miRTarBase - #MIRT041090


—
pre-miRNA Information
pre-miRNA hsa-mir-504   
Genomic Coordinates chrX: 138667711 - 138667793
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1297440872 6 dbSNP
rs1429220261 12 dbSNP
rs745623382 14 dbSNP
rs770027520 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMCR7L
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuaUC-UCACGUCUGGUCCCaga 5'
             || |||||||| :||||   
Target 5' --cAGAAGTGCAGAGTAGGGaac 3'
 		1 - 21
2 
miRNA  3' cuaUCUC-ACGUCUGGUCCCAGA- 5'
             |||| ||  | : |||| || 
Target 5' accAGAGCTG--GTTAAGGGCCTA 3'
 		20 - 41
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.404 0.01 0.280 0.07 29 Click to see details
BLCA 0.469 0.05 0.297 0.15 14 Click to see details
BRCA 0.183 0.07 0.233 0.03 65 Click to see details
PAAD 0.845 0.08 0.800 0.1 4 Click to see details
LIHC -0.219 0.08 -0.149 0.17 43 Click to see details
KIRP -0.248 0.1 -0.268 0.08 28 Click to see details
UCEC 0.346 0.1 0.407 0.07 15 Click to see details
HNSC -0.178 0.18 -0.213 0.14 28 Click to see details
KICH -0.163 0.22 -0.262 0.1 25 Click to see details
LUAD -0.238 0.24 -0.100 0.38 11 Click to see details
CHOL 0.156 0.37 0.393 0.19 7 Click to see details
ESCA -0.138 0.41 0.200 0.37 5 Click to see details
THCA 0.025 0.43 -0.105 0.24 49 Click to see details
KIRC 0.021 0.44 0.004 0.49 51 Click to see details
COAD 0.077 0.45 -0.200 0.37 5 Click to see details
STAD -0.017 0.47 0.022 0.46 24 Click to see details
PRAD 0.005 0.49 -0.010 0.47 50 Click to see details
PRAD 0.005 0.49 -0.010 0.47 50 Click to see details
PRAD 0.005 0.49 -0.010 0.47 50 Click to see details
PRAD 0.005 0.49 -0.010 0.47 50 Click to see details
PRAD 0.005 0.49 -0.010 0.47 50 Click to see details
101 hsa-miR-504-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT016251 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT016252 FAS Fas cell surface death receptor 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A like 1 2 1
MIRT016256 MDM2 MDM2 proto-oncogene 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1 H2A family member c 1 1
MIRT041076 FEM1A fem-1 homolog A 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208 member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L mitochondrial elongation factor 1 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domain containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b subunit 1 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT448052 SFRP1 secreted frizzled related protein 1 2 2
MIRT457649 ZNF69 zinc finger protein 69 2 2
MIRT458626 TRIM72 tripartite motif containing 72 2 2
MIRT466176 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT472583 NACC1 nucleus accumbens associated 1 2 2
MIRT473576 MAT2A methionine adenosyltransferase 2A 2 6
MIRT485155 RASL10B RAS like family 10 member B 2 2
MIRT490063 PRRT2 proline rich transmembrane protein 2 2 2
MIRT493015 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT499425 PLCG2 phospholipase C gamma 2 2 11
MIRT506956 HOXB3 homeobox B3 2 4
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508101 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT522215 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT530327 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531042 ZNF502 zinc finger protein 502 2 2
MIRT532580 GSS glutathione synthetase 2 2
MIRT534841 RAB15 RAB15, member RAS oncogene family 2 2
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT538303 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT546344 TFAP2C transcription factor AP-2 gamma 2 2
MIRT546704 RORA RAR related orphan receptor A 2 4
MIRT549222 BCL2L11 BCL2 like 11 2 4
MIRT549623 TMEM101 transmembrane protein 101 2 2
MIRT549931 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550163 ZNF223 zinc finger protein 223 2 4
MIRT550555 ARSK arylsulfatase family member K 2 2
MIRT553402 TRIM2 tripartite motif containing 2 2 4
MIRT554084 SNX4 sorting nexin 4 2 4
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT558525 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT558565 CRLF3 cytokine receptor like factor 3 2 4
MIRT560946 TPM4 tropomyosin 4 2 4
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT562174 HOXA13 homeobox A13 2 2
MIRT568635 ACVR2A activin A receptor type 2A 2 2
MIRT574908 Plcg2 phospholipase C, gamma 2 2 7
MIRT575177 Atg9a autophagy related 9A 2 2
MIRT611972 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT635830 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 4
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 4
MIRT643205 JAK3 Janus kinase 3 2 2
MIRT650232 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT655940 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT662021 ZNF445 zinc finger protein 445 2 2
MIRT662037 FUT2 fucosyltransferase 2 2 2
MIRT666873 POU2F2 POU class 2 homeobox 2 2 2
MIRT684310 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT687333 OSMR oncostatin M receptor 2 2
MIRT689008 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT695137 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695154 PRY PTPN13-like, Y-linked 2 2
MIRT700695 POLR3D RNA polymerase III subunit D 2 2
MIRT703269 GNL3L G protein nucleolar 3 like 2 2
MIRT708941 CRY2 cryptochrome circadian clock 2 2 2
MIRT709200 SAPCD2 suppressor APC domain containing 2 2 2
MIRT709572 PDE4A phosphodiesterase 4A 2 2
MIRT711295 PSME3 proteasome activator subunit 3 2 2
MIRT712425 MACROD2 MACRO domain containing 2 2 2
MIRT713941 PIGR polymeric immunoglobulin receptor 2 2
MIRT714124 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714630 KIAA1143 KIAA1143 2 2
MIRT724046 SMIM14 small integral membrane protein 14 2 2
MIRT724649 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725476 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-504 Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-504 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-504 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-504-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-504-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-504-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-504-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-504-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-504-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission