  ||| 
Target 5' gtcACAGTGGCATTGCAGTTGTCt 3'
 165 - 188 91.00 -8.20
3 
miRNA  3' cuAUCUCACGUCUGGUCCCAGa 5'
            || : |||| |::| | || 
Target 5' caTACGATGCACATTATGCTCt 3'
 361 - 382 88.00 -5.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30458083 26 COSMIC
COSN1120473 27 COSMIC
COSN31573228 52 COSMIC
COSN31586453 68 COSMIC
COSN20106828 95 COSMIC
COSN30152014 108 COSMIC
COSN28846832 121 COSMIC
COSN30138198 203 COSMIC
COSN16323588 210 COSMIC
COSN31562435 217 COSMIC
COSN26925496 318 COSMIC
COSN20106830 382 COSMIC
COSN23755531 421 COSMIC
COSN30212550 465 COSMIC
COSN5878418 493 COSMIC
COSN5878419 580 COSMIC
COSN21678883 647 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772529151 2 dbSNP
rs773732502 4 dbSNP
rs1268528729 5 dbSNP
rs1321367754 7 dbSNP
rs760680316 10 dbSNP
rs551904436 16 dbSNP
rs776702262 17 dbSNP
rs759850747 20 dbSNP
rs764906769 21 dbSNP
rs767009889 26 dbSNP
rs752494232 29 dbSNP
rs1209847528 33 dbSNP
rs1262411274 35 dbSNP
rs1351375912 35 dbSNP
rs764236290 36 dbSNP
rs1364759290 37 dbSNP
rs781563976 38 dbSNP
rs1042753250 39 dbSNP
rs764062044 40 dbSNP
rs746191214 46 dbSNP
rs769380984 48 dbSNP
rs925596380 49 dbSNP
rs1315822069 50 dbSNP
rs751550916 50 dbSNP
rs756827035 53 dbSNP
rs1420815777 54 dbSNP
rs549179442 57 dbSNP
rs567380046 62 dbSNP
rs1312698028 72 dbSNP
rs1400976612 73 dbSNP
rs537958809 73 dbSNP
rs762903896 76 dbSNP
rs550298347 78 dbSNP
rs1039234466 84 dbSNP
rs900680534 89 dbSNP
rs997604577 92 dbSNP
rs139115917 93 dbSNP
rs79427500 93 dbSNP
rs374489641 96 dbSNP
rs1474370616 98 dbSNP
rs1358903981 104 dbSNP
rs1052363122 123 dbSNP
rs942071125 125 dbSNP
rs1447363527 127 dbSNP
rs183243244 133 dbSNP
rs1485475769 136 dbSNP
rs576772470 137 dbSNP
rs996716316 138 dbSNP
rs1332295873 142 dbSNP
rs189098323 142 dbSNP
rs1029991320 143 dbSNP
rs1005366322 148 dbSNP
rs74861203 149 dbSNP
rs899141876 162 dbSNP
rs1316613064 163 dbSNP
rs371421725 164 dbSNP
rs573197875 165 dbSNP
rs1020538294 167 dbSNP
rs1459931127 169 dbSNP
rs776053816 175 dbSNP
rs1417498057 178 dbSNP
rs1171662901 179 dbSNP
rs1222624779 184 dbSNP
rs1293431979 186 dbSNP
rs1427890581 189 dbSNP
rs1444971214 190 dbSNP
rs1253526644 192 dbSNP
rs1001455740 201 dbSNP
rs1034235100 202 dbSNP
rs1466752334 205 dbSNP
rs374720345 212 dbSNP
rs992713175 213 dbSNP
rs1340983832 217 dbSNP
rs533940953 219 dbSNP
rs1476664907 226 dbSNP
rs1020517891 250 dbSNP
rs992375343 254 dbSNP
rs1385169181 259 dbSNP
rs1445275531 262 dbSNP
rs1439260266 266 dbSNP
rs1393850681 278 dbSNP
rs376381017 279 dbSNP
rs1411900651 289 dbSNP
rs766857811 289 dbSNP
rs1378678213 290 dbSNP
rs1165994484 294 dbSNP
rs1400387207 295 dbSNP
rs1461288934 297 dbSNP
rs1195434192 306 dbSNP
rs1395382304 306 dbSNP
rs1452441634 310 dbSNP
rs1251870618 312 dbSNP
rs1181863926 314 dbSNP
rs967182727 317 dbSNP
rs978888187 318 dbSNP
rs1270427867 327 dbSNP
rs369379635 327 dbSNP
rs1317369448 328 dbSNP
rs1195656529 329 dbSNP
rs1349055651 336 dbSNP
rs1282843563 341 dbSNP
rs1232769214 350 dbSNP
rs1345629650 351 dbSNP
rs1370861052 354 dbSNP
rs925637154 366 dbSNP
rs373312949 367 dbSNP
rs1381972717 368 dbSNP
rs1444440235 369 dbSNP
rs977527036 370 dbSNP
rs1334265125 371 dbSNP
rs1288395104 373 dbSNP
rs35002405 379 dbSNP
rs397786460 379 dbSNP
rs1358808270 382 dbSNP
rs974971488 385 dbSNP
rs922229053 388 dbSNP
rs1394380561 393 dbSNP
rs933552175 393 dbSNP
rs1051969961 398 dbSNP
rs1039119537 405 dbSNP
rs886580685 409 dbSNP
rs573928386 410 dbSNP
rs932469023 414 dbSNP
rs1180665127 415 dbSNP
rs1485767377 418 dbSNP
rs1284531489 420 dbSNP
rs1260093656 425 dbSNP
rs1209143483 426 dbSNP
rs749550536 440 dbSNP
rs1202209929 445 dbSNP
rs1243023375 448 dbSNP
rs1348643955 455 dbSNP
rs193033794 463 dbSNP
rs1050913454 465 dbSNP
rs1357572835 466 dbSNP
rs899174481 468 dbSNP
rs1185465510 477 dbSNP
rs1318897514 481 dbSNP
rs1402316268 489 dbSNP
rs1009414827 497 dbSNP
rs1469807847 498 dbSNP
rs1475356267 502 dbSNP
rs1419546731 512 dbSNP
rs1186327504 513 dbSNP
rs1485548876 514 dbSNP
rs1283696880 515 dbSNP
rs144339710 515 dbSNP
rs1233953531 517 dbSNP
rs1034347901 520 dbSNP
rs148627492 531 dbSNP
rs1033842763 534 dbSNP
rs1378192256 545 dbSNP
rs1174055838 546 dbSNP
rs1432845234 547 dbSNP
rs1343331731 549 dbSNP
rs959184649 552 dbSNP
rs1405222142 553 dbSNP
rs1396312562 559 dbSNP
rs1453368589 559 dbSNP
rs779464717 560 dbSNP
rs1025120047 563 dbSNP
rs530849752 563 dbSNP
rs1333414960 564 dbSNP
rs1440839238 565 dbSNP
rs769086500 567 dbSNP
rs950876277 567 dbSNP
rs577541863 568 dbSNP
rs1352429057 570 dbSNP
rs1222046132 571 dbSNP
rs1262957569 574 dbSNP
rs1324884709 575 dbSNP
rs545008029 579 dbSNP
rs1206189003 580 dbSNP
rs560377958 582 dbSNP
rs1213329037 584 dbSNP
rs963371403 588 dbSNP
rs1437246002 590 dbSNP
rs1296075807 591 dbSNP
rs375957202 592 dbSNP
rs183876354 595 dbSNP
rs186719454 597 dbSNP
rs1441468015 601 dbSNP
rs1372564554 603 dbSNP
rs1323258776 621 dbSNP
rs1457126698 624 dbSNP
rs201605887 628 dbSNP
rs1173060483 638 dbSNP
rs933381013 639 dbSNP
rs1389865001 640 dbSNP
rs1455928431 644 dbSNP
rs1251252828 646 dbSNP
rs561145274 657 dbSNP
rs1481110849 658 dbSNP
rs879260105 664 dbSNP
rs1197007696 669 dbSNP
rs1305559400 682 dbSNP
rs1273584453 687 dbSNP
rs747064639 694 dbSNP
rs912368251 701 dbSNP
rs755657602 703 dbSNP
rs1385719446 708 dbSNP
rs1373693783 709 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuaUCUCACGUCUGGUCccaga 5'
             |||| | ||:||||     
Target 5' ctaAGAG-GAAGGCCAGcatgc 3'
 		20 - 40
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.655 0.01 0.719 0 14 Click to see details
ESCA -0.955 0.01 -0.700 0.09 5 Click to see details
THCA 0.254 0.04 0.222 0.06 49 Click to see details
COAD 0.83 0.04 0.700 0.09 5 Click to see details
PAAD 0.909 0.05 0.400 0.3 4 Click to see details
KIRC 0.15 0.15 0.074 0.3 51 Click to see details
KICH -0.139 0.25 -0.172 0.21 25 Click to see details
LIHC -0.099 0.26 -0.157 0.16 43 Click to see details
UCEC 0.176 0.27 0.189 0.25 15 Click to see details
LUAD 0.18 0.3 0.018 0.48 11 Click to see details
BRCA -0.062 0.31 -0.056 0.33 65 Click to see details
CHOL 0.161 0.37 0.107 0.41 7 Click to see details
STAD -0.048 0.41 -0.011 0.48 24 Click to see details
LUSC -0.024 0.45 0.028 0.44 29 Click to see details
HNSC -0.023 0.45 -0.020 0.46 28 Click to see details
KIRP 0.018 0.46 -0.041 0.42 28 Click to see details
PRAD 0.006 0.48 0.075 0.3 50 Click to see details
PRAD 0.006 0.48 0.075 0.3 50 Click to see details
PRAD 0.006 0.48 0.075 0.3 50 Click to see details
PRAD 0.006 0.48 0.075 0.3 50 Click to see details
PRAD 0.006 0.48 0.075 0.3 50 Click to see details
101 hsa-miR-504-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT016251 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT016252 FAS Fas cell surface death receptor 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A like 1 2 1
MIRT016256 MDM2 MDM2 proto-oncogene 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1 H2A family member c 1 1
MIRT041076 FEM1A fem-1 homolog A 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208 member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L mitochondrial elongation factor 1 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domain containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b subunit 1 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT448052 SFRP1 secreted frizzled related protein 1 2 2
MIRT457649 ZNF69 zinc finger protein 69 2 2
MIRT458626 TRIM72 tripartite motif containing 72 2 2
MIRT466176 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT472583 NACC1 nucleus accumbens associated 1 2 2
MIRT473576 MAT2A methionine adenosyltransferase 2A 2 6
MIRT485155 RASL10B RAS like family 10 member B 2 2
MIRT490063 PRRT2 proline rich transmembrane protein 2 2 2
MIRT493015 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT499425 PLCG2 phospholipase C gamma 2 2 11
MIRT506956 HOXB3 homeobox B3 2 4
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508101 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT522215 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT530327 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531042 ZNF502 zinc finger protein 502 2 2
MIRT532580 GSS glutathione synthetase 2 2
MIRT534841 RAB15 RAB15, member RAS oncogene family 2 2
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT538303 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT546344 TFAP2C transcription factor AP-2 gamma 2 2
MIRT546704 RORA RAR related orphan receptor A 2 4
MIRT549222 BCL2L11 BCL2 like 11 2 4
MIRT549623 TMEM101 transmembrane protein 101 2 2
MIRT549931 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550163 ZNF223 zinc finger protein 223 2 4
MIRT550555 ARSK arylsulfatase family member K 2 2
MIRT553402 TRIM2 tripartite motif containing 2 2 4
MIRT554084 SNX4 sorting nexin 4 2 4
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT558525 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT558565 CRLF3 cytokine receptor like factor 3 2 4
MIRT560946 TPM4 tropomyosin 4 2 4
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT562174 HOXA13 homeobox A13 2 2
MIRT568635 ACVR2A activin A receptor type 2A 2 2
MIRT574908 Plcg2 phospholipase C, gamma 2 2 7
MIRT575177 Atg9a autophagy related 9A 2 2
MIRT611972 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT635830 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 4
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 4
MIRT643205 JAK3 Janus kinase 3 2 2
MIRT650232 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT655940 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT662021 ZNF445 zinc finger protein 445 2 2
MIRT662037 FUT2 fucosyltransferase 2 2 2
MIRT666873 POU2F2 POU class 2 homeobox 2 2 2
MIRT684310 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT687333 OSMR oncostatin M receptor 2 2
MIRT689008 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT695137 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695154 PRY PTPN13-like, Y-linked 2 2
MIRT700695 POLR3D RNA polymerase III subunit D 2 2
MIRT703269 GNL3L G protein nucleolar 3 like 2 2
MIRT708941 CRY2 cryptochrome circadian clock 2 2 2
MIRT709200 SAPCD2 suppressor APC domain containing 2 2 2
MIRT709572 PDE4A phosphodiesterase 4A 2 2
MIRT711295 PSME3 proteasome activator subunit 3 2 2
MIRT712425 MACROD2 MACRO domain containing 2 2 2
MIRT713941 PIGR polymeric immunoglobulin receptor 2 2
MIRT714124 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714630 KIAA1143 KIAA1143 2 2
MIRT724046 SMIM14 small integral membrane protein 14 2 2
MIRT724649 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725476 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-504 Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-504 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-504 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-504-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-504-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-504-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-504-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-504-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-504-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission