miRTarBase - #MIRT043675


—
pre-miRNA Information
pre-miRNA hsa-mir-342   
Genomic Coordinates chr14: 100109655 - 100109753
Synonyms MIRN342, hsa-mir-342, MIR342
Description Homo sapiens miR-342 stem-loop
Comment This sequence was predicted by homology to a rat miRNA .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-342-3p
Sequence 61| UCUCACACAGAAAUCGCACCCGU |83
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
C-to-U 17 14 + 100109731 26209130, 28550310 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30534923 3 COSMIC
COSN31541843 8 COSMIC
COSN30539229 10 COSMIC
COSN31505541 10 COSMIC
COSN1080961 15 COSMIC
COSN1080960 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751380399 1 dbSNP
rs902260466 4 dbSNP
rs560521928 8 dbSNP
rs757207115 12 dbSNP
rs1253187345 15 dbSNP
rs1450379061 16 dbSNP
rs562656621 19 dbSNP
rs375982953 20 dbSNP
rs368305313 21 dbSNP
rs779049179 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATXN7   
Synonyms ADCAII, OPCA3, SCA7
Description ataxin 7
Transcript NM_000333   
Other Transcripts NM_001128149 , NM_001177387   
Expression
Putative miRNA Targets on ATXN7
3'UTR of ATXN7
(miRNA target sites are highlighted)		 
>ATXN7|NM_000333|3'UTR
   1 CAGCTGAAAATAGCACGGGGAGGAATAATGCGGACACTTTTGAGGACAAGTTACACCTCCACTCAGCACTCTGGACTCCA
  81 CGATGCCTTTGAGTCTGTTTTCCCAACCTCCTGTGGGCCTCAAGGGTAGAAACCTGCCGGGCTGTTGTTTTAACGAGGAT
 161 TTCCCTGAAGCTATGTCTCTAGCAGTGAGTACTCATAAAGGACACTGGATCAAGTTCAGCCACCGAATTGCTTTTATCAG
 241 TGTTAAAGTGGTCTGAACTGCTTGCTACCAATCTGTGAGAAGTTTTTGTTTTTGTTTTGTTTTTTAACTTGCAGTATATC
 321 ACAGAGCCACTCTTCAAGTAGATTGGCTGGGCAAAAGAATGTTTTGGCAAGAGCGTTACTGTAGACCTTTCTCCCTCCTT
 401 CCTTTTACTACCATTTTTTTTTAACACTGTCATCTGTAGGTCACTCTCCAGCAGTTAGGCACCTTAACTGGAGACCAGAA
 481 ACCTTCCAGAGAACACAGGGCTGCATCCCGAGCAACCCTCTGAAGAAGGGAATTAGGCTTTAGATTTTGATAGCAATGTT
 561 CCAGGAATGAAATATAGATGTTAGCCCAAGACACCATGACAAAATAGCCCAGCCTTTTGAGAGTAATTTGGGAAAAGAAG
 641 CTGTCAGAAGTTTCTAACTTACAAACTGGTTTGAAATTTTTGATGCCCAGACAGCAAGTATAAATCATTTTGGAGGCTTA
 721 CTTTTCATGATACAAAAGCAATTCTGTGTGATTTTTTTTTTTAAGAAGAAAGAAAATGCAAGCTAGTTTTGAGAAAGGAA
 801 GGCCAAATTGGGTCGGGGGAGGGTGGGAGTGAGGAAGTTAAAATCACTATAGGGAGAAAAAACTTTTTTCAAGATTTCCA
 881 AAGAGATGAAATTTTCTTAATCCTTTTAAGTTTTCATAGTAAACAGTATGGCAGATTGGGTTGGTTGTCCTACCTGGTCT
 961 ATTTTTAAAAGTCACCTTTTAAAGTGACATTATTAGATACACTTAAATGTTTCCAAGGCACTCTCTACATTACCCTTGTT
1041 TTTCTCTTTGGATACTGTCCTGGGACTAAGTGTAGATTTCTGCTTCAAGCACTTCTGGCATTGTGTGTTTTTGTATGCAC
1121 TCCCCTTCATGCCACTTCAGATGTTTATTTGGATGTGGTTGGGGACGAGAGCAGACACCAAGGAAAGGGAGTTGGAGAGA
1201 ATGTAAGTCCTGACCTGAAGGTCTTTTGTGATGCATGTATAGGATTGCCCTGACACACACCCTCCTTTCTTGGGATTATA
1281 CCAGCCATCTTCCTGAGAGTTTTGGAGCCCTCTAGGATATTTTTTCTAGTACCCCACCCCCCACCCCTAAAGAAAGACCT
1361 TAATATGTTAAAACAGCATTGCTTGGAGAAGGTGTCATTGAATTCCGGGACGAGCCGGAGCCTTTAAATGGGTGCTTCCA
1441 CCACTACAGGCTCCTGACACGAGTAACAGGCACTGTTGCTTAGAAGAACACACGAAGTTGCCGAACACAGGGTAAAATTT
1521 CCAAGGCGCTGATCGTTGCCCTGGCCAGGGCCTGATGAGAGCCAGTCAGTACATTCTTTTTTTCCTACAGTTCTTGGGTT
1601 TCAAACTTCAGTTTCAGGGAATTTCAAGTCAACAACAGGTAGAATGAATAAACTTGGTTACCAGCCTAATAATGTGAATT
1681 GCTACAGAATTATTCTTATTATGTAAGAAAACAAAAACTTTATGCAGATACTTTAGCTATAAATTGATGTAAAATACTGA
1761 TTTTTTTAAAGGAAGGAGAGAACAGTATCTTGTTCAATTATTATGCAATCAATCAGTAAATGTTTTTAAAATGATACTAC
1841 AGGAGAGCTTAGTAAGGAGAGGGCATGGATGGGCCAGTTTGGCATAGTTGGGAGAAATCAGTCTGGTTTCCATCCCAGTC
1921 GGGGAAGAGAGAGGTGAGAGGGAATCAGAACGTACCTAGTTGATTCCTTGGTGACAAGTGCAATGGGGTATGGGTAGAAT
2001 TTATTTTCAGAGCCAAGAGGACTTGATGGTTATAAATAAAGTTGCCTTTAGCAATGGAATTTACAGATCGATCATGTTGT
2081 TCCGAAAGATGTGAATAGGATCCACAATAACAAGTTGATTCAGACTAATGTAGATATTTAGATTAGCAAGTATTGAACAT
2161 TTGATTTCTTAGACTGAGGTTTTAAATGAATTTCATTATTTCTCCCGGTAATACACAGAGCATCGGGATTAGGAAATTAG
2241 CCATTTTGGATTCTGTCTGCCACAAACAGACCTATTCTAAACAGTGCTATTAAATTTTAGACTGTTGTTCAAATATTTTA
2321 TTTTCTCCTAAACTACTTTTTATGGTGATGAATAATTAAGACCATTTAAAACACGGGAGTACAAGTATTTTTTTGAATTA
2401 AATTAACTTGCAAAAACCAAATTTGCAGTGGTTGGGTTGTTTCTAGACAGACTTTGGTATCAATTTAAAACCAAGATAAT
2481 TTTTATATTCTTTCCAATAGAATTTCATGACAACTCCTGCAGTTTTCTTAACCTACAAAAAAAAAAAAAAAGTGCTGCAA
2561 TGATGAACAAAGAATTATACAAAACCTACTTTTGTATCTTTATTTTGGAATTTCTTGTTCTATTATAAATATGGAAGTAT
2641 CCCTATTTCAGAAGACATATTTTGTTAAAAATGAATTGTACATATTTAAATATGTATTTTTGCACAGGTCTTTTTTTCTG
2721 ATATCCTGTTTTGGTACAATTGAGATCATCTAGTATTTATTTATTAATTAATAAAAGTAAATACCTTTTTATAATTTGAA
2801 GTGGTTCACTGCCAAGCCAATAGTTCTAGAACCTGCCTCCTTTACAGTTTTAAGGGATGCCTCTGTTCTGTGAAAAGTCT
2881 TTGTCCCTTTTAGTGTCTCGGGAGTGGATTCATACAGATGAAGTGGGCATTGCTTCTTCCTGGTTGCCTGGTTTCCCGAT
2961 AGACTACATGTAACTAAGTGACACACTGCTTTTCTTTTGTTAGTATTTTATGTGTGGGAGTATGTGACTGCGTGTGTGTG
3041 TGCCTGTGCGTGTGTGTGTATACTCAGCACATGTATGTTACTATGTGATGTGGTTTAAAACTAATGGAAAAAACTGAAAG
3121 TGCCTGAAACTAGTTTTAAGCTTAGACAGAATCTCTTTAAAAAGACTTGAATGTTCAGTTGAACTTTTGGAGTTTGCTTT
3201 TTCCACCTAAATATTGTTTCTAAAATTTTAGGGGCGGAGTTGAAAACCACCAATGCTGGTAATTTTATAAGGTATTTTAA
3281 AATTAAGACCTCTTGGTTCATAGTAATTCAATTGGTGATGGATTGCCTGGTGGCACCAAGGGTTACAGATCTTTTTGTCA
3361 GCCAGCAACTTACACGATGTGTCCGTTTTGTTATTCACTCATGAAATACAATTTAAAATATTTAAAATATTTTGTATTCC
3441 AAAAATATAATACAAAGAAGTACCTCTGAGAACATTGAAAAAAATGTATAATTTGAAAAATGTAACTTATAAGGGCAGCT
3521 GTCTTCCTGCAAGAGTTCTGTTGCCAAGGAATTTCTTAATGTCGCTCATTCTGTCCAGGGGGTTTGGGGCGATTGGGCTT
3601 TGAAAAAATATTCTTAAAAGTTTGTTTAGCAGAAAATAATCACTTTTACATTTTGTGCAAAACATTTTACATTTTCAGAT
3681 AATTTAAATGAGCACTACATACTGTCAGTGTGAATGTAGGGCCTTGAAAGCATTTTGCTTTTTTTTTTTTTTTTTTTTTT
3761 TTGAGCTTGGTTATAAAAGCAATCTCCTGTGTTAAAAACGTGTGAATAGTTTGATAATTTGTACACATAATCAAGAGCAT
3841 CTCAGCTGGACTTTGTGTTGGCTGCTGTATAGAACATGAACAAATGTCAAGGGATAGAAAATTACTTTGGATATTTAAAA
3921 GAGAAGAAATATATAGTCTATTTGTTTTGTAACAAGTTTCTGTAAATAAAATAATTTATACTATTTATAAGAAAAAAAAA
4001 AAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcccaCGCUAAAGACACACUcu 5'
                || | ||||||||||  
Target 5' acaaaaGC-AATTCTGTGTGAtt 3'
 732 - 753 144.00 -12.70
2 
miRNA  3' ugccCACGC-UAAAG-ACACACUCu 5'
              ||  | ||||: ||||||:| 
Target 5' ttttGTTAGTATTTTATGTGTGGGa 3'
 2995 - 3019 143.00 -13.10
3 
miRNA  3' ugcccacgcuAAAGACACACUcu 5'
                    | || ||||||  
Target 5' cactacatacTGTCAGTGTGAat 3'
 3693 - 3715 129.00 -7.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
599471 15 ClinVar
809503 32 ClinVar
COSM1425063 4 COSMIC
COSM308357 15 COSMIC
COSM3380679 17 COSMIC
COSM8625185 17 COSMIC
COSM6586445 30 COSMIC
COSM1184237 80 COSMIC
COSM8640503 92 COSMIC
COSN19673960 97 COSMIC
COSN31590359 138 COSMIC
COSN19766042 178 COSMIC
COSN29543736 808 COSMIC
COSN23117452 815 COSMIC
COSN26505039 816 COSMIC
COSN31486969 857 COSMIC
COSN31962083 874 COSMIC
COSN31480592 879 COSMIC
COSN30159577 923 COSMIC
COSN19058996 970 COSMIC
COSN31590803 1024 COSMIC
COSN31521657 1056 COSMIC
COSN18946125 1170 COSMIC
COSN229039 1372 COSMIC
COSN15902211 1697 COSMIC
COSN1956980 2120 COSMIC
COSN23050204 2125 COSMIC
COSN6574929 2317 COSMIC
COSN7704187 2331 COSMIC
COSN31563002 2522 COSMIC
COSN28930142 2552 COSMIC
COSN26549140 2595 COSMIC
COSN26639929 2634 COSMIC
COSN31482273 2751 COSMIC
COSN31538699 2958 COSMIC
COSN20090831 2970 COSMIC
COSN25295651 3698 COSMIC
COSN28201029 3752 COSMIC
COSN9557260 3815 COSMIC
COSN25291680 3918 COSMIC
COSN25294534 3920 COSMIC
COSN25291681 3923 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751048443 10 dbSNP
rs1275131150 13 dbSNP
rs180696871 15 dbSNP
rs1273743537 16 dbSNP
rs1211731978 17 dbSNP
rs1389085494 17 dbSNP
rs780787335 18 dbSNP
rs745466231 19 dbSNP
rs769503307 23 dbSNP
rs1278979431 26 dbSNP
rs780212405 30 dbSNP
rs749733097 31 dbSNP
rs769269406 32 dbSNP
rs748272621 33 dbSNP
rs1473967548 34 dbSNP
rs761951339 37 dbSNP
rs772003452 41 dbSNP
rs1463807995 54 dbSNP
rs933924549 57 dbSNP
rs773364173 60 dbSNP
rs1395958753 65 dbSNP
rs756509918 69 dbSNP
rs778802006 71 dbSNP
rs1295413471 73 dbSNP
rs1307940358 78 dbSNP
rs1353623947 79 dbSNP
rs1232796857 80 dbSNP
rs760750156 82 dbSNP
rs752476125 83 dbSNP
rs762787169 85 dbSNP
rs904090659 86 dbSNP
rs201478726 87 dbSNP
rs751461369 90 dbSNP
rs748109169 92 dbSNP
rs943434782 92 dbSNP
rs899286796 93 dbSNP
rs994959421 94 dbSNP
rs757243736 107 dbSNP
rs780514689 108 dbSNP
rs1209105595 109 dbSNP
rs1186630483 111 dbSNP
rs1420776107 117 dbSNP
rs1430815524 118 dbSNP
rs749950312 119 dbSNP
rs753946408 120 dbSNP
rs755713008 120 dbSNP
rs1372854442 123 dbSNP
rs779908613 125 dbSNP
rs749645247 127 dbSNP
rs1003807539 132 dbSNP
rs769181398 134 dbSNP
rs1303822720 135 dbSNP
rs1031690166 137 dbSNP
rs1357659798 139 dbSNP
rs762254732 139 dbSNP
rs779450176 139 dbSNP
rs528224210 140 dbSNP
rs1156922209 142 dbSNP
rs765791311 143 dbSNP
rs546603553 155 dbSNP
rs771725606 156 dbSNP
rs1014179976 158 dbSNP
rs1482144403 159 dbSNP
rs1420592666 165 dbSNP
rs184480137 166 dbSNP
rs77203794 174 dbSNP
rs879571540 178 dbSNP
rs73834169 182 dbSNP
rs1246300242 191 dbSNP
rs1324035235 193 dbSNP
rs1313992445 201 dbSNP
rs1370367295 206 dbSNP
rs1026973650 214 dbSNP
rs1385554179 215 dbSNP
rs1436063498 215 dbSNP
rs1318660730 225 dbSNP
rs1459453470 226 dbSNP
rs952731553 232 dbSNP
rs867814278 233 dbSNP
rs1391760189 236 dbSNP
rs911155795 237 dbSNP
rs189447000 239 dbSNP
rs982680059 248 dbSNP
rs943362652 254 dbSNP
rs908460595 259 dbSNP
rs879053579 264 dbSNP
rs1245748853 272 dbSNP
rs537239991 274 dbSNP
rs965232187 276 dbSNP
rs1211127243 282 dbSNP
rs1266617565 284 dbSNP
rs1488514368 284 dbSNP
rs1240476647 285 dbSNP
rs557741706 290 dbSNP
rs1300296229 292 dbSNP
rs1351308505 293 dbSNP
rs1215649900 295 dbSNP
rs1364743765 295 dbSNP
rs1293680450 296 dbSNP
rs1388660823 298 dbSNP
rs759317342 300 dbSNP
rs537003212 303 dbSNP
rs181414756 312 dbSNP
rs1372285284 321 dbSNP
rs1168994125 322 dbSNP
rs1428800156 323 dbSNP
rs1039045588 330 dbSNP
rs1200546521 335 dbSNP
rs541092375 335 dbSNP
rs1489443161 339 dbSNP
rs1188902587 343 dbSNP
rs1490013153 344 dbSNP
rs1189351878 367 dbSNP
rs930733058 369 dbSNP
rs1206386334 371 dbSNP
rs1048328600 373 dbSNP
rs920995803 374 dbSNP
rs1440390192 376 dbSNP
rs1180806490 381 dbSNP
rs567404509 388 dbSNP
rs1378708756 394 dbSNP
rs1331848892 398 dbSNP
rs114899708 403 dbSNP
rs552918625 411 dbSNP
rs1352270164 413 dbSNP
rs1056705433 414 dbSNP
rs1394031802 414 dbSNP
rs1409058084 414 dbSNP
rs3836529 414 dbSNP
rs1174019508 449 dbSNP
rs868336868 456 dbSNP
rs1165964169 457 dbSNP
rs1011914966 463 dbSNP
rs1173356509 468 dbSNP
rs577962164 477 dbSNP
rs1183488498 479 dbSNP
rs1254673950 479 dbSNP
rs934319179 484 dbSNP
rs369620380 495 dbSNP
rs1248886133 497 dbSNP
rs967754958 501 dbSNP
rs1345980821 508 dbSNP
rs538884771 510 dbSNP
rs556965841 511 dbSNP
rs1446867552 515 dbSNP
rs1047026665 516 dbSNP
rs1409113906 517 dbSNP
rs905274929 522 dbSNP
rs115253214 525 dbSNP
rs1313190617 529 dbSNP
rs1396330881 533 dbSNP
rs1401075284 536 dbSNP
rs1323251939 543 dbSNP
rs1334276775 550 dbSNP
rs987069841 554 dbSNP
rs1027027731 556 dbSNP
rs952677672 557 dbSNP
rs1472568562 558 dbSNP
rs1004653683 562 dbSNP
rs1443339894 562 dbSNP
rs575582720 565 dbSNP
rs542823138 571 dbSNP
rs965698774 575 dbSNP
rs186686373 576 dbSNP
rs1268875665 580 dbSNP
rs1227822037 585 dbSNP
rs983537019 595 dbSNP
rs190745990 597 dbSNP
rs1285826855 599 dbSNP
rs953878505 613 dbSNP
rs759197372 614 dbSNP
rs1057073382 619 dbSNP
rs1436857052 620 dbSNP
rs925702264 624 dbSNP
rs948290360 627 dbSNP
rs1398391367 628 dbSNP
rs934337856 629 dbSNP
rs1164767569 633 dbSNP
rs770604131 634 dbSNP
rs1384979154 637 dbSNP
rs148551198 639 dbSNP
rs1332833435 641 dbSNP
rs1030739448 644 dbSNP
rs1445344607 647 dbSNP
rs564854307 650 dbSNP
rs556062388 657 dbSNP
rs562804861 659 dbSNP
rs530263312 663 dbSNP
rs1002333147 674 dbSNP
rs563826186 675 dbSNP
rs1230255582 677 dbSNP
rs1048454276 679 dbSNP
rs1226407717 683 dbSNP
rs1018528480 687 dbSNP
rs1332287963 690 dbSNP
rs1326172506 691 dbSNP
rs1179509215 692 dbSNP
rs1318554318 702 dbSNP
rs888568799 707 dbSNP
rs963896767 709 dbSNP
rs1365465213 717 dbSNP
rs973974819 717 dbSNP
rs531268571 721 dbSNP
rs1016037962 722 dbSNP
rs901186589 727 dbSNP
rs1256290222 734 dbSNP
rs1391084504 734 dbSNP
rs998486481 750 dbSNP
rs1186146581 751 dbSNP
rs112759850 752 dbSNP
rs1474493657 752 dbSNP
rs532905732 752 dbSNP
rs564179420 752 dbSNP
rs952032814 752 dbSNP
rs549130161 756 dbSNP
rs953825601 758 dbSNP
rs1342601181 763 dbSNP
rs142980121 765 dbSNP
rs1212416349 766 dbSNP
rs1346623946 772 dbSNP
rs983891318 786 dbSNP
rs1435047387 787 dbSNP
rs1345453277 810 dbSNP
rs771024428 815 dbSNP
rs1482366566 816 dbSNP
rs1371531012 821 dbSNP
rs1170124007 822 dbSNP
rs1181648463 824 dbSNP
rs1408460067 826 dbSNP
rs575897203 827 dbSNP
rs1427445411 840 dbSNP
rs1264304201 850 dbSNP
rs151104593 852 dbSNP
rs571752248 854 dbSNP
rs181913082 860 dbSNP
rs1184217765 861 dbSNP
rs1483288676 864 dbSNP
rs1232114409 865 dbSNP
rs557353948 866 dbSNP
rs916761587 867 dbSNP
rs1278822268 873 dbSNP
rs1218194106 876 dbSNP
rs1320797420 880 dbSNP
rs1281978274 884 dbSNP
rs948260644 887 dbSNP
rs1351594817 888 dbSNP
rs1297966863 889 dbSNP
rs1043983710 891 dbSNP
rs1440395534 894 dbSNP
rs1361176174 895 dbSNP
rs3836530 904 dbSNP
rs397841163 904 dbSNP
rs988482828 904 dbSNP
rs200800677 905 dbSNP
rs1469389950 910 dbSNP
rs935007459 922 dbSNP
rs186560191 928 dbSNP
rs560428028 935 dbSNP
rs758846211 936 dbSNP
rs1401809759 938 dbSNP
rs1175282334 939 dbSNP
rs1008401155 940 dbSNP
rs1202610411 941 dbSNP
rs1276224377 943 dbSNP
rs949767892 945 dbSNP
rs982293327 948 dbSNP
rs1318060069 955 dbSNP
rs536565923 957 dbSNP
rs1222488923 958 dbSNP
rs926909057 962 dbSNP
rs938177690 974 dbSNP
rs899695783 985 dbSNP
rs995327302 986 dbSNP
rs1280745703 987 dbSNP
rs1164546939 988 dbSNP
rs751483443 1001 dbSNP
rs888525232 1003 dbSNP
rs1210384211 1005 dbSNP
rs1264410805 1019 dbSNP
rs191077593 1021 dbSNP
rs1192193646 1022 dbSNP
rs182363490 1023 dbSNP
rs1026850571 1024 dbSNP
rs940070648 1025 dbSNP
rs1156836269 1026 dbSNP
rs1425380302 1027 dbSNP
rs13272 1028 dbSNP
rs1182703564 1029 dbSNP
rs1191296089 1036 dbSNP
rs573080384 1037 dbSNP
rs751865993 1047 dbSNP
rs901131144 1047 dbSNP
rs1249437249 1049 dbSNP
rs1004846339 1052 dbSNP
rs1485255814 1057 dbSNP
rs1015345261 1060 dbSNP
rs998205708 1066 dbSNP
rs1214246071 1072 dbSNP
rs1028237762 1078 dbSNP
rs1412453011 1079 dbSNP
rs1172592716 1081 dbSNP
rs1361003356 1083 dbSNP
rs1421276920 1085 dbSNP
rs1296055938 1087 dbSNP
rs889748280 1089 dbSNP
rs1437060164 1091 dbSNP
rs1276716625 1094 dbSNP
rs1365552629 1096 dbSNP
rs1233899552 1097 dbSNP
rs1380881408 1097 dbSNP
rs752287584 1102 dbSNP
rs992669061 1102 dbSNP
rs1356049468 1105 dbSNP
rs1214905362 1106 dbSNP
rs540293087 1110 dbSNP
rs1361350146 1115 dbSNP
rs1287099773 1120 dbSNP
rs1000014035 1122 dbSNP
rs544839190 1125 dbSNP
rs1459388668 1154 dbSNP
rs558361550 1160 dbSNP
rs916691456 1164 dbSNP
rs1162724371 1167 dbSNP
rs1283950700 1168 dbSNP
rs1391676881 1177 dbSNP
rs1452714596 1177 dbSNP
rs1427469966 1191 dbSNP
rs969534127 1202 dbSNP
rs767338049 1204 dbSNP
rs925525395 1204 dbSNP
rs1452027438 1208 dbSNP
rs935585063 1215 dbSNP
rs1192685376 1218 dbSNP
rs1277116915 1227 dbSNP
rs368937006 1228 dbSNP
rs576920309 1231 dbSNP
rs1228408128 1234 dbSNP
rs543844162 1236 dbSNP
rs1293567869 1237 dbSNP
rs867688097 1243 dbSNP
rs1441085937 1244 dbSNP
rs943780574 1250 dbSNP
rs11922969 1251 dbSNP
rs1039414653 1253 dbSNP
rs1405937133 1255 dbSNP
rs562517122 1259 dbSNP
rs995297716 1260 dbSNP
rs1348283308 1261 dbSNP
rs1168930455 1265 dbSNP
rs1461176879 1273 dbSNP
rs1440275547 1279 dbSNP
rs1370944815 1280 dbSNP
rs988945354 1301 dbSNP
rs1433238615 1303 dbSNP
rs1430660508 1309 dbSNP
rs1309982807 1323 dbSNP
rs780971911 1326 dbSNP
rs1048218638 1329 dbSNP
rs1254430107 1330 dbSNP
rs1196711154 1335 dbSNP
rs1480444444 1337 dbSNP
rs1379429738 1338 dbSNP
rs1024064186 1339 dbSNP
rs1235566849 1342 dbSNP
rs1238177810 1343 dbSNP
rs1279388014 1344 dbSNP
rs1357459591 1345 dbSNP
rs1212219454 1346 dbSNP
rs1390554923 1353 dbSNP
rs971461240 1364 dbSNP
rs1304188548 1366 dbSNP
rs1469925666 1367 dbSNP
rs1427969726 1371 dbSNP
rs552349200 1372 dbSNP
rs1479743210 1373 dbSNP
rs1414776372 1376 dbSNP
rs1004548520 1384 dbSNP
rs1183051326 1387 dbSNP
rs187957148 1399 dbSNP
rs1238212372 1408 dbSNP
rs938294287 1412 dbSNP
rs984349017 1413 dbSNP
rs1280043935 1415 dbSNP
rs910017337 1417 dbSNP
rs755202728 1418 dbSNP
rs191044528 1421 dbSNP
rs922744676 1429 dbSNP
rs528652831 1435 dbSNP
rs1411536201 1446 dbSNP
rs1387829542 1447 dbSNP
rs1159651033 1454 dbSNP
rs1453573108 1455 dbSNP
rs969502986 1460 dbSNP
rs1189969591 1462 dbSNP
rs1445502881 1464 dbSNP
rs547217123 1476 dbSNP
rs1466284077 1482 dbSNP
rs956950241 1486 dbSNP
rs988817824 1490 dbSNP
rs912838457 1494 dbSNP
rs1332149305 1495 dbSNP
rs943693836 1502 dbSNP
rs570828438 1504 dbSNP
rs1039383080 1508 dbSNP
rs1312426119 1509 dbSNP
rs769377701 1509 dbSNP
rs1436735049 1513 dbSNP
rs1326496149 1515 dbSNP
rs1316950209 1517 dbSNP
rs539940809 1521 dbSNP
rs1054399947 1524 dbSNP
rs1444892008 1526 dbSNP
rs531711308 1529 dbSNP
rs1425663922 1530 dbSNP
rs1384890325 1535 dbSNP
rs748378792 1536 dbSNP
rs1010102745 1537 dbSNP
rs558469362 1539 dbSNP
rs971192713 1540 dbSNP
rs1192473365 1545 dbSNP
rs183418963 1546 dbSNP
rs1247463260 1564 dbSNP
rs1282719308 1570 dbSNP
rs1223007193 1572 dbSNP
rs1334803022 1574 dbSNP
rs1219734623 1577 dbSNP
rs1230180661 1577 dbSNP
rs115550453 1589 dbSNP
rs1319348589 1597 dbSNP
rs1193788897 1615 dbSNP
rs1269111448 1622 dbSNP
rs1249369966 1625 dbSNP
rs1427982325 1628 dbSNP
rs1325249857 1630 dbSNP
rs1305458162 1631 dbSNP
rs1406004792 1634 dbSNP
rs1442566808 1639 dbSNP
rs1057414971 1640 dbSNP
rs1189394402 1645 dbSNP
rs1255073427 1647 dbSNP
rs1411869242 1650 dbSNP
rs895768920 1653 dbSNP
rs1167427459 1662 dbSNP
rs951732765 1668 dbSNP
rs1013591653 1680 dbSNP
rs1023646687 1686 dbSNP
rs1200047188 1689 dbSNP
rs1171259876 1690 dbSNP
rs1490150274 1690 dbSNP
rs139145114 1696 dbSNP
rs1460517549 1700 dbSNP
rs1167347459 1703 dbSNP
rs1403187700 1704 dbSNP
rs1438070354 1715 dbSNP
rs1000963868 1719 dbSNP
rs1397966589 1722 dbSNP
rs1032488982 1728 dbSNP
rs1346500880 1729 dbSNP
rs201027399 1732 dbSNP
rs764674434 1732 dbSNP
rs777889897 1737 dbSNP
rs1224673211 1740 dbSNP
rs988359846 1748 dbSNP
rs1020282532 1749 dbSNP
rs34471608 1751 dbSNP
rs554914439 1754 dbSNP
rs910143001 1759 dbSNP
rs965603448 1761 dbSNP
rs975015435 1761 dbSNP
rs187302239 1764 dbSNP
rs533975414 1768 dbSNP
rs1354662346 1774 dbSNP
rs1401191176 1774 dbSNP
rs1408410899 1774 dbSNP
rs1480088267 1781 dbSNP
rs1427056356 1784 dbSNP
rs961836653 1788 dbSNP
rs1341900227 1789 dbSNP
rs747548769 1798 dbSNP
rs1470371521 1805 dbSNP
rs1201986747 1806 dbSNP
rs771384084 1806 dbSNP
rs1250222016 1809 dbSNP
rs1345304732 1812 dbSNP
rs1202438296 1817 dbSNP
rs931038378 1821 dbSNP
rs777032870 1825 dbSNP
rs1281901595 1832 dbSNP
rs1225903880 1837 dbSNP
rs1201791298 1842 dbSNP
rs1374498777 1843 dbSNP
rs1279281697 1848 dbSNP
rs1049854666 1852 dbSNP
rs1485218833 1857 dbSNP
rs1337498705 1858 dbSNP
rs1469336562 1864 dbSNP
rs1403870622 1870 dbSNP
rs192294510 1870 dbSNP
rs79896076 1871 dbSNP
rs143984857 1873 dbSNP
rs555836975 1876 dbSNP
rs1406993422 1885 dbSNP
rs574104223 1889 dbSNP
rs770314056 1895 dbSNP
rs1243320457 1898 dbSNP
rs1182494174 1900 dbSNP
rs1192601712 1904 dbSNP
rs1459563803 1916 dbSNP
rs1254825665 1918 dbSNP
rs895686599 1920 dbSNP
rs775215267 1922 dbSNP
rs1284047787 1923 dbSNP
rs1467819673 1926 dbSNP
rs1238370820 1927 dbSNP
rs1045059158 1930 dbSNP
rs1315959458 1932 dbSNP
rs905213487 1952 dbSNP
rs1375296266 1954 dbSNP
rs762706967 1956 dbSNP
rs1431394735 1958 dbSNP
rs1344490931 1964 dbSNP
rs76350727 1967 dbSNP
rs558239897 1968 dbSNP
rs1300378268 1976 dbSNP
rs892589506 1979 dbSNP
rs1385517032 1982 dbSNP
rs561241983 1984 dbSNP
rs1010109689 1991 dbSNP
rs1263228794 1994 dbSNP
rs763681624 1997 dbSNP
rs1382103749 2003 dbSNP
rs878946899 2014 dbSNP
rs1486493153 2015 dbSNP
rs1242023662 2017 dbSNP
rs1378264640 2024 dbSNP
rs1362036631 2029 dbSNP
rs1294288829 2032 dbSNP
rs1245534059 2051 dbSNP
rs1010465265 2055 dbSNP
rs184678476 2070 dbSNP
rs1019787343 2071 dbSNP
rs528786861 2073 dbSNP
rs965571477 2074 dbSNP
rs1406611126 2075 dbSNP
rs975652770 2077 dbSNP
rs1028554049 2084 dbSNP
rs907057481 2085 dbSNP
rs1346631201 2086 dbSNP
rs983836115 2090 dbSNP
rs1217070094 2092 dbSNP
rs908287587 2095 dbSNP
rs1419512740 2096 dbSNP
rs1001215902 2107 dbSNP
rs1034064285 2108 dbSNP
rs1287843440 2116 dbSNP
rs951681272 2126 dbSNP
rs1490966830 2132 dbSNP
rs1270056763 2136 dbSNP
rs1222161923 2138 dbSNP
rs1487639070 2150 dbSNP
rs1484865975 2155 dbSNP
rs767714521 2157 dbSNP
rs1204461484 2164 dbSNP
rs540455579 2165 dbSNP
rs1276325413 2169 dbSNP
rs939790251 2178 dbSNP
rs1268197847 2179 dbSNP
rs1346029667 2180 dbSNP
rs1005920341 2185 dbSNP
rs1434979919 2192 dbSNP
rs917103854 2195 dbSNP
rs1298392794 2199 dbSNP
rs1461097903 2205 dbSNP
rs948597736 2207 dbSNP
rs565492381 2208 dbSNP
rs904470836 2213 dbSNP
rs961676729 2217 dbSNP
rs973299690 2223 dbSNP
rs1053792322 2225 dbSNP
rs922767637 2226 dbSNP
rs1196586761 2227 dbSNP
rs1480393691 2238 dbSNP
rs187544052 2244 dbSNP
rs551056959 2245 dbSNP
rs146464987 2247 dbSNP
rs1205591583 2259 dbSNP
rs1324258915 2264 dbSNP
rs1262398866 2269 dbSNP
rs1230880419 2286 dbSNP
rs1337298543 2290 dbSNP
rs1453721805 2291 dbSNP
rs1307369207 2306 dbSNP
rs568349747 2307 dbSNP
rs1009664900 2313 dbSNP
rs1041585799 2319 dbSNP
rs985506244 2326 dbSNP
rs911320179 2327 dbSNP
rs1453120239 2329 dbSNP
rs1407516670 2334 dbSNP
rs761776385 2344 dbSNP
rs1464905967 2346 dbSNP
rs990187597 2357 dbSNP
rs1323226310 2359 dbSNP
rs750782645 2363 dbSNP
rs913126380 2364 dbSNP
rs945954618 2375 dbSNP
rs530110455 2376 dbSNP
rs1242523017 2382 dbSNP
rs1311247850 2383 dbSNP
rs1198676361 2385 dbSNP
rs573364181 2387 dbSNP
rs1352665632 2388 dbSNP
rs1314879293 2389 dbSNP
rs1238328525 2395 dbSNP
rs1351116249 2396 dbSNP
rs140925736 2406 dbSNP
rs1015268115 2408 dbSNP
rs961389257 2412 dbSNP
rs937182986 2414 dbSNP
rs1387716884 2427 dbSNP
rs1265948922 2428 dbSNP
rs992611702 2430 dbSNP
rs1055462644 2436 dbSNP
rs917028353 2437 dbSNP
rs1489392306 2438 dbSNP
rs1165692683 2443 dbSNP
rs887567467 2444 dbSNP
rs1185456669 2448 dbSNP
rs1448684136 2448 dbSNP
rs535677943 2449 dbSNP
rs1014621620 2472 dbSNP
rs1293561911 2480 dbSNP
rs534093934 2494 dbSNP
rs1358239373 2495 dbSNP
rs925819675 2498 dbSNP
rs897498705 2499 dbSNP
rs1228951891 2501 dbSNP
rs994409317 2506 dbSNP
rs1319552550 2508 dbSNP
rs935939927 2514 dbSNP
rs1406321883 2516 dbSNP
rs1418847502 2517 dbSNP
rs1359043608 2520 dbSNP
rs1165856110 2530 dbSNP
rs558438394 2533 dbSNP
rs1198903098 2535 dbSNP
rs1029155770 2537 dbSNP
rs1054165249 2537 dbSNP
rs1192834700 2537 dbSNP
rs1391803071 2537 dbSNP
rs77184837 2537 dbSNP
rs879220831 2537 dbSNP
rs1323335032 2538 dbSNP
rs1393068833 2539 dbSNP
rs1447116001 2551 dbSNP
rs1222892303 2553 dbSNP
rs1029924306 2564 dbSNP
rs1490099280 2576 dbSNP
rs570626308 2589 dbSNP
rs1287270425 2591 dbSNP
rs1197109240 2596 dbSNP
rs1269021289 2597 dbSNP
rs1339459100 2597 dbSNP
rs1218570900 2599 dbSNP
rs1299523361 2610 dbSNP
rs1339035814 2612 dbSNP
rs955493856 2615 dbSNP
rs553930844 2618 dbSNP
rs36035541 2620 dbSNP
rs945393244 2623 dbSNP
rs1274160089 2627 dbSNP
rs1321820717 2638 dbSNP
rs1390622837 2640 dbSNP
rs1018351140 2644 dbSNP
rs957468396 2651 dbSNP
rs79883177 2652 dbSNP
rs990651285 2655 dbSNP
rs901298718 2656 dbSNP
rs1336902666 2672 dbSNP
rs996966270 2675 dbSNP
rs1049887999 2676 dbSNP
rs537500103 2680 dbSNP
rs913207172 2682 dbSNP
rs946040436 2685 dbSNP
rs1005815608 2691 dbSNP
rs1477574675 2692 dbSNP
rs1244680208 2693 dbSNP
rs1318688941 2694 dbSNP
rs1015654644 2695 dbSNP
rs1196153679 2706 dbSNP
rs556214178 2709 dbSNP
rs961057135 2711 dbSNP
rs1265507601 2719 dbSNP
rs774401009 2722 dbSNP
rs541274040 2725 dbSNP
rs969796688 2726 dbSNP
rs979895818 2729 dbSNP
rs1480391835 2732 dbSNP
rs1330824941 2740 dbSNP
rs559260640 2749 dbSNP
rs572145490 2750 dbSNP
rs925787218 2752 dbSNP
rs1177058287 2754 dbSNP
rs957490621 2754 dbSNP
rs1182837150 2759 dbSNP
rs1422806242 2763 dbSNP
rs981346851 2763 dbSNP
rs1160046514 2764 dbSNP
rs540778279 2769 dbSNP
rs574708993 2774 dbSNP
rs1470320041 2775 dbSNP
rs1237165082 2784 dbSNP
rs1258643507 2786 dbSNP
rs1474541602 2793 dbSNP
rs913168904 2794 dbSNP
rs1164798412 2795 dbSNP
rs1211449079 2805 dbSNP
rs1009133429 2814 dbSNP
rs928589622 2818 dbSNP
rs945388060 2821 dbSNP
rs1171836948 2822 dbSNP
rs1352408470 2826 dbSNP
rs937173190 2828 dbSNP
rs1308802149 2837 dbSNP
rs1461140834 2840 dbSNP
rs1041062600 2851 dbSNP
rs1337396061 2864 dbSNP
rs1055577164 2871 dbSNP
rs56783135 2873 dbSNP
rs565694302 2877 dbSNP
rs941762176 2878 dbSNP
rs932747064 2879 dbSNP
rs574239008 2887 dbSNP
rs750393646 2893 dbSNP
rs193273102 2901 dbSNP
rs184160451 2910 dbSNP
rs755821236 2912 dbSNP
rs891405536 2913 dbSNP
rs1007049056 2914 dbSNP
rs1446017712 2925 dbSNP
rs150104842 2927 dbSNP
rs1180729296 2928 dbSNP
rs1483220315 2941 dbSNP
rs1236201786 2942 dbSNP
rs957788611 2943 dbSNP
rs1218470010 2953 dbSNP
rs1037275180 2955 dbSNP
rs540945464 2958 dbSNP
rs1216406156 2959 dbSNP
rs539520330 2961 dbSNP
rs758689490 2963 dbSNP
rs1211059173 2965 dbSNP
rs565290077 2969 dbSNP
rs777801481 2970 dbSNP
rs1359673346 2973 dbSNP
rs1001301905 2979 dbSNP
rs981447556 2981 dbSNP
rs1365756890 2985 dbSNP
rs1032783172 2986 dbSNP
rs1412342815 2989 dbSNP
rs1421541552 2989 dbSNP
rs577378905 2994 dbSNP
rs1479052734 2995 dbSNP
rs1478399030 2996 dbSNP
rs747109956 3002 dbSNP
rs991379701 3003 dbSNP
rs909028005 3005 dbSNP
rs377114964 3006 dbSNP
rs771938770 3011 dbSNP
rs941862865 3011 dbSNP
rs1319984302 3015 dbSNP
rs1416713853 3015 dbSNP
rs1036080809 3022 dbSNP
rs1339710261 3023 dbSNP
rs3733126 3029 dbSNP
rs147010817 3030 dbSNP
rs879350599 3030 dbSNP
rs1365884188 3031 dbSNP
rs3733127 3032 dbSNP
rs888795568 3033 dbSNP
rs1432642496 3034 dbSNP
rs1170490715 3035 dbSNP
rs1311973118 3035 dbSNP
rs985494470 3042 dbSNP
rs9990236 3046 dbSNP
rs1192006317 3050 dbSNP
rs1268386757 3050 dbSNP
rs59211117 3050 dbSNP
rs796227729 3050 dbSNP
rs1432749159 3051 dbSNP
rs1039980799 3053 dbSNP
rs1487589632 3057 dbSNP
rs548589167 3063 dbSNP
rs1361323317 3066 dbSNP
rs1012191745 3069 dbSNP
rs879932380 3073 dbSNP
rs1220101871 3074 dbSNP
rs1020364756 3083 dbSNP
rs1037646905 3084 dbSNP
rs1256076657 3086 dbSNP
rs1225178915 3091 dbSNP
rs1331486430 3092 dbSNP
rs189032643 3094 dbSNP
rs879238486 3095 dbSNP
rs1300255566 3103 dbSNP
rs1384753183 3105 dbSNP
rs1345927505 3106 dbSNP
rs1331501178 3108 dbSNP
rs1445367258 3115 dbSNP
rs897369081 3116 dbSNP
rs1169144915 3120 dbSNP
rs527544578 3126 dbSNP
rs950291394 3130 dbSNP
rs1210626832 3135 dbSNP
rs145568367 3137 dbSNP
rs1431682555 3144 dbSNP
rs1002816274 3146 dbSNP
rs1449258532 3153 dbSNP
rs1236372506 3159 dbSNP
rs556466506 3159 dbSNP
rs1035626678 3188 dbSNP
rs1345581165 3191 dbSNP
rs570692986 3195 dbSNP
rs1032753464 3196 dbSNP
rs1230769878 3201 dbSNP
rs1318399557 3204 dbSNP
rs574788994 3220 dbSNP
rs892915605 3232 dbSNP
rs1452138618 3235 dbSNP
rs377628055 3236 dbSNP
rs148863609 3237 dbSNP
rs1403471858 3242 dbSNP
rs1302682235 3248 dbSNP
rs115703220 3249 dbSNP
rs963236942 3260 dbSNP
rs975990287 3261 dbSNP
rs1344746187 3264 dbSNP
rs1437300780 3272 dbSNP
rs1442988365 3273 dbSNP
rs1198588385 3277 dbSNP
rs746816860 3280 dbSNP
rs1327933832 3286 dbSNP
rs551747355 3292 dbSNP
rs1233786276 3302 dbSNP
rs918998112 3303 dbSNP
rs1286388333 3311 dbSNP
rs933033917 3312 dbSNP
rs1353277695 3319 dbSNP
rs1316563854 3320 dbSNP
rs954036118 3337 dbSNP
rs1341631714 3338 dbSNP
rs985461992 3339 dbSNP
rs909967489 3340 dbSNP
rs567799065 3343 dbSNP
rs910179182 3347 dbSNP
rs943023411 3349 dbSNP
rs950218647 3365 dbSNP
rs535191285 3375 dbSNP
rs927564832 3376 dbSNP
rs936988591 3377 dbSNP
rs1054531088 3379 dbSNP
rs1192583781 3383 dbSNP
rs879897270 3386 dbSNP
rs1487131899 3392 dbSNP
rs776055529 3394 dbSNP
rs1010416002 3395 dbSNP
rs1355056562 3401 dbSNP
rs1471032882 3402 dbSNP
rs1263098235 3403 dbSNP
rs1042308233 3405 dbSNP
rs560747364 3407 dbSNP
rs565903225 3410 dbSNP
rs1405843593 3411 dbSNP
rs1866300 3411 dbSNP
rs1002891241 3420 dbSNP
rs1392352879 3441 dbSNP
rs1390110881 3446 dbSNP
rs553325427 3448 dbSNP
rs1035740788 3458 dbSNP
rs1332276516 3461 dbSNP
rs866263959 3463 dbSNP
rs1467137920 3471 dbSNP
rs143627115 3476 dbSNP
rs1440470989 3477 dbSNP
rs1192720085 3478 dbSNP
rs748943934 3489 dbSNP
rs1028861620 3491 dbSNP
rs1248152168 3492 dbSNP
rs1199137893 3503 dbSNP
rs1012906909 3506 dbSNP
rs1287159778 3510 dbSNP
rs953336290 3510 dbSNP
rs1320675145 3511 dbSNP
rs1259267016 3515 dbSNP
rs1006809071 3518 dbSNP
rs1274558245 3520 dbSNP
rs17069638 3527 dbSNP
rs962801961 3530 dbSNP
rs1330689080 3541 dbSNP
rs963651641 3550 dbSNP
rs972017189 3564 dbSNP
rs1026542026 3565 dbSNP
rs1401024073 3574 dbSNP
rs918706124 3588 dbSNP
rs1463939850 3589 dbSNP
rs954528668 3591 dbSNP
rs981646213 3592 dbSNP
rs138196842 3594 dbSNP
rs1244595359 3598 dbSNP
rs1180047896 3605 dbSNP
rs910336401 3610 dbSNP
rs143867995 3613 dbSNP
rs781705444 3616 dbSNP
rs1236976135 3618 dbSNP
rs1198572442 3628 dbSNP
rs1456792352 3641 dbSNP
rs1281192217 3642 dbSNP
rs972110545 3648 dbSNP
rs1344629068 3658 dbSNP
rs1189945493 3663 dbSNP
rs937584210 3667 dbSNP
rs1242474962 3678 dbSNP
rs181472839 3680 dbSNP
rs563111354 3685 dbSNP
rs1360804734 3693 dbSNP
rs1444505148 3693 dbSNP
rs947598882 3694 dbSNP
rs1041846382 3698 dbSNP
rs1041991753 3700 dbSNP
rs186110216 3703 dbSNP
rs1328652959 3706 dbSNP
rs1176178797 3709 dbSNP
rs901637278 3710 dbSNP
rs1211346933 3713 dbSNP
rs542344244 3718 dbSNP
rs560989955 3721 dbSNP
rs1278558830 3726 dbSNP
rs1219112511 3733 dbSNP
rs1291973970 3736 dbSNP
rs1057137962 3737 dbSNP
rs1238016915 3737 dbSNP
rs1284699333 3738 dbSNP
rs1381337184 3738 dbSNP
rs1435447943 3738 dbSNP
rs1182962647 3739 dbSNP
rs1191512502 3739 dbSNP
rs1196273574 3739 dbSNP
rs1213809150 3739 dbSNP
rs1227706480 3739 dbSNP
rs1255877536 3739 dbSNP
rs1285575672 3739 dbSNP
rs1290603345 3739 dbSNP
rs1323599750 3739 dbSNP
rs1362824233 3739 dbSNP
rs1416659881 3739 dbSNP
rs1447128990 3739 dbSNP
rs1472718109 3739 dbSNP
rs754267860 3739 dbSNP
rs889000361 3739 dbSNP
rs1232163144 3740 dbSNP
rs894605126 3752 dbSNP
rs1295948154 3763 dbSNP
rs1339512328 3763 dbSNP
rs1434067390 3763 dbSNP
rs869110728 3763 dbSNP
rs1423023721 3764 dbSNP
rs1478263223 3765 dbSNP
rs1193682773 3766 dbSNP
rs1272080332 3769 dbSNP
rs745475866 3770 dbSNP
rs1362856611 3771 dbSNP
rs1189725397 3774 dbSNP
rs1163405157 3778 dbSNP
rs769361262 3783 dbSNP
rs1255340102 3784 dbSNP
rs1196380324 3786 dbSNP
rs560479630 3787 dbSNP
rs775149765 3789 dbSNP
rs1016647641 3790 dbSNP
rs899180906 3794 dbSNP
rs993780961 3800 dbSNP
rs527673842 3801 dbSNP
rs1247385529 3806 dbSNP
rs1220897254 3816 dbSNP
rs1026237513 3823 dbSNP
rs552334923 3828 dbSNP
rs1259906440 3829 dbSNP
rs1374835073 3829 dbSNP
rs1474578180 3830 dbSNP
rs954518935 3835 dbSNP
rs1317080676 3840 dbSNP
rs987340909 3849 dbSNP
rs1167542818 3854 dbSNP
rs1017347675 3856 dbSNP
rs190922611 3858 dbSNP
rs1367841619 3864 dbSNP
rs964490767 3866 dbSNP
rs74434492 3878 dbSNP
rs1436974387 3882 dbSNP
rs1392991354 3883 dbSNP
rs549530215 3887 dbSNP
rs1375394849 3896 dbSNP
rs773887576 3897 dbSNP
rs1401098601 3899 dbSNP
rs1466541296 3901 dbSNP
rs1423399937 3906 dbSNP
rs1295719282 3922 dbSNP
rs1168721333 3924 dbSNP
rs567937462 3933 dbSNP
rs945079311 3937 dbSNP
rs1322878872 3938 dbSNP
rs1190749510 3939 dbSNP
rs963018272 3942 dbSNP
rs1240040683 3967 dbSNP
rs1199197236 3969 dbSNP
rs1457232974 3974 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugCCCACG---CU--AAAGACACACUcu 5'
            ||||||    |  ||||| | |||  
Target 5' --GGGTGCTTTTATTTTTCTCTTTGAtt 3'
 		1 - 26
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER+ ER+ breast cancer 0.466 1.9e-2 0.400 4.0e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.433 2.8e-2 -0.507 1.1e-2 20 Click to see details
GSE14794 Lymphoblastoid cells -0.161 6.5e-2 -0.130 1.1e-1 90 Click to see details
GSE17306 Multiple myeloma 0.204 8.0e-2 0.232 5.4e-2 49 Click to see details
GSE28544 Breast cancer 0.289 8.5e-2 0.175 2.1e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.366 1.1e-1 -0.396 9.0e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.19 1.5e-1 -0.104 2.9e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.298 1.7e-1 0.180 2.9e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.117 1.8e-1 -0.214 4.5e-2 64 Click to see details
GSE17498 Multiple myeloma 0.131 2.1e-1 0.268 4.7e-2 40 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.283 2.3e-1 -0.117 3.8e-1 9 Click to see details
GSE38226 Liver fibrosis -0.162 2.4e-1 -0.365 5.2e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.085 3.5e-1 0.240 1.3e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.095 3.6e-1 0.012 4.8e-1 16 Click to see details
GSE19536 Breast cancer 0.031 3.8e-1 0.009 4.6e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.053 4.0e-1 -0.202 1.7e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.028 4.0e-1 -0.040 3.6e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.027 4.5e-1 0.015 4.7e-1 25 Click to see details
GSE21032 Prostate cancer 0.01 4.6e-1 -0.041 3.6e-1 83 Click to see details
GSE21849 B cell lymphoma 0.009 4.8e-1 0.075 3.5e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.375 0.06 0.381 0.06 18 Click to see details
PRAD 0.191 0.09 0.202 0.08 50 Click to see details
HNSC 0.203 0.1 0.240 0.06 42 Click to see details
KIRC 0.158 0.1 0.100 0.21 68 Click to see details
LUAD 0.366 0.12 0.413 0.09 12 Click to see details
LIHC -0.162 0.13 -0.214 0.07 49 Click to see details
PAAD 0.716 0.14 0.800 0.1 4 Click to see details
ESCA -0.266 0.21 -0.218 0.26 11 Click to see details
PCPG -0.702 0.25 -0.500 0.33 3 Click to see details
THCA 0.08 0.27 0.100 0.23 59 Click to see details
UCEC -0.146 0.28 -0.135 0.29 19 Click to see details
CESC -0.61 0.29 -0.500 0.33 3 Click to see details
COAD 0.221 0.3 0.381 0.18 8 Click to see details
KIRP -0.093 0.31 -0.071 0.35 32 Click to see details
BRCA 0.056 0.31 0.095 0.2 84 Click to see details
STAD 0.07 0.35 0.021 0.45 32 Click to see details
LUSC -0.03 0.43 -0.047 0.39 38 Click to see details
CHOL 0.064 0.44 0.100 0.4 9 Click to see details
KICH -0.023 0.46 -0.032 0.44 25 Click to see details
KICH -0.023 0.46 -0.032 0.44 25 Click to see details
KICH -0.023 0.46 -0.032 0.44 25 Click to see details
303 hsa-miR-342-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005881 GEMIN4 gem nuclear organelle associated protein 4 4 3
MIRT005882 BMP7 bone morphogenetic protein 7 2 1
MIRT006443 DNMT1 DNA methyltransferase 1 3 1
MIRT043661 TMEM98 transmembrane protein 98 1 1
MIRT043662 IDH3B isocitrate dehydrogenase 3 (NAD(+)) beta 1 1
MIRT043663 KPNA2 karyopherin subunit alpha 2 1 1
MIRT043664 PRKCE protein kinase C epsilon 1 1
MIRT043665 TRMT61A tRNA methyltransferase 61A 1 1
MIRT043666 ZNF766 zinc finger protein 766 1 1
MIRT043667 FIGN fidgetin, microtubule severing factor 1 1
MIRT043668 FIBP FGF1 intracellular binding protein 1 1
MIRT043669 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 1 1
MIRT043670 KCTD15 potassium channel tetramerization domain containing 15 1 1
MIRT043671 RPS3A ribosomal protein S3A 1 1
MIRT043672 NCAN neurocan 1 1
MIRT043673 SLC6A12 solute carrier family 6 member 12 1 1
MIRT043674 RPS9 ribosomal protein S9 1 1
MIRT043675 ATXN7 ataxin 7 1 1
MIRT043676 ISOC2 isochorismatase domain containing 2 1 1
MIRT043677 CRB2 crumbs 2, cell polarity complex component 2 3
MIRT043678 PPIE peptidylprolyl isomerase E 1 1
MIRT043679 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT043680 GJA1 gap junction protein alpha 1 1 1
MIRT043681 CANX calnexin 1 1
MIRT043682 NOP2 NOP2 nucleolar protein 1 1
MIRT043683 VAPB VAMP associated protein B and C 1 1
MIRT043684 ATF4 activating transcription factor 4 1 1
MIRT043685 BPTF bromodomain PHD finger transcription factor 1 1
MIRT043686 RPL26 ribosomal protein L26 1 1
MIRT043687 NGRN neugrin, neurite outgrowth associated 1 1
MIRT043688 TNS3 tensin 3 2 3
MIRT043689 RPL15 ribosomal protein L15 1 1
MIRT043690 FN3KRP fructosamine 3 kinase related protein 1 1
MIRT043691 METTL2A methyltransferase like 2A 1 1
MIRT043692 VPS35 VPS35, retromer complex component 1 1
MIRT043693 IDS iduronate 2-sulfatase 1 1
MIRT043694 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT043695 ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase 1 1
MIRT043696 SLC30A9 solute carrier family 30 member 9 1 1
MIRT043697 RPL27A ribosomal protein L27a 1 1
MIRT043698 GOT2 glutamic-oxaloacetic transaminase 2 1 1
MIRT043699 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT043700 RRM2 ribonucleotide reductase regulatory subunit M2 1 1
MIRT043701 RFX3 regulatory factor X3 1 1
MIRT043702 CCND2 cyclin D2 1 1
MIRT043703 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT043704 ZNF430 zinc finger protein 430 1 1
MIRT043705 NAPG NSF attachment protein gamma 1 1
MIRT043706 GTF2H2C GTF2H2 family member C 1 1
MIRT043707 FAM3C family with sequence similarity 3 member C 1 1
MIRT043708 PWP2 PWP2, small subunit processome component 1 1
MIRT043709 PTRF caveolae associated protein 1 2 3
MIRT043710 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT043711 ACTG1 actin gamma 1 1 1
MIRT043712 TRERF1 transcriptional regulating factor 1 2 3
MIRT043713 CBX1 chromobox 1 1 1
MIRT043714 TOMM70A translocase of outer mitochondrial membrane 70 1 1
MIRT043715 ZSCAN29 zinc finger and SCAN domain containing 29 2 3
MIRT043716 NABP2 nucleic acid binding protein 2 1 1
MIRT043717 HARS histidyl-tRNA synthetase 1 1
MIRT043718 INO80D INO80 complex subunit D 1 1
MIRT043719 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 1
MIRT043720 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT043721 PA2G4 proliferation-associated 2G4 1 1
MIRT043722 STRN striatin 1 1
MIRT043723 CCDC6 coiled-coil domain containing 6 1 1
MIRT043724 EXOSC1 exosome component 1 1 1
MIRT043725 EPB41 erythrocyte membrane protein band 4.1 2 3
MIRT043726 ZFC3H1 zinc finger C3H1-type containing 1 1
MIRT043727 XPOT exportin for tRNA 1 1
MIRT043728 JUN Jun proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT043729 SOD2 superoxide dismutase 2 1 1
MIRT043730 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT043731 TCP1 t-complex 1 1 1
MIRT043732 TCF3 transcription factor 3 1 1
MIRT043733 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT043734 TRAP1 TNF receptor associated protein 1 1 1
MIRT043735 FOSL2 FOS like 2, AP-1 transcription factor subunit 1 1
MIRT043736 APTX aprataxin 1 1
MIRT043737 SF3B3 splicing factor 3b subunit 3 1 1
MIRT043738 SF3B2 splicing factor 3b subunit 2 1 1
MIRT043739 TACC1 transforming acidic coiled-coil containing protein 1 1 1
MIRT043740 CXADR CXADR, Ig-like cell adhesion molecule 1 1
MIRT054884 ID4 inhibitor of DNA binding 4, HLH protein 3 1
MIRT102908 INSIG1 insulin induced gene 1 2 4
MIRT407297 IGFBP5 insulin like growth factor binding protein 5 2 4
MIRT437733 RMND5A required for meiotic nuclear division 5 homolog A 2 1
MIRT437734 SYNPO2L synaptopodin 2 like 2 1
MIRT437735 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 1
MIRT437736 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 1
MIRT437737 C20orf11 GID complex subunit 8 homolog 3 2
MIRT437738 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT437783 ANKRD49 ankyrin repeat domain 49 2 1
MIRT438066 SREBF1 sterol regulatory element binding transcription factor 1 3 1
MIRT438067 SREBF2 sterol regulatory element binding transcription factor 2 3 1
MIRT446662 MXI1 MAX interactor 1, dimerization protein 2 4
MIRT451848 TXNDC5 thioredoxin domain containing 5 2 2
MIRT454440 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT457188 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT463394 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT464518 UBXN7 UBX domain protein 7 2 2
MIRT469230 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT472349 NETO2 neuropilin and tolloid like 2 2 2
MIRT503514 USP51 ubiquitin specific peptidase 51 2 6
MIRT510418 ZNF268 zinc finger protein 268 2 4
MIRT511283 KLHL15 kelch like family member 15 2 2
MIRT524562 CALR calreticulin 2 2
MIRT527248 ASB3 ankyrin repeat and SOCS box containing 3 2 2
MIRT528806 RAB32 RAB32, member RAS oncogene family 2 2
MIRT529775 ZNF486 zinc finger protein 486 2 2
MIRT530278 CIRH1A UTP4, small subunit processome component 2 4
MIRT531817 GPR75-ASB3 GPR75-ASB3 readthrough 2 2
MIRT534376 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT534784 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT539662 EID1 EP300 interacting inhibitor of differentiation 1 2 10
MIRT539827 KLF8 Kruppel like factor 8 2 2
MIRT540117 KLF17 Kruppel like factor 17 2 2
MIRT540474 MLLT6 MLLT6, PHD finger containing 2 6
MIRT540605 CD3D CD3d molecule 2 2
MIRT540671 LHFPL3 LHFPL tetraspan subfamily member 3 2 4
MIRT540697 ATG10 autophagy related 10 2 4
MIRT540765 RALGPS1 Ral GEF with PH domain and SH3 binding motif 1 2 4
MIRT541057 SEPHS1 selenophosphate synthetase 1 2 2
MIRT541345 FRMD3 FERM domain containing 3 2 4
MIRT541479 ARF3 ADP ribosylation factor 3 2 6
MIRT541574 SYT5 synaptotagmin 5 2 6
MIRT541714 TMEM33 transmembrane protein 33 2 2
MIRT541893 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT541944 NBPF10 NBPF member 10 2 4
MIRT542038 FAM180B family with sequence similarity 180 member B 2 11
MIRT542120 EPHB3 EPH receptor B3 2 8
MIRT542150 EGR3 early growth response 3 2 4
MIRT547498 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT551163 UBTF upstream binding transcription factor, RNA polymerase I 2 4
MIRT557042 HOXB3 homeobox B3 2 2
MIRT560204 AK4 adenylate kinase 4 2 2
MIRT565953 RRAGD Ras related GTP binding D 2 2
MIRT566178 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT569210 SHC3 SHC adaptor protein 3 2 2
MIRT570179 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT571553 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT572159 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT572574 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT573183 P2RX3 purinergic receptor P2X 3 2 2
MIRT575398 Zdhhc22 zinc finger, DHHC-type containing 22 2 3
MIRT575406 Rnf152 ring finger protein 152 2 5
MIRT576117 Klf6 Kruppel-like factor 6 2 2
MIRT576239 Rgs4 regulator of G-protein signaling 4 2 3
MIRT576246 Asah2 N-acylsphingosine amidohydrolase 2 2 5
MIRT607088 RNF152 ring finger protein 152 2 7
MIRT607211 ASAH2 N-acylsphingosine amidohydrolase 2 2 7
MIRT607280 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT609144 ZNF610 zinc finger protein 610 2 2
MIRT609878 RAD54L2 RAD54 like 2 2 4
MIRT610080 CRLF1 cytokine receptor like factor 1 2 2
MIRT610223 HDAC9 histone deacetylase 9 2 2
MIRT610232 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT610558 NBPF14 NBPF member 14 2 2
MIRT610699 ZNF548 zinc finger protein 548 2 2
MIRT611213 CLN8 CLN8, transmembrane ER and ERGIC protein 2 6
MIRT611288 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT611307 ZDHHC22 zinc finger DHHC-type containing 22 2 3
MIRT611504 HIPK3 homeodomain interacting protein kinase 3 2 2
MIRT611759 PLA2G7 phospholipase A2 group VII 2 6
MIRT611976 ZNF175 zinc finger protein 175 2 2
MIRT612318 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT612387 TCTE1 t-complex-associated-testis-expressed 1 2 8
MIRT612411 SPAG7 sperm associated antigen 7 2 2
MIRT612514 SH3PXD2A SH3 and PX domains 2A 2 4
MIRT612542 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT612812 LMX1A LIM homeobox transcription factor 1 alpha 2 2
MIRT613262 C2orf72 chromosome 2 open reading frame 72 2 4
MIRT613327 ANTXR2 anthrax toxin receptor 2 2 2
MIRT613372 ACVR1B activin A receptor type 1B 2 2
MIRT614341 PVRIG poliovirus receptor related immunoglobulin domain containing 2 4
MIRT614774 SLC41A2 solute carrier family 41 member 2 2 4
MIRT615053 DCAF12 DDB1 and CUL4 associated factor 12 2 2
MIRT615063 CRIM1 cysteine rich transmembrane BMP regulator 1 2 2
MIRT615345 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT615628 F11R F11 receptor 2 4
MIRT615687 ZNF280B zinc finger protein 280B 2 2
MIRT616247 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 4
MIRT616521 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT616579 FAM107A family with sequence similarity 107 member A 2 2
MIRT617567 RPSAP58 ribosomal protein SA pseudogene 58 2 4
MIRT617921 WDR73 WD repeat domain 73 2 2
MIRT618484 SIGLEC15 sialic acid binding Ig like lectin 15 2 2
MIRT618697 KIF13A kinesin family member 13A 2 2
MIRT620429 ATP6V1G3 ATPase H+ transporting V1 subunit G3 2 2
MIRT620696 RFTN2 raftlin family member 2 2 2
MIRT622433 NUDT19 nudix hydrolase 19 2 2
MIRT623125 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT623435 KIAA1161 myogenesis regulating glycosidase (putative) 2 2
MIRT623633 IGF1R insulin like growth factor 1 receptor 2 2
MIRT623758 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT624078 DUSP6 dual specificity phosphatase 6 2 2
MIRT624149 DIAPH1 diaphanous related formin 1 2 2
MIRT625971 PKP1 plakophilin 1 2 2
MIRT626853 IREB2 iron responsive element binding protein 2 2 2
MIRT627799 PXDN peroxidasin 2 2
MIRT628216 FOXJ3 forkhead box J3 2 2
MIRT628728 IKZF3 IKAROS family zinc finger 3 2 2
MIRT628742 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT628913 DARS aspartyl-tRNA synthetase 2 2
MIRT630686 HUNK hormonally up-regulated Neu-associated kinase 2 4
MIRT631701 C1QTNF6 C1q and TNF related 6 2 2
MIRT631987 CLSTN3 calsyntenin 3 2 4
MIRT632221 YME1L1 YME1 like 1 ATPase 2 2
MIRT632387 SLITRK4 SLIT and NTRK like family member 4 2 2
MIRT632429 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT632639 OSMR oncostatin M receptor 2 2
MIRT633415 TMEM120B transmembrane protein 120B 2 2
MIRT634312 SNTN sentan, cilia apical structure protein 2 2
MIRT634424 PHKG2 phosphorylase kinase catalytic subunit gamma 2 2 2
MIRT634486 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT635142 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT637088 SELPLG selectin P ligand 2 2
MIRT637595 PLD6 phospholipase D family member 6 2 2
MIRT637685 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 2 2
MIRT638438 PLXNA4 plexin A4 2 2
MIRT638660 GGCX gamma-glutamyl carboxylase 2 2
MIRT638775 EMC7 ER membrane protein complex subunit 7 2 2
MIRT638956 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT640594 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT646836 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT648283 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT650728 TNFSF8 TNF superfamily member 8 2 2
MIRT652628 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT653036 STRN3 striatin 3 2 2
MIRT655877 NFASC neurofascin 2 2
MIRT656165 MRRF mitochondrial ribosome recycling factor 2 2
MIRT659533 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT659637 CDK6 cyclin dependent kinase 6 2 2
MIRT661112 FPR1 formyl peptide receptor 1 2 2
MIRT661503 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
MIRT661660 ZNF623 zinc finger protein 623 2 2
MIRT662095 ZNF419 zinc finger protein 419 2 2
MIRT665496 VAPA VAMP associated protein A 2 2
MIRT665750 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT665777 TMEM236 transmembrane protein 236 2 2
MIRT665952 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor 2 4
MIRT670473 TMEM105 transmembrane protein 105 2 2
MIRT670999 PTGIS prostaglandin I2 synthase 2 2
MIRT671254 ATP6V0E1 ATPase H+ transporting V0 subunit e1 2 2
MIRT671291 RPL37A ribosomal protein L37a 2 2
MIRT671600 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT671611 C6orf25 megakaryocyte and platelet inhibitory receptor G6b 2 2
MIRT671769 PLA2G4A phospholipase A2 group IVA 2 2
MIRT672458 POU2F3 POU class 2 homeobox 3 2 2
MIRT672625 IGF2R insulin like growth factor 2 receptor 2 4
MIRT672805 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT673029 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674322 POLR1B RNA polymerase I subunit B 2 2
MIRT674576 KIF3A kinesin family member 3A 2 2
MIRT675032 SNX1 sorting nexin 1 2 2
MIRT675155 NDRG1 N-myc downstream regulated 1 2 2
MIRT675211 TTC9C tetratricopeptide repeat domain 9C 2 2
MIRT675221 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT678334 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT683473 RGS4 regulator of G protein signaling 4 2 3
MIRT689825 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT697534 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT697709 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT703498 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT704278 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT705829 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT708261 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT708690 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT708892 ZNF780A zinc finger protein 780A 2 2
MIRT709317 HMBOX1 homeobox containing 1 2 2
MIRT709582 LETMD1 LETM1 domain containing 1 2 2
MIRT710166 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT711301 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711508 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711644 LIPG lipase G, endothelial type 2 2
MIRT711758 CCDC59 coiled-coil domain containing 59 2 2
MIRT712005 F9 coagulation factor IX 2 2
MIRT712260 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT712796 KCTD16 potassium channel tetramerization domain containing 16 2 2
MIRT714112 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714533 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT714569 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT714940 ZNF330 zinc finger protein 330 2 2
MIRT715509 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT715573 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 2
MIRT715977 TFRC transferrin receptor 2 2
MIRT716139 LSAMP limbic system-associated membrane protein 2 2
MIRT720215 KCNK1 potassium two pore domain channel subfamily K member 1 2 2
MIRT721332 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT722069 TP53INP2 tumor protein p53 inducible nuclear protein 2 2 2
MIRT722189 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722969 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723246 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT724116 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT725378 MLXIP MLX interacting protein 2 2
MIRT733613 ANXA2 annexin A2 3 0
MIRT733614 MTOR mechanistic target of rapamycin kinase 3 0
MIRT734786 MAP1LC3B microtubule associated protein 1 light chain 3 beta 3 0
MIRT735433 MAPK1 mitogen-activated protein kinase 1 3 0
MIRT735531 SOX6 SRY-box 6 3 0
MIRT736919 BAG1 BCL2 associated athanogene 1 4 0
MIRT737360 LINC00460 long intergenic non-protein coding RNA 460 3 0
MIRT737361 AGR2 anterior gradient 2, protein disulphide isomerase family member 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-342 Acetaminophen approved 1983 Microarray rat liver 17965554 2007 down-regulated
miR-342 Carbon tetrachloride NULL 5943 Microarray rat liver 17965554 2007 down-regulated
miR-342 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-342 All-trans-retinoic acid (ATRA) approved 444795 Microarray acute promyelocytic leukemia 17260024 2008 up-regulated
miR-342 All-trans-retinoic acid (ATRA) approved 444795 Northern blot acute promyelocytic leukemia (APL) 19151778 2009 up-regulated
miR-342 All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR acute promyelocytic leukemia (APL) 19749800 2009 up-regulated
miR-342-3p Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-342-3p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-342-3p 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-342-3p Cisplatin approved 84093 Quantitative real-time PCR human squamous cell carcinoma cell line KYSE410 21743970 2011 up-regulated
miR-342-3p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-342 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-342 Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-mir-342 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-342 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-342 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-342 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-342 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-342 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-mir-342 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-342-3p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-342-3p (-)-eburnamonine 71203 NSC322920 sensitive
hsa-miR-342-3p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-342-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-342-3p (11Z)-11-(5-bromopentylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 5472472 NSC719162 sensitive
hsa-miR-342-3p (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 sensitive
hsa-miR-342-3p (1S,12R)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 335395 NSC344505 sensitive
hsa-miR-342-3p (1s,4as,6br,10s,12ar)-10-hydroxy-6a-[[(e)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxymethyl]-1,2,6b,9,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1h-picene-4a-carboxylic acid 5459259 NSC664161 sensitive
hsa-miR-342-3p (2-nitrophenyl)methyl (1s,5s,8z,12s,20r)-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyne-13-carboxylate 5469103 NSC683252 sensitive
hsa-miR-342-3p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-342-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-342-3p (2E)-2-[2-(4-bromophenyl)-2-oxoethylidene]-5-(2,4-dimethylphenyl)furan-3-one 5468713 NSC674919 sensitive
hsa-miR-342-3p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54605003 NSC639978 sensitive
hsa-miR-342-3p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-342-3p (2e)-5,6-dimethoxy-2-[(3-phenacyloxyphenyl)methylidene]-3h-inden-1-one 45028869 NSC744650 sensitive
hsa-miR-342-3p (2E)-N-[2-[[(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]ethyl]-2-[(6aS)-2-methoxy-11-oxo-3-phenylmethoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetamide 10032352 NSC728035 sensitive
hsa-miR-342-3p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-342-3p (2R,6R)-9,11-dibromo-5-oxa-10-thia-3-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 383027 NSC671009 sensitive
hsa-miR-342-3p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-342-3p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-342-3p (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-342-3p (3-bromophenyl) (e)-3-phenylprop-2-enoate 5876919 NSC700124 sensitive
hsa-miR-342-3p (3-sulfanylidene-5,6-dihydroimidazo[2,1-c][1,2,4]thiadiazol-7-yl) 2-[[4-(trifluoromethoxy)phenyl]sulfonylamino]-4,5-dihydroimidazole-1-carbodithioate 24205510 NSC736065 sensitive
hsa-miR-342-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-342-3p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-342-3p (3R,5R)-3,5-bis(4-methylphenyl)spiro[cyclohexane-4,2'-indene]-1,1',3'-trione 385845 NSC677244 sensitive
hsa-miR-342-3p (3s,8r,9s,10r,13s,14s,16e,17e)-17-hydroxyimino-16-[(4-methoxyphenyl)methylidene]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-ol 9572507 NSC718185 sensitive
hsa-miR-342-3p (3z)-1-(2,6-dichlorophenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]indol-2-one 60147866 NSC752703 sensitive
hsa-miR-342-3p (3z)-5-fluoro-3-(3,4,5-trimethoxybenzylidene)-1,3-dihydro-2h-indol-2-one 5829927 NSC737698 sensitive
hsa-miR-342-3p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-342-3p (3Z)-5,7-dichloro-3-[(E)-(3-ethoxy-2-hydroxyphenyl)methylidenehydrazinylidene]-1H-indol-2-one 135452599 NSC329277 sensitive
hsa-miR-342-3p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-342-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-342-3p (3Z,8R,9S,10R,13S,14S,17R)-17-ethynyl-10,13-dimethyl-3-(2-pyrrolidin-1-ylethoxyimino)-2,6,7,8,9,11,12,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-17-ol 6520040 NSC701574 sensitive
hsa-miR-342-3p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-3-(3,4-dimethoxyphenyl)-5-hydroxy-4h-pyrazol-1-yl]methanone 400820 NSC713326 sensitive
hsa-miR-342-3p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-342-3p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-342-3p (4z)-n-[(2-chlorobenzylidene)amino]-4-(dimethylaminohydrazono)-5-methyl-pyrazole-3-carboxamide 135545659 NSC131257 sensitive
hsa-miR-342-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-342-3p (5,7-dibromo-8-hydroxy-3-methyl-2-quinolinyl)(phenyl)methanone 370210 NSC642954 sensitive
hsa-miR-342-3p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-342-3p (5E)-3-(4-chlorophenyl)-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470241 NSC699069 sensitive
hsa-miR-342-3p (5e)-5-[[(5e)-5-[[5-[(z)-(4,4-dimethyl-5-oxopyrrolidin-2-ylidene)methyl]-4,4-dimethylpyrrol-2-yl]methylidene]-4,4-dimethyl-1-(trifluoromethylsulfonyl)pyrrol-2-yl]methylidene]-2,4,4-trimethyl-1-(triflu 5471912 NSC715335 sensitive
hsa-miR-342-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-342-3p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-342-3p (5S,8aR)-5-(4-aminoanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 363647 NSC628676 sensitive
hsa-miR-342-3p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 374326 NSC651850 sensitive
hsa-miR-342-3p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374327 NSC651851 sensitive
hsa-miR-342-3p (5z)-3-(4,7-dimethoxy-1,3-benzothiazol-2-yl)-5-[[4-(dimethylamino)phenyl]methylidene]-2-phenylimidazol-4-one 1273997 NSC711830 sensitive
hsa-miR-342-3p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-342-3p (5Z)-5-[(4-aminophenyl)methylidene]-3-[[4-[[(4Z)-4-[(4-aminophenyl)methylidene]-2-methyl-5-oxoimidazol-1-yl]amino]phthalazin-1-yl]amino]-2-methylimidazol-4-one 6412823 NSC654895 sensitive
hsa-miR-342-3p (6-acetamido-5-imino-7-methyl-8-oxo-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 377193 NSC658420 sensitive
hsa-miR-342-3p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-342-3p (6aS)-3-[3-[[(6aS)-8,8-difluoro-2-methoxy-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propoxy]-8,8-difluoro-2-methoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-11-one 24780427 NSC741459 sensitive
hsa-miR-342-3p (6aS)-3-[3-[4-[3-[[(6aS)-8,8-difluoro-2-methoxy-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propyl]piperazin-1-yl]propoxy]-8,8-difluoro-2-methoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-11-one 44204058 NSC744331 sensitive
hsa-miR-342-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-342-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-342-3p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-342-3p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-342-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(3,4,5-trimethoxyphenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5470702 NSC704614 sensitive
hsa-miR-342-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5472100 NSC716263 sensitive
hsa-miR-342-3p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-342-3p (8R,9S,13S,14S,17S)-3,17-dihydroxy-13-methyl-2-(2,2,2-trifluoroethoxy)-8,9,11,12,14,15,16,17-octahydro-7H-cyclopenta[a]phenanthren-6-one 387663 NSC681684 sensitive
hsa-miR-342-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-342-3p (8S,9S,10R,13S,14S,17S)-10,13-dimethyl-17-(2-methyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 259211 NSC88916 sensitive
hsa-miR-342-3p (e)-1-(1h-benzimidazol-2-yl)-3-(4-methylsulfanylphenyl)prop-2-en-1-one 5472117 NSC716334 sensitive
hsa-miR-342-3p (e)-1-(2,5-dimethoxyphenyl)-3-(2-fluoro-4,5-dihydroxyphenyl)prop-2-en-1-one 5471282 NSC710266 sensitive
hsa-miR-342-3p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-342-3p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-342-3p (e)-1-[(4r,5r)-1,3-dibenzyl-2-oxo-4,5-diphenyl-1,3,2lambda5-diazaphospholidin-2-yl]-3-phenylprop-2-en-1-ol 5470796 NSC705149 sensitive
hsa-miR-342-3p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-342-3p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-342-3p (e)-1-[4-[[4-anilino-6-(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613477 NSC749379 sensitive
hsa-miR-342-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-342-3p (E)-2-(3,4-dihydroxybenzoyl)-3-(1H-indol-3-yl)prop-2-enenitrile 5329275 NSC650934 sensitive
hsa-miR-342-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-342-3p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-342-3p (e)-3-chloro-3-(3,4-dimethoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387397 NSC623176 sensitive
hsa-miR-342-3p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-342-3p (ne)-n-[(3e,8r,9s,10r,13s,14s,16e)-16-[(3,4-dimethoxyphenyl)methylidene]-3-hydroxyimino-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthren-17-ylidene]hydroxylamine 9572443 NSC716260 sensitive
hsa-miR-342-3p (r,r)-diop 122582 NSC699412 sensitive
hsa-miR-342-3p (z)-1,3-diphenyl-3-triphenylplumbyloxy-prop-2-en-1-one NSC644908 sensitive
hsa-miR-342-3p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-342-3p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-342-3p [(1R,2S,6R,9Z)-9-(acetyloxymethyl)-4-(hydroxymethyl)-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradec-9-en-2-yl] 2-methylprop-2-enoate 5468206 NSC666113 sensitive
hsa-miR-342-3p [(1s,2r)-1-benzamido-3-[[(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-2-benzoyloxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl]oxy]-3-oxo-1- 16129931 NSC705435 sensitive
hsa-miR-342-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-342-3p [(1S,4R)-4-[2-[(1S,12R,18S,21S,24E,26E,35S)-18-[3-(diethylamino)propanoyloxy]-1-hydroxy-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-2,3,10,14,20-pentaoxo-11,36-dioxa-4-azatricyclo[30.3.1.04,9]hexatriaconta-16,24,26,28-tetraen-12-yl]propyl]-2-methoxycyclo 54600729 NSC643248 sensitive
hsa-miR-342-3p [(2r,3s,4r,5r)-5-(6-chloropurin-9-yl)-4-hydroxy-2-(trityloxymethyl)oxolan-3-yl] benzoate 401669 NSC715399 sensitive
hsa-miR-342-3p [(3S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-4,5-dioxo-3-(1-phenylprop-2-enyl)oxolan-3-yl] acetate 386050 NSC677617 sensitive
hsa-miR-342-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-342-3p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 sensitive
hsa-miR-342-3p [(6aS,11aR)-2,3,8-trimethoxy-6-methyl-5,11-dioxo-6a,11a-dihydroindeno[1,2-c]isoquinolin-9-yl] methanesulfonate 341886 NSC376254 sensitive
hsa-miR-342-3p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-342-3p [(8r,13s,17s)-3-benzoyloxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] 2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 5459229 NSC654894 sensitive
hsa-miR-342-3p [(8R,9S,13S,14S)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] [(8S,9R,13R,14R)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] sulfite;ethyl acetate 389907 NSC686560 sensitive
hsa-miR-342-3p [[(2S,3R,4S,5S)-5-(4-amino-2-oxopyrimidin-1-yl)-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl] hexadecyl hydrogen phosphate 499308 NSC672974 sensitive
hsa-miR-342-3p [[2-(3-anilino-3-oxopropanoyl)hydrazinyl]-[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]methyl]phosphonous acid 377948 NSC659616 sensitive
hsa-miR-342-3p [[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-[2-[3-(2-chloroanilino)-3-oxopropanoyl]hydrazinyl]methyl]phosphonous acid 377940 NSC659608 sensitive
hsa-miR-342-3p [1-(benzenesulfonyloxy)-4,13-dimethyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] acetate 386755 NSC679434 sensitive
hsa-miR-342-3p [1-[(4-methoxyphenyl)methyl]-2-oxo-5h-indeno[2,3-e]pyridin-3-yl] trifluoromethanesulfonate 397447 NSC705305 sensitive
hsa-miR-342-3p [1-[(E)-(carbamothioylhydrazinylidene)methyl]-4-methylisoquinolin-5-yl] acetate 9571611 NSC687304 sensitive
hsa-miR-342-3p [1-[[[2-amino-6-chloro-5-[(E)-hydroxyiminomethyl]pyrimidin-4-yl]amino]methyl]cyclobutyl]methanol 5468789 NSC676372 sensitive
hsa-miR-342-3p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-342-3p [2-(4-methoxyphenyl)-4-thioxo-quinazolin-3-yl] acetate 389393 NSC685459 sensitive
hsa-miR-342-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper 135484826 NSC638279 sensitive
hsa-miR-342-3p [3-(chloromethyl)indolin-1-yl]-(5,6,7-trimethoxy-1h-indol-2-yl)methanone 393954 NSC696990 sensitive
hsa-miR-342-3p [3-(difluoromethyl)-6,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl]-phenylmethanone 54612713 NSC742327 sensitive
hsa-miR-342-3p [3-(furan-2-carbonyl)-2-thioxo-imidazolidin-1-yl]-(2-furyl)methanone 396757 NSC703467 sensitive
hsa-miR-342-3p [3-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl 2-methylpropanoate;iodide 376906 NSC658088 sensitive
hsa-miR-342-3p [3-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl cyclopropanecarboxylate;iodide 376916 NSC658093 sensitive
hsa-miR-342-3p [3-[4-[3-(fluoromethylsulfonyloxy)propanoyl]piperazin-1-yl]-3-oxopropyl] fluoromethanesulfonate 383018 NSC671002 sensitive
hsa-miR-342-3p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 sensitive
hsa-miR-342-3p [3,4,5-tribenzyloxy-6-(4-methoxyphenoxy)tetrahydropyran-2-yl]methanol 380509 NSC666124 sensitive
hsa-miR-342-3p [4-(hydroxymethyl)-10-imino-3,7-dioxa-1,9-diazatricyclo[6.4.0.02,6]dodeca-8,11-dien-5-yl] dihydrogen phosphate 278767 NSC128687 sensitive
hsa-miR-342-3p [4-[(E)-[3-[(dimethylamino)methyl]-2-oxocyclohexylidene]methyl]phenyl] (E)-3-(4-chlorophenyl)prop-2-enoate 6036088 NSC693442 sensitive
hsa-miR-342-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-342-3p [4-amino-2-[(4-methoxyphenyl)amino]thiazol-5-yl]-(2-furyl)methanone 399017 NSC709438 sensitive
hsa-miR-342-3p [4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-phenylmethanone 405497 NSC722854 sensitive
hsa-miR-342-3p [5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [4-hydroxy-2-(hydroxymethyl)-5-[4-(octadecylamino)-2-oxopyrimidin-1-yl]oxolan-3-yl] hydrogen phosphate 395196 NSC699499 sensitive
hsa-miR-342-3p [5-(4-bromophenyl)-3-(1,3-diphenylpyrazol-4-yl)-3,4-dihydropyrazol-2-yl]-(4-methoxyphenyl)methanone 155808132 NSC759216 sensitive
hsa-miR-342-3p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoate 5468408 NSC669727 sensitive
hsa-miR-342-3p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-342-3p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 sensitive
hsa-miR-342-3p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-342-3p [methyl(phenylcarbamoyl)amino] N,N-dimethylcarbamodithioate 293865 NSC161128 sensitive
hsa-miR-342-3p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-342-3p {3-[(4-benzyloxycarbonylamino-butyl)-tert-butoxycarbonyl-amino]-propyl}-carbamic acid benzyl ester NSC685964 sensitive
hsa-miR-342-3p 1-(2-chloroethyl)-3-[4-[[4-[[2-chloroethyl(nitroso)carbamoyl]amino]cyclohexyl]methyl]cyclohexyl]-1-nitrosourea 285728 NSC143147 sensitive
hsa-miR-342-3p 1-(2-chlorophenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5923821 NSC668333 sensitive
hsa-miR-342-3p 1-(2-methoxyphenyl)-3-[(e)-2-pyridylmethyleneamino]thiourea 9554753 NSC668298 sensitive
hsa-miR-342-3p 1-(4-(trifluoromethyl)phenyl)-3h-[1,3]thiazolo[3,4-a]benzimidazole 362619 NSC626760 sensitive
hsa-miR-342-3p 1-(4-chlorobenzyl)-2-methyl-1h-naphtho[2,3-d]imidazole-4,9-dione 374273 NSC651774 sensitive
hsa-miR-342-3p 1-(4-chlorophenyl)-1'-methyl-3,3-diphenylspiro[azetidine-4,3'-indole]-2,2'-dione 16096361 NSC737780 sensitive
hsa-miR-342-3p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-342-3p 1-[(2r,4s,5r)-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[methoxy(methyl)phosphinothioyl]oxyoxolan-2-yl]-5-methylpyrimidine-2,4-dione 9572423 NSC716002 sensitive
hsa-miR-342-3p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-342-3p 1-[(E)-(5-hydroxypyridin-2-yl)methylideneamino]-3-pyridin-3-ylthiourea 135443616 NSC185065 sensitive
hsa-miR-342-3p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-342-3p 1-[(e)-benzylideneamino]-3-(2-phenylchroman-4-yl)thiourea 9569902 NSC623626 sensitive
hsa-miR-342-3p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-342-3p 1-[11-(4-chlorophenyl)-13-methyl-15-thia-12,17-diazatetracyclo[8.7.0.02,7.012,16]heptadeca-1(10),2,4,6,13,16-hexaen-14-yl]ethanone 388255 NSC682866 sensitive
hsa-miR-342-3p 1-[2-(2,4-dinitrophenyl)sulfonyl-1-methylene-allyl]sulfonyl-2,4-dinitro-benzene 361138 NSC623970 sensitive
hsa-miR-342-3p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-342-3p 1-[3-(4-chlorophenyl)-5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3,4-dihydropyrazol-2-yl]ethanone 72374604 NSC759004 sensitive
hsa-miR-342-3p 1-[3-[(3-aminophenyl)methoxy]phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine 419051 NSC109834 sensitive
hsa-miR-342-3p 1-[4-[5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl]piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54613116 NSC749147 sensitive
hsa-miR-342-3p 1-[8-(3-methoxyphenyl)-6,7-dimethyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]pyrrolidine 382365 NSC669884 resistant
hsa-miR-342-3p 1-adamantyl(3-(4-hydroxyphenyl)-2-oxiranyl)methanone 386287 NSC678044 sensitive
hsa-miR-342-3p 1-azido-2-phenyl-3-phenalenone 381891 NSC669152 sensitive
hsa-miR-342-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-342-3p 12-iminodaunorubicin hcl 72400 NSC254681 sensitive
hsa-miR-342-3p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-342-3p 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-342-3p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-342-3p 17-nitro-8,20-diazapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(21),2,4,6,8,10,12,14(19),15,17-decaene 438794 NSC670694 sensitive
hsa-miR-342-3p 1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) NSC659162 sensitive
hsa-miR-342-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-phenyl- 369537 NSC641394 sensitive
hsa-miR-342-3p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 sensitive
hsa-miR-342-3p 2'-bromo-4'-epi-daunorubicin 6711997 NSC650931 sensitive
hsa-miR-342-3p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 sensitive
hsa-miR-342-3p 2-(1-hydroxyethyl)thieno[3,2-f][1]benzothiole-4,8-dione 391375 NSC690432 resistant
hsa-miR-342-3p 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-[3-chloro-2-[4-(dimethylamino)phenyl]-4-oxoazetidin-1-yl]benzamide 402413 NSC716344 sensitive
hsa-miR-342-3p 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachlorobenzohydrazide 402423 NSC716354 sensitive
hsa-miR-342-3p 2-(2-acetylbenzimidazol-1-yl)-1-(4-methoxyphenyl)ethanone 384456 NSC674258 sensitive
hsa-miR-342-3p 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-342-3p 2-(2,5-dichloroanilino)benzo[f][1,3]benzothiazole-4,9-dione 377059 NSC658274 sensitive
hsa-miR-342-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 sensitive
hsa-miR-342-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-342-3p 2-(3,5-bis(chloromethyl)-4-methoxyphenyl)-4h-thiochromen-4-one 355507 NSC609259 sensitive
hsa-miR-342-3p 2-(4-((oxiran-2-yl)methoxy)styryl)-4,5-dihydrooxazole 24206038 NSC737757 sensitive
hsa-miR-342-3p 2-(4-bromophenyl)-1,3-dichloro-5,6-dimethoxy-1h-indene 360785 NSC623166 sensitive
hsa-miR-342-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-342-3p 2-(4-methylphenyl)-5-phenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399104 NSC709520 sensitive
hsa-miR-342-3p 2-(4-nitroanilino)benzo[f][1,3]benzothiazole-4,9-dione 364767 NSC631526 sensitive
hsa-miR-342-3p 2-(6-bromo-2-chloroquinolin-3-yl)-2-[(4-methoxyphenyl)amino]acetamide 402332 NSC716223 sensitive
hsa-miR-342-3p 2-(diethylaminomethyl)-4-[(10-methylindolo[3,2-b]quinolin-11-yl)amino]phenol;hydrochloride 373149 NSC649091 sensitive
hsa-miR-342-3p 2-(dimethylamino)-3-(4-methylphenyl)sulfanylnaphthalene-1,4-dione 275098 NSC121713 sensitive
hsa-miR-342-3p 2-(hydroxymethyl)-8-methyl-8-azabicyclo[3.2.1]octan-3-one NSC715572 sensitive
hsa-miR-342-3p 2-(naphthalen-2-ylamino)-1,2-diphenylethanone 411561 NSC34924 sensitive
hsa-miR-342-3p 2-[(2e)-2-[(5-bromo-2-hydroxyphenyl)methylidene]hydrazinyl]-4-methyl-1h-pyrimidin-6-one 135458781 NSC97960 sensitive
hsa-miR-342-3p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-342-3p 2-[(4-hydroxyphenyl)sulfanylmethyl]benzene-1,4-diol 384134 NSC673421 sensitive
hsa-miR-342-3p 2-[(9-amino-5-methylacridine-4-carbonyl)amino]ethyl-dimethyl-[(5-nitrothiophen-2-yl)methyl]azanium;chloride 391703 NSC691247 sensitive
hsa-miR-342-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 sensitive
hsa-miR-342-3p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxycyclohexa-2,5-diene-1,4-dione;hydrochloride 5387996 NSC630511 sensitive
hsa-miR-342-3p 2-[(e)-(dimethylhydrazono)methyl]-3-methyl-furo[2,3-f]quinolin-5-ol 5326297 NSC651003 sensitive
hsa-miR-342-3p 2-[(phenylamino)methyl]benzene-1,4-diol 403336 NSC718125 sensitive
hsa-miR-342-3p 2-[(z)-6-[2-(trifluoromethyl)phenyl]hex-3-en-1,5-diynyl]aniline 24203959 NSC730269 resistant
hsa-miR-342-3p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-342-3p 2-[[(3s,8s,9s,10r,11s,13s,14s,16s,17r)-3,11-dihydroxy-17-[(2s,3s)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1h-cyclopenta[a]phenanthren-16-yl]oxy]-6-methy 392623 NSC693185 sensitive
hsa-miR-342-3p 2-[[(E)-3-(2-chlorophenyl)prop-2-enoyl]amino]-5-iodobenzamide 53329762 NSC748148 sensitive
hsa-miR-342-3p 2-[[2-(9h-fluoren-9-ylmethoxycarbonylamino)-3-(1h-indol-3-yl)propanoyl]amino]-6-[(2-methylpropan-2-yl)oxycarbonylamino]hexanoic acid 383837 NSC672453 sensitive
hsa-miR-342-3p 2-[[4-(1h-benzimidazol-2-yl)phenyl]iminomethyl]phenol 402059 NSC715755 sensitive
hsa-miR-342-3p 2-[[amino-[bis(2-bromoethyl)amino]phosphoryl]oxymethyl]naphthalene-1,4-dione 390536 NSC688023 sensitive
hsa-miR-342-3p 2-[2-[(Z)-benzylideneamino]-6-phenylpyrimidin-4-yl]-5-methoxyphenol 135509206 NSC678882 sensitive
hsa-miR-342-3p 2-[2-[carboxymethyl-[2-(4-hydroxy-3-methoxycarbonylanilino)-2-oxoethyl]amino]ethyl-[2-(4-hydroxy-3-methoxycarbonylanilino)-2-oxoethyl]amino]acetic acid 10077122 NSC742629 sensitive
hsa-miR-342-3p 2-[3-[2-[3-(5,8-dinitro-1,3-dioxobenzo[de]isoquinolin-2-yl)propylamino]ethylamino]propyl]-5,8-dinitrobenzo[de]isoquinoline-1,3-dione;hydrochloride 355134 NSC615803 sensitive
hsa-miR-342-3p 2-[3-[4-[3-(1,3-dioxobenzo[de]isoquinolin-2-yl)propylamino]butylamino]propyl]benzo[de]isoquinoline-1,3-dione;hydrobromide 397637 NSC706000 sensitive
hsa-miR-342-3p 2-[3-methyl-N-(2-methylsulfonyloxyethyl)-4-[[4-(2-methyl-1,3-thiazol-4-yl)phenyl]iminomethyl]anilino]ethyl methanesulfonate;hydrochloride 24194270 NSC166237 sensitive
hsa-miR-342-3p 2-[4-(acridin-9-ylmethylamino)phenyl]sulfonylguanidine 335981 NSC348894 sensitive
hsa-miR-342-3p 2-[4-(methoxy)phenyltio]-3-phenyl-5,7-diamino quinoxaline 24203447 NSC728040 sensitive
hsa-miR-342-3p 2-[4-[[1-[3-(3-methoxyanilino)-3-oxopropanoyl]-3-methyl-5-oxo-4H-pyrazol-4-yl]diazenyl]phenyl]sulfonylethyl hydrogen sulfate 385612 NSC676917 sensitive
hsa-miR-342-3p 2-[4-[[2-(2,4-dinitrophenyl)hydrazinyl]diazenyl]phenyl]-1h-benzimidazole 6712853 NSC716951 sensitive
hsa-miR-342-3p 2-[4-[[4-(2-benzyl-5-methyl-1,3-thiazol-4-yl)phenyl]iminomethyl]-3-methyl-N-(2-methylsulfonyloxyethyl)anilino]ethyl methanesulfonate 322935 NSC281617 sensitive
hsa-miR-342-3p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-342-3p 2-[N-(2-methylsulfonyloxyethyl)-4-[[4-[2-(phenoxymethyl)-1,3-thiazol-4-yl]phenyl]iminomethyl]anilino]ethyl methanesulfonate 322463 NSC280074 sensitive
hsa-miR-342-3p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-342-3p 2-acetylimidazo[4,5-b]pyridin 4 tolyl 3 thiosemicarbazone 135440014 NSC674106 sensitive
hsa-miR-342-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-342-3p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-342-3p 2-amino-1-N,9-N-bis[10-[(4-methoxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129907 NSC684908 sensitive
hsa-miR-342-3p 2-amino-4-(2-hydroxy-4-methylphenyl)-5-phenylpyrimidine 392744 NSC693547 sensitive
hsa-miR-342-3p 2-amino-4-(3,4-dimethoxyphenyl)-10-methyl-5,6-dihydro-[1]benzothiepino[4,5-c]pyridine-1-carbonitrile 391881 NSC691562 sensitive
hsa-miR-342-3p 2-amino-4,6-dimethyl-3-oxo-1-N,9-N-bis[7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3,10-di(propan-2-yl)-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]phenoxazine-1,9-dicarboxamide 2019