pre-miRNA Information
pre-miRNA hsa-mir-195   
Genomic Coordinates chr17: 7017615 - 7017701
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1311315368 2 dbSNP
rs1483556117 3 dbSNP
rs1257736738 4 dbSNP
rs1230392050 6 dbSNP
rs1354352122 9 dbSNP
rs1346604530 12 dbSNP
rs761226479 14 dbSNP
rs376953960 17 dbSNP
rs767045828 19 dbSNP
rs975705809 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BPLS91 miR-195-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood Quantitative reverse transcription PCR
Gene Information
Gene Symbol ZNF280C   
Synonyms SUHW3, ZNF633
Description zinc finger protein 280C
Transcript NM_017666   
Expression
Putative miRNA Targets on ZNF280C
3'UTR of ZNF280C
(miRNA target sites are highlighted)
>ZNF280C|NM_017666|3'UTR
   1 ATTCCTGCTCCATGGAGTTCATGCAACCTGGTGCAAGACAAGTTGGAAGTTCCTAAGTTCAAAGTTCTGAAGTATTTTCT
  81 CACACAAAGGGCAGTTAAACAGCCAAGTTTATGACACTAGCTCTCATTATTCAGCTCTTTTCAGCTTTCAGATGCCACTA
 161 CATTGTTATTCCACCTTATCTTTGCGTCAGGTTAACATATCTTAACATATTTTTTTCTCCAGTTGGCTCTCTCCAAAAAT
 241 GCCTTTTGTTTTTCTCTGCTATACTTGACTTGCCTTCAGAATATTACATTCCAGATAATATGACTGTTCATCTTTTTCTG
 321 TCTGTTTTGTCTGCTTTCTTAATTTCTTATAAGTCTTACATGTTTAGGTCAGATAACCATTTTTTCTTCATTCCTTGTTC
 401 ATTACTGTTCTATTTTTCATATTTTTCAAATGAAGAAGCAACACATAAGTTTCAAAAAATATCCAGGGTACTCCTGGACA
 481 GTGTCCCCTTTTGATGGACACAACTGATACCTGTTCTTTCTTTCCAAGAAATGTGAATTATTTGACTGTGAGACGTCCTC
 561 TAGTTTGTGGCCTTCAGAAATCAGATCTTGGGGAGAGTCCCTTCCTACCTGACTGACCTCCCATAAGGCTGATGCTGATT
 641 TGGCCAGAGATGACCTCAAGGCCCACCAAATAGAGCACAACTTCCCATTGGGAGCTTTGGCTTTTGATCTTAAGCTTATG
 721 GGTCGATTCTAACCAAGAAAAGTCCATGAGATCAGTGCTTCAACATCCAGGTTGACGTTTAACCATTTTGGCTGCTGCTC
 801 TTTAATTTTCCTCTAGCAGGCATGCAGTCCAAGGAATATCAAAATTCTGATTGTATGGGAACCAAGGTTACTTTCTTGTT
 881 CTTGGATAAAGAAAATTTCTACAATTACAGTTCCCAAAGACACAGTTGTTCATGTTATTTAAAGTTTTATCCAGTATTCT
 961 AGGAATTTTCAGCAATACTAATATTCTCATTTTTAAACATTTTTTACATTTTATTTTGTTTTATTTTGGTAGCTTGGTTT
1041 TATATTGTTTTTAGATCAGTGCTTCAACATCCAGGCTGACGTTTAGCCATTTTGGCTGCTGTTCTTTAATCTTCCTCTAG
1121 CAGGCATGCAGTCCAAGGAATATCAAAATTCTGGTTGTATTGGGAACCAAGGTTACTTTCTTGTTTTTGGAAAAACAAAA
1201 TTTCTACAATTACAGTTCCCAAAGTCAGTTATTCATGTTTTCATTTAAAGTTTTATCCAATATTCTAGGAATTTTCAGCA
1281 ATACTGATATTCACTTTATTTTTTTTCTTTTTTTAAGACAGAGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGCG
1361 ATCTTGGCTCACTGCAAGCTCCGCCTCCTGGGTTCACGCCATTCTCCTGCCTCAGTCTCCCAAGTACCTGGGATGACAGG
1441 CGCCTGCCACCACGCCCGGCTAATTTTTAATTTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTAGCCAGGATGG
1521 TCTCGATCTCCTGACGTCGTGATCAGTCCGCCTCGTCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGCACCCGA
1601 CCGATACTCACATTTTTAAACTTTTTTTTTAATTTTATTTTGGTAGCTAGGTTTTATATTGTTCTTAAATTTATTTTACT
1681 CTATTTTATTTTTCCATCACTTCTTTGTCCCAGATTCATGAAATTTGCTGATGTCCATTTTATGTCTACTTTTGAACTCT
1761 TCTCTTTGTGTTTGTTTTGTTCTTATTACAAACTCCAAGACATTTCTTAGAATTGTCTACAGATTTCGTGTAGCTACTTA
1841 TTGGTAGCTTCTTAATTTCATACTTGTCCAGACCATTAGACATTATTACATGCTCTGTCTTGGGCCTATCATTAACATTA
1921 GCTTAGGGATTCTGATTTCAAAGACATAAAGAATTGGCAAAACTCTTCTTACAGAACTTAAAACAAGTTTTAAAGTTACA
2001 TTTCTATACATCTAATACATAATACCTTCTTAGCCATTAATGTAATTCCTCTGGATAAAGATAATATATTCAAAAAATAT
2081 TGGGACCAAAAAATGCACTTGTTTCTTGCTCATATATATATAGATGTATATTTTTTTTAATTTCTTGTTTGTTTATTTTG
2161 GTTACATTGAATACAGATTTGCTGAACAGTTTTGATGTTATTTTTTTAATAAAATTTGTATTGTTAAAGTGCCTTGGAAA
2241 TTTCTAATAAATAACTTCATATAAAAGCTATCATATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cgguuaUAAAGAC-ACGACGAu 5'
                ||||: | ||||||| 
Target 5' ttaaccATTTTGGCTGCTGCTc 3'
779 - 800 155.00 -15.30
2
miRNA  3' cgguuaUAAAGAC-ACGACGAu 5'
                ||||: | |||||:| 
Target 5' ttagccATTTTGGCTGCTGTTc 3'
1083 - 1104 139.00 -16.30
3
miRNA  3' cgGUUAUAAAGAC-ACGACGAu 5'
            | |||   ||| ||||| | 
Target 5' tcCCATAAGGCTGATGCTGATt 3'
619 - 640 123.00 -12.12
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs142038442 2 dbSNP
rs772365736 4 dbSNP
rs748260954 10 dbSNP
rs779341374 13 dbSNP
rs1358722180 18 dbSNP
rs185190513 25 dbSNP
rs376094415 26 dbSNP
rs1316861163 27 dbSNP
rs371843321 38 dbSNP
rs1409092048 42 dbSNP
rs756572698 49 dbSNP
rs746467219 57 dbSNP
rs1024825956 75 dbSNP
rs1217191648 85 dbSNP
rs777293566 87 dbSNP
rs1348086131 123 dbSNP
rs369127657 132 dbSNP
rs1271813929 134 dbSNP
rs113967220 140 dbSNP
rs1045748757 160 dbSNP
rs1474143013 161 dbSNP
rs929927113 162 dbSNP
rs1204415749 169 dbSNP
rs1233876566 178 dbSNP
rs1471358842 180 dbSNP
rs608117 185 dbSNP
rs1424738340 186 dbSNP
rs1454835119 199 dbSNP
rs1012455571 203 dbSNP
rs868691644 204 dbSNP
rs959328308 207 dbSNP
rs201175294 208 dbSNP
rs760109501 210 dbSNP
rs1027311599 211 dbSNP
rs1434049778 211 dbSNP
rs1273980492 217 dbSNP
rs200100871 217 dbSNP
rs565937192 222 dbSNP
rs985403428 226 dbSNP
rs1236003159 227 dbSNP
rs955288192 227 dbSNP
rs775134291 229 dbSNP
rs1207548472 236 dbSNP
rs1294831972 246 dbSNP
rs1340827561 254 dbSNP
rs1029971845 256 dbSNP
rs1274201416 261 dbSNP
rs1226230148 273 dbSNP
rs1440001830 274 dbSNP
rs896807368 283 dbSNP
rs1358589517 291 dbSNP
rs977790584 294 dbSNP
rs1469103096 298 dbSNP
rs1195705339 301 dbSNP
rs1343196278 313 dbSNP
rs535248895 320 dbSNP
rs1285859154 324 dbSNP
rs1168514175 326 dbSNP
rs1007994622 327 dbSNP
rs1403499597 346 dbSNP
rs1322698617 349 dbSNP
rs149288199 350 dbSNP
rs1442724881 352 dbSNP
rs757369999 353 dbSNP
rs1339651343 359 dbSNP
rs890855822 370 dbSNP
rs759311253 373 dbSNP
rs1310904639 377 dbSNP
rs1227536802 387 dbSNP
rs181185487 392 dbSNP
rs1342124221 404 dbSNP
rs1291485055 412 dbSNP
rs1370717721 412 dbSNP
rs1272999712 423 dbSNP
rs751732069 439 dbSNP
rs1407660700 444 dbSNP
rs1415389267 445 dbSNP
rs1446593856 454 dbSNP
rs770878048 459 dbSNP
rs1243889667 460 dbSNP
rs139525679 465 dbSNP
rs1164114424 467 dbSNP
rs1416356376 472 dbSNP
rs1418391866 473 dbSNP
rs1184707007 479 dbSNP
rs1462822901 485 dbSNP
rs1156612390 488 dbSNP
rs1001634384 497 dbSNP
rs1251299850 503 dbSNP
rs1382396832 516 dbSNP
rs1319760135 525 dbSNP
rs922247957 533 dbSNP
rs1446532200 548 dbSNP
rs1293203316 552 dbSNP
rs777583113 556 dbSNP
rs936702378 560 dbSNP
rs1046369455 582 dbSNP
rs1453371626 583 dbSNP
rs1205921860 587 dbSNP
rs1286503133 588 dbSNP
rs1290766583 590 dbSNP
rs150542819 592 dbSNP
rs375432864 595 dbSNP
rs897146088 599 dbSNP
rs1038488991 609 dbSNP
rs781669244 615 dbSNP
rs747050626 618 dbSNP
rs1291367580 623 dbSNP
rs1476118348 635 dbSNP
rs941413009 641 dbSNP
rs1229958007 648 dbSNP
rs923954990 652 dbSNP
rs911281113 660 dbSNP
rs1454036440 667 dbSNP
rs1350907977 670 dbSNP
rs1049609823 689 dbSNP
rs1287294781 702 dbSNP
rs1439618172 704 dbSNP
rs1381887546 707 dbSNP
rs1312907729 708 dbSNP
rs1356697952 710 dbSNP
rs780232989 724 dbSNP
rs933775663 725 dbSNP
rs1286900372 727 dbSNP
rs758591522 745 dbSNP
rs978407894 749 dbSNP
rs970787296 753 dbSNP
rs753419346 754 dbSNP
rs750678152 759 dbSNP
rs1404250137 772 dbSNP
rs1343064006 776 dbSNP
rs1210286794 777 dbSNP
rs779200862 782 dbSNP
rs765723538 783 dbSNP
rs1202905851 786 dbSNP
rs990704337 793 dbSNP
rs1473110601 794 dbSNP
rs1411740729 798 dbSNP
rs1183628355 804 dbSNP
rs1175698406 807 dbSNP
rs1375598808 811 dbSNP
rs1479162966 816 dbSNP
rs959467815 818 dbSNP
rs1026929899 827 dbSNP
rs989075269 829 dbSNP
rs959130978 850 dbSNP
rs1467218052 857 dbSNP
rs973973823 866 dbSNP
rs1210569978 868 dbSNP
rs1329563239 881 dbSNP
rs1267342286 887 dbSNP
rs759926941 891 dbSNP
rs1369202952 903 dbSNP
rs777289575 907 dbSNP
rs1304318392 910 dbSNP
rs1350124602 924 dbSNP
rs766922875 932 dbSNP
rs971963607 934 dbSNP
rs1435065905 937 dbSNP
rs761081699 938 dbSNP
rs1007863445 953 dbSNP
rs1024598898 955 dbSNP
rs1264967572 959 dbSNP
rs890911226 965 dbSNP
rs994809552 970 dbSNP
rs561980095 971 dbSNP
rs1447135465 980 dbSNP
rs1169066217 989 dbSNP
rs1038393202 1001 dbSNP
rs772835294 1009 dbSNP
rs1462909635 1023 dbSNP
rs1300308995 1038 dbSNP
rs771460041 1046 dbSNP
rs1392708421 1053 dbSNP
rs1416520280 1058 dbSNP
rs1426081877 1061 dbSNP
rs548647035 1062 dbSNP
rs1373379141 1067 dbSNP
rs1380613701 1068 dbSNP
rs1190848065 1070 dbSNP
rs1452629557 1076 dbSNP
rs1229493984 1078 dbSNP
rs1250023999 1081 dbSNP
rs142437791 1086 dbSNP
rs900652518 1087 dbSNP
rs889879032 1092 dbSNP
rs1463231944 1095 dbSNP
rs936942367 1096 dbSNP
rs1260080676 1102 dbSNP
rs1261777916 1106 dbSNP
rs1049810106 1111 dbSNP
rs1173145557 1114 dbSNP
rs1313763083 1119 dbSNP
rs1461250841 1119 dbSNP
rs593323 1120 dbSNP
rs768453615 1121 dbSNP
rs1396984039 1128 dbSNP
rs922408029 1140 dbSNP
rs1233168805 1154 dbSNP
rs1345118969 1156 dbSNP
rs1299254401 1162 dbSNP
rs1042335547 1167 dbSNP
rs1288419590 1179 dbSNP
rs1362738082 1183 dbSNP
rs902732781 1189 dbSNP
rs1291370935 1191 dbSNP
rs1354676640 1196 dbSNP
rs945296940 1198 dbSNP
rs1274771847 1211 dbSNP
rs1314805727 1214 dbSNP
rs1214602237 1222 dbSNP
rs1260862042 1225 dbSNP
rs1486557016 1228 dbSNP
rs1179539151 1231 dbSNP
rs749018568 1234 dbSNP
rs1475136833 1235 dbSNP
rs779822187 1238 dbSNP
rs1042379906 1242 dbSNP
rs1420451290 1243 dbSNP
rs915137378 1247 dbSNP
rs1158655418 1258 dbSNP
rs1345944324 1259 dbSNP
rs989108155 1260 dbSNP
rs1311093398 1263 dbSNP
rs1374808716 1274 dbSNP
rs958997426 1275 dbSNP
rs926408589 1290 dbSNP
rs145194991 1301 dbSNP
rs1222917654 1307 dbSNP
rs745773747 1307 dbSNP
rs1307263686 1315 dbSNP
rs1318283796 1321 dbSNP
rs1175589208 1338 dbSNP
rs971613268 1341 dbSNP
rs1278937740 1342 dbSNP
rs1024882053 1346 dbSNP
rs994318082 1358 dbSNP
rs1212211573 1359 dbSNP
rs5977225 1360 dbSNP
rs1468928988 1361 dbSNP
rs991295868 1363 dbSNP
rs1409019466 1367 dbSNP
rs1421066325 1371 dbSNP
rs1171892847 1382 dbSNP
rs592368 1397 dbSNP
rs752985747 1398 dbSNP
rs765495392 1400 dbSNP
rs937888857 1402 dbSNP
rs1352619327 1411 dbSNP
rs189751365 1427 dbSNP
rs889784576 1428 dbSNP
rs35799699 1433 dbSNP
rs1375111171 1442 dbSNP
rs1231601309 1445 dbSNP
rs1049880392 1453 dbSNP
rs752123789 1454 dbSNP
rs901227437 1455 dbSNP
rs754320201 1457 dbSNP
rs945188698 1458 dbSNP
rs893732019 1473 dbSNP
rs1209696587 1476 dbSNP
rs1436528278 1477 dbSNP
rs961287987 1500 dbSNP
rs1053622563 1502 dbSNP
rs937716529 1509 dbSNP
rs1191967536 1511 dbSNP
rs1015511110 1524 dbSNP
rs767094733 1525 dbSNP
rs1175532769 1530 dbSNP
rs1417319731 1534 dbSNP
rs1409258377 1535 dbSNP
rs184920659 1536 dbSNP
rs981913499 1537 dbSNP
rs1371209107 1545 dbSNP
rs1442492652 1547 dbSNP
rs143776467 1549 dbSNP
rs1338062884 1550 dbSNP
rs1214472426 1554 dbSNP
rs918990017 1555 dbSNP
rs1320441318 1556 dbSNP
rs1380344249 1564 dbSNP
rs1312713303 1573 dbSNP
rs1413335031 1576 dbSNP
rs1252621050 1578 dbSNP
rs973314657 1582 dbSNP
rs1469034229 1583 dbSNP
rs1201131379 1590 dbSNP
rs961535847 1594 dbSNP
rs1475078260 1596 dbSNP
rs773560164 1599 dbSNP
rs955196469 1601 dbSNP
rs759223394 1611 dbSNP
rs1163881412 1619 dbSNP
rs767078250 1628 dbSNP
rs954052922 1630 dbSNP
rs1325336206 1631 dbSNP
rs761169981 1631 dbSNP
rs192809993 1647 dbSNP
rs1430725837 1650 dbSNP
rs1028339470 1657 dbSNP
rs1342869935 1660 dbSNP
rs1231866826 1661 dbSNP
rs749569823 1667 dbSNP
rs1272896730 1682 dbSNP
rs768365715 1693 dbSNP
rs1211834079 1700 dbSNP
rs998171377 1702 dbSNP
rs901254048 1718 dbSNP
rs1216522497 1733 dbSNP
rs1414465636 1735 dbSNP
rs748928854 1737 dbSNP
rs1009848797 1744 dbSNP
rs1187010329 1746 dbSNP
rs893637087 1748 dbSNP
rs1418280720 1767 dbSNP
rs1000952740 1771 dbSNP
rs1156439378 1778 dbSNP
rs1053653264 1791 dbSNP
rs1400795794 1795 dbSNP
rs937917687 1800 dbSNP
rs902809723 1808 dbSNP
rs905090050 1818 dbSNP
rs1042618319 1819 dbSNP
rs1046507448 1826 dbSNP
rs1253460646 1828 dbSNP
rs774165939 1835 dbSNP
rs919011959 1840 dbSNP
rs896467880 1876 dbSNP
rs971833847 1878 dbSNP
rs1350168352 1881 dbSNP
rs1055105442 1883 dbSNP
rs940213960 1895 dbSNP
rs1293216840 1897 dbSNP
rs919983975 1910 dbSNP
rs148988487 1911 dbSNP
rs1258045660 1920 dbSNP
rs1443930799 1923 dbSNP
rs1179327138 1926 dbSNP
rs1362886697 1927 dbSNP
rs1352769169 1928 dbSNP
rs910034935 1944 dbSNP
rs1392694862 1946 dbSNP
rs939831074 1957 dbSNP
rs1312812174 1981 dbSNP
rs1403464678 1984 dbSNP
rs1398182830 1999 dbSNP
rs1327227690 2000 dbSNP
rs190314754 2001 dbSNP
rs184766256 2006 dbSNP
rs1295309082 2009 dbSNP
rs1458481469 2011 dbSNP
rs1345808266 2018 dbSNP
rs1028534670 2027 dbSNP
rs780938060 2060 dbSNP
rs1346976454 2066 dbSNP
rs965398968 2077 dbSNP
rs1021495836 2080 dbSNP
rs192617480 2084 dbSNP
rs1193884780 2086 dbSNP
rs1249516206 2092 dbSNP
rs1164152388 2098 dbSNP
rs748169502 2101 dbSNP
rs1180106802 2104 dbSNP
rs1009636392 2105 dbSNP
rs770788195 2108 dbSNP
rs779128463 2109 dbSNP
rs920945457 2110 dbSNP
rs1413953160 2111 dbSNP
rs1378754900 2114 dbSNP
rs762842967 2116 dbSNP
rs1323903544 2123 dbSNP
rs761433503 2123 dbSNP
rs766245219 2123 dbSNP
rs1396210463 2126 dbSNP
rs1447886112 2128 dbSNP
rs755308503 2131 dbSNP
rs186693362 2132 dbSNP
rs1418205854 2138 dbSNP
rs1247994001 2139 dbSNP
rs1440289338 2139 dbSNP
rs1313916057 2140 dbSNP
rs1192361181 2144 dbSNP
rs1488535359 2146 dbSNP
rs957354603 2147 dbSNP
rs1200236251 2148 dbSNP
rs1212412013 2155 dbSNP
rs1270912495 2156 dbSNP
rs1001969793 2159 dbSNP
rs1467724343 2160 dbSNP
rs905122640 2179 dbSNP
rs780507177 2185 dbSNP
rs1268812781 2190 dbSNP
rs1032716581 2192 dbSNP
rs1013705577 2197 dbSNP
rs1001029673 2201 dbSNP
rs756392680 2207 dbSNP
rs1372940205 2215 dbSNP
rs12848296 2219 dbSNP
rs12848294 2224 dbSNP
rs1466482224 2233 dbSNP
rs1269230109 2255 dbSNP
rs1392593502 2258 dbSNP
rs1238800030 2261 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 5'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgguuauaaAGACACGACGAu 5'
                   ||  ||:|||| 
Target 5' ccgggggagTCGCTGTTGCTg 3'
12 - 32
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.346 6.8e-4 0.266 7.5e-3 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.586 1.6e-3 -0.299 8.3e-2 23 Click to see details
GSE19783 ER- ER- breast cancer -0.27 8.1e-3 -0.304 3.2e-3 79 Click to see details
GSE19536 Breast cancer -0.226 1.2e-2 -0.266 3.7e-3 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.466 1.9e-2 -0.412 3.6e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.425 1.9e-2 0.197 1.8e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.535 3.0e-2 -0.604 1.4e-2 13 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.621 3.7e-2 -0.733 1.2e-2 9 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.275 9.2e-2 -0.048 4.1e-1 25 Click to see details
GSE28544 Breast cancer 0.249 1.2e-1 0.274 9.8e-2 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.273 1.2e-1 0.343 6.9e-2 20 Click to see details
GSE14794 Lymphoblastoid cells 0.103 1.7e-1 0.070 2.6e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.17 3.0e-1 0.231 2.4e-1 12 Click to see details
GSE38226 Liver fibrosis -0.114 3.1e-1 -0.191 2.0e-1 21 Click to see details
GSE27834 Pluripotent stem cells -0.115 3.4e-1 -0.132 3.1e-1 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.066 3.8e-1 0.001 5.0e-1 25 Click to see details
GSE17306 Multiple myeloma 0.044 3.8e-1 0.072 3.1e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.027 4.2e-1 -0.023 4.3e-1 64 Click to see details
GSE32688 Pancreatic cancer -0.007 4.8e-1 -0.051 3.9e-1 32 Click to see details
GSE21849 B cell lymphoma -0.003 4.9e-1 -0.030 4.4e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA 0.711 0.01 0.718 0.01 11 Click to see details
STAD -0.376 0.02 -0.417 0.01 32 Click to see details
KICH 0.417 0.02 0.393 0.03 25 Click to see details
LUSC -0.322 0.02 -0.463 0 38 Click to see details
BRCA 0.187 0.04 0.169 0.06 84 Click to see details
KIRC 0.175 0.08 0.152 0.11 68 Click to see details
HNSC 0.212 0.09 0.073 0.32 42 Click to see details
LIHC -0.178 0.11 -0.149 0.15 49 Click to see details
CHOL -0.385 0.15 -0.400 0.14 9 Click to see details
THCA 0.131 0.16 0.077 0.28 59 Click to see details
KIRP 0.127 0.24 0.065 0.36 32 Click to see details
CESC -0.613 0.29 -0.500 0.33 3 Click to see details
PRAD 0.057 0.35 0.025 0.43 50 Click to see details
UCEC -0.083 0.37 -0.128 0.3 19 Click to see details
PCPG -0.374 0.38 -0.500 0.33 3 Click to see details
PAAD -0.194 0.4 -0.400 0.3 4 Click to see details
COAD -0.093 0.41 -0.167 0.35 8 Click to see details
LUAD 0.045 0.44 0.077 0.41 12 Click to see details
BLCA -0.035 0.45 -0.005 0.49 18 Click to see details
BLCA -0.035 0.45 -0.005 0.49 18 Click to see details
BLCA -0.035 0.45 -0.005 0.49 18 Click to see details
618 hsa-miR-195-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 G2 checkpoint kinase 13 8
MIRT000223 E2F3 E2F transcription factor 3 5 3
MIRT000224 CDK6 cyclin dependent kinase 6 6 4
MIRT000225 CCND1 cyclin D1 6 8
MIRT000785 BCL2L11 BCL2 like 11 2 1
MIRT000795 MECP2 methyl-CpG binding protein 2 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 7 16
MIRT004390 SKI SKI proto-oncogene 4 4
MIRT004669 CCL4 C-C motif chemokine ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 BCL2, apoptosis regulator 5 3
MIRT006077 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 3 2
MIRT006080 RUNX2 runt related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 member 3 4 5
MIRT006245 TBCCD1 TBCC domain containing 1 3 2
MIRT006246 CCND3 cyclin D3 2 2
MIRT006252 CDK4 cyclin dependent kinase 4 2 2
MIRT006995 CDC42 cell division cycle 42 3 2
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 5 7
MIRT007370 BCL2L2 BCL2 like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase like vesicle associated 1 1
MIRT044860 AGER advanced glycosylation end-product specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 2 4
MIRT044862 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamate rich protein like 2 1 1
MIRT044872 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT053194 DICER1 dicer 1, ribonuclease III 3 2
MIRT053228 FASN fatty acid synthase 5 5
MIRT053467 ARL2 ADP ribosylation factor like GTPase 2 4 1
MIRT054417 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT054418 WNT7A Wnt family member 7A 2 1
MIRT054890 MYB MYB proto-oncogene, transcription factor 3 1
MIRT054904 ATG14 autophagy related 14 4 3
MIRT055424 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055817 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057517 CEP55 centrosomal protein 55 2 8
MIRT057735 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057909 STXBP3 syntaxin binding protein 3 1 1
MIRT061007 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061249 AMOTL1 angiomotin like 1 2 12
MIRT061531 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063399 ETNK1 ethanolamine kinase 1 1 1
MIRT064688 CCND2 cyclin D2 2 4
MIRT065716 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066296 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066314 USP15 ubiquitin specific peptidase 15 2 2
MIRT068658 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071211 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072825 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074533 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075254 SNTB2 syntrophin beta 2 2 4
MIRT075277 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075896 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076795 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077785 MINK1 misshapen like kinase 1 1 1
MIRT078285 RPS6KB1 ribosomal protein S6 kinase B1 5 3
MIRT079658 NAPG NSF attachment protein gamma 2 12
MIRT080014 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082988 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083269 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084465 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085217 CCNT2 cyclin T2 1 1
MIRT086012 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087426 ZNRF3 zinc and ring finger 3 2 2
MIRT087557 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088106 SEPT2 septin 2 1 1
MIRT089111 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089211 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090450 CDV3 CDV3 homolog 1 1
MIRT090691 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091673 RARB retinoic acid receptor beta 2 6
MIRT092195 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092213 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093687 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095434 PURA purine rich element binding protein A 1 1
MIRT096238 CANX calnexin 2 2
MIRT098830 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT100210 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100368 HSPA1B heat shock protein family A (Hsp70) member 1B 2 7
MIRT100571 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100899 CD2AP CD2 associated protein 2 2
MIRT102439 CALU calumenin 2 3
MIRT102635 UBN2 ubinuclein 2 2 11
MIRT102973 EN2 engrailed homeobox 2 2 6
MIRT103096 MAFK MAF bZIP transcription factor K 2 5
MIRT103858 FOXK1 forkhead box K1 2 3
MIRT104019 USP42 ubiquitin specific peptidase 42 2 6
MIRT104235 DMTF1 cyclin D binding myb like transcription factor 1 2 3
MIRT106297 ZFHX4 zinc finger homeobox 4 2 6
MIRT106736 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107220 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107688 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT108985 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109244 ZNF275 zinc finger protein 275 2 2
MIRT110056 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112974 LUZP1 leucine zipper protein 1 2 6
MIRT114927 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117659 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120683 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT125925 PDCD4 programmed cell death 4 1 1
MIRT127735 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128805 UBE4A ubiquitination factor E4A 1 1
MIRT129059 ARCN1 archain 1 1 1
MIRT130383 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131102 TMEM138 transmembrane protein 138 1 1
MIRT132746 RASSF5 Ras association domain family member 5 1 1
MIRT132836 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133339 BCL7A BCL tumor suppressor 7A 1 1
MIRT137521 RCOR1 REST corepressor 1 1 1
MIRT140151 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140827 SMAD3 SMAD family member 3 1 1
MIRT141246 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141285 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142244 DCTN5 dynactin subunit 5 2 9
MIRT144030 PSKH1 protein serine kinase H1 1 1
MIRT145386 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146023 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146359 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146502 SNX11 sorting nexin 11 1 1
MIRT148310 RNF138 ring finger protein 138 1 1
MIRT150358 IER2 immediate early response 2 1 1
MIRT152285 TNFSF9 TNF superfamily member 9 2 3
MIRT152512 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152753 KIF3B kinesin family member 3B 1 1
MIRT152932 NOL4L nucleolar protein 4 like 2 3
MIRT154051 RASSF2 Ras association domain family member 2 2 2
MIRT154403 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156463 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158529 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT159005 EPT1 selenoprotein I 1 1
MIRT159592 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160173 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163261 PRKCD protein kinase C delta 1 1
MIRT164271 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164961 TADA2B transcriptional adaptor 2B 1 1
MIRT165180 GRAMD3 GRAM domain containing 2B 2 3
MIRT165896 CREBRF CREB3 regulatory factor 2 3
MIRT168591 HMGA1 high mobility group AT-hook 1 3 2
MIRT168685 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169070 IRF4 interferon regulatory factor 4 1 1
MIRT170158 KLHDC10 kelch domain containing 10 1 1
MIRT170740 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171604 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172819 HMBOX1 homeobox containing 1 1 1
MIRT174792 RNF38 ring finger protein 38 1 1
MIRT175236 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175527 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179012 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180911 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186374 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189763 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189964 AGO4 argonaute 4, RISC catalytic component 3 2
MIRT190187 GPR180 G protein-coupled receptor 180 2 6
MIRT191457 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191628 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194241 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194907 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196278 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196455 TAOK1 TAO kinase 1 2 2
MIRT201458 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204596 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204627 MOB4 MOB family member 4, phocein 2 8
MIRT204743 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206022 NUP50 nucleoporin 50 2 7
MIRT211200 FGF2 fibroblast growth factor 2 5 4
MIRT211316 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212610 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217747 TBPL1 TATA-box binding protein like 1 2 3
MIRT223692 FZD6 frizzled class receptor 6 2 6
MIRT224968 BAG4 BCL2 associated athanogene 4 2 2
MIRT229349 ZNF449 zinc finger protein 449 2 2
MIRT229863 YIPF6 Yip1 domain family member 6 2 2
MIRT230122 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234345 MSL1 male specific lethal 1 homolog 2 8
MIRT245006 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246940 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247239 ELK4 ELK4, ETS transcription factor 2 4
MIRT247370 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248555 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248768 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249452 ZNF691 zinc finger protein 691 2 4
MIRT251494 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255337 SRPRB SRP receptor beta subunit 2 5
MIRT256310 CDC42SE2 CDC42 small effector 2 2 2
MIRT258413 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265058 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265078 CHEK1 checkpoint kinase 1 5 4
MIRT267256 TMEM109 transmembrane protein 109 1 1
MIRT267531 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270456 SIRT4 sirtuin 4 1 1
MIRT270555 SETD1B SET domain containing 1B 2 2
MIRT273668 HOXC8 homeobox C8 2 2
MIRT274744 RAB3IP RAB3A interacting protein 2 2
MIRT277508 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282537 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286970 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289633 CBX2 chromobox 2 2 2
MIRT294286 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295814 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297781 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300108 STRADB STE20-related kinase adaptor beta 4 3
MIRT300997 MTMR3 myotubularin related protein 3 2 2
MIRT302617 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302828 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307144 CTDSPL CTD small phosphatase like 2 4
MIRT313678 ITGA2 integrin subunit alpha 2 2 2
MIRT314054 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317724 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319334 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320630 ZNRF2 zinc and ring finger 2 2 2
MIRT324841 IFT74 intraflagellar transport 74 1 1
MIRT326305 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327966 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367267 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT437657 ALOX12 arachidonate 12-lipoxygenase, 12S type 2 1
MIRT437658 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437659 CGNL1 cingulin like 1 2 1
MIRT437660 KIF21A kinesin family member 21A 2 1
MIRT437661 RASGEF1B RasGEF domain family member 1B 2 1
MIRT437662 TUFT1 tuftelin 1 2 1
MIRT437663 PDIA6 protein disulfide isomerase family A member 6 4 5
MIRT437664 SNX16 sorting nexin 16 4 7
MIRT437665 TRIP10 thyroid hormone receptor interactor 10 2 1
MIRT437792 CDC25A cell division cycle 25A 4 4
MIRT437793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 3 2
MIRT438296 INSR insulin receptor 3 1
MIRT438377 ELN elastin 3 1
MIRT438609 RET ret proto-oncogene 1 1
MIRT438896 Bace1 beta-secretase 1 1 1
MIRT443814 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446505 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447775 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448444 TLL1 tolloid like 1 2 2
MIRT449187 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451836 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453285 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453751 CSNK1E casein kinase 1 epsilon 2 2
MIRT454967 TPM2 tropomyosin 2 2 2
MIRT456864 ZNF460 zinc finger protein 460 2 10
MIRT460221 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460435 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461561 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463166 ZNF367 zinc finger protein 367 2 10
MIRT464664 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464747 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465164 TSC22D2 TSC22 domain family member 2 2 2
MIRT465567 TOB2 transducer of ERBB2, 2 2 2
MIRT465928 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466011 TMEM189 transmembrane protein 189 2 8
MIRT466295 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466434 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466919 STK38 serine/threonine kinase 38 2 10
MIRT466999 SSRP1 structure specific recognition protein 1 2 5
MIRT468056 SIK1 salt inducible kinase 1 2 3
MIRT468148 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468678 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469087 RNF168 ring finger protein 168 2 2
MIRT469412 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471036 PISD phosphatidylserine decarboxylase 2 10
MIRT471493 PDE4D phosphodiesterase 4D 2 4
MIRT471953 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472264 NFIC nuclear factor I C 2 2
MIRT472666 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474317 LAMC1 laminin subunit gamma 1 2 2
MIRT474832 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475066 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475120 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475536 HOXA3 homeobox A3 2 8
MIRT475717 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475840 HDGF heparin binding growth factor 2 4
MIRT476257 GNB1 G protein subunit beta 1 2 7
MIRT476274 GNAL G protein subunit alpha L 2 6
MIRT476697 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477562 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477846 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478909 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479985 CARD10 caspase recruitment domain family member 10 2 2
MIRT481180 AVL9 AVL9 cell migration associated 2 6
MIRT482115 AKT3 AKT serine/threonine kinase 3 2 4
MIRT482372 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482552 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482579 ABHD2 abhydrolase domain containing 2 2 2
MIRT484775 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485217 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487391 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492712 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494349 CASKIN1 CASK interacting protein 1 2 2
MIRT495144 ZNRF1 zinc and ring finger 1 2 2
MIRT496016 CD180 CD180 molecule 2 2
MIRT497773 KIAA0895 KIAA0895 2 2
MIRT498981 ORC4 origin recognition complex subunit 4 2 8
MIRT499453 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499617 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500094 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500323 ZNF622 zinc finger protein 622 2 9
MIRT500421 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500577 USP53 ubiquitin specific peptidase 53 2 2
MIRT500862 SYPL1 synaptophysin like 1 2 8
MIRT500939 SRPR SRP receptor alpha subunit 2 7
MIRT500950 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501086 SMAD7 SMAD family member 7 3 9
MIRT501503 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502037 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502149 KIF5B kinesin family member 5B 2 9
MIRT502499 FAM122B family with sequence similarity 122B 2 8
MIRT502569 E2F7 E2F transcription factor 7 2 11
MIRT502647 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502917 CDCA4 cell division cycle associated 4 2 9
MIRT502949 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503145 ATG9A autophagy related 9A 2 7
MIRT504335 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504537 ZNF620 zinc finger protein 620 2 6
MIRT504853 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505117 YTHDC1 YTH domain containing 1 2 6
MIRT505347 TMEM245 transmembrane protein 245 2 6
MIRT505397 TMEM100 transmembrane protein 100 2 2
MIRT505503 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505685 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505909 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505927 RCAN3 RCAN family member 3 2 4
MIRT506109 PPIG peptidylprolyl isomerase G 2 6
MIRT506134 PLRG1 pleiotropic regulator 1 2 4
MIRT506167 PLAG1 PLAG1 zinc finger 2 9
MIRT506193 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506489 MYO5A myosin VA 2 7
MIRT506855 KIF23 kinesin family member 23 2 7
MIRT507000 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507821 CDK1 cyclin dependent kinase 1 2 6
MIRT507851 CCNE2 cyclin E2 2 6
MIRT507880 CBX6 chromobox 6 2 2
MIRT508038 AXIN2 axin 2 2 6
MIRT508642 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509365 DMPK DM1 protein kinase 2 11
MIRT509691 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510044 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511844 GPATCH8 G-patch domain containing 8 2 5
MIRT512284 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512643 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513859 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514023 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT518092 TRIM35 tripartite motif containing 35 2 2
MIRT518531 FLCN folliculin 2 6
MIRT518995 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521204 SBNO1 strawberry notch homolog 1 2 6
MIRT521813 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522101 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522776 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537816 EFNB2 ephrin B2 2 4
MIRT539900 RPL14 ribosomal protein L14 2 4
MIRT540844 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541220 HOXA10 homeobox A10 2 2
MIRT541431 CBX4 chromobox 4 5 4
MIRT542807 PHC3 polyhomeotic homolog 3 2 3
MIRT542834 PDCD1 programmed cell death 1 2 7
MIRT543060 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543080 APP amyloid beta precursor protein 2 2
MIRT543307 ZNF585B zinc finger protein 585B 2 2
MIRT543409 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543526 PRSS21 protease, serine 21 2 2
MIRT543798 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543836 GSG1 germ cell associated 1 2 2
MIRT544572 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544590 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544913 CLSPN claspin 2 2
MIRT544966 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545187 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545348 CCDC83 coiled-coil domain containing 83 2 2
MIRT545683 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545956 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545976 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546115 USP48 ubiquitin specific peptidase 48 2 4
MIRT546606 SALL1 spalt like transcription factor 1 2 4
MIRT546618 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546637 RTN4 reticulon 4 2 2
MIRT547064 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547129 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547232 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547301 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547410 MKX mohawk homeobox 2 2
MIRT547461 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547550 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547665 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547701 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547971 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547997 HCFC2 host cell factor C2 2 4
MIRT548016 GRB2 growth factor receptor bound protein 2 2 4
MIRT548221 FKBP1A FK506 binding protein 1A 2 2
MIRT548277 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548728 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548805 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548948 CDK17 cyclin dependent kinase 17 2 3
MIRT549079 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549126 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549277 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549387 AMOT angiomotin 2 2
MIRT550403 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550467 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550616 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550824 FAM229B family with sequence similarity 229 member B 2 2
MIRT551380 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551618 ZNF267 zinc finger protein 267 2 2
MIRT551738 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552036 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552345 ZNF704 zinc finger protein 704 2 2
MIRT552750 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553440 TPM3 tropomyosin 3 2 2
MIRT553563 TMEM161B transmembrane protein 161B 2 2
MIRT553617 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553773 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553810 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554701 RNF149 ring finger protein 149 2 2
MIRT554963 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555033 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555148 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555226 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555277 PRDM4 PR/SET domain 4 2 2
MIRT555437 PPAP2B phospholipid phosphatase 3 2 2
MIRT556384 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556854 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557282 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557481 GPR27 G protein-coupled receptor 27 2 4
MIRT558038 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558508 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558590 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558663 CNKSR3 CNKSR family member 3 2 2
MIRT559012 CA8 carbonic anhydrase 8 2 2
MIRT559157 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559532 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560853 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561151 KRT33B keratin 33B 2 2
MIRT561401 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561875 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562028 LANCL1 LanC like 1 2 2
MIRT562202 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562878 KIAA1456 KIAA1456 2 2
MIRT563087 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563504 DLGAP3 DLG associated protein 3 2 2
MIRT563702 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563846 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563897 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564333 CCNT1 cyclin T1 2 2
MIRT564479 ZNF391 zinc finger protein 391 2 2
MIRT564553 CCDC80 coiled-coil domain containing 80 2 2
MIRT564841 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564951 XKR7 XK related 7 2 2
MIRT564988 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565043 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565396 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566121 RASEF RAS and EF-hand domain containing 2 2
MIRT566651 NCKAP1 NCK associated protein 1 2 2
MIRT566832 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567020 KLHL15 kelch like family member 15 2 2
MIRT567447 GNG12 G protein subunit gamma 12 2 2
MIRT567478 FZD9 frizzled class receptor 9 2 2
MIRT568022 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568144 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568471 ARMC12 armadillo repeat containing 12 2 2
MIRT568573 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568623 ACVR2A activin A receptor type 2A 2 2
MIRT570465 TLK1 tousled like kinase 1 2 3
MIRT571120 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571284 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571429 RIF1 replication timing regulatory factor 1 2 2
MIRT571661 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571829 PHF19 PHD finger protein 19 2 2
MIRT574058 PROSC pyridoxal phosphate binding protein 2 2
MIRT574204 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574596 N4BP1 NEDD4 binding protein 1 2 3
MIRT575883 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575925 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576097 Pdcd1 programmed cell death 1 2 5
MIRT576597 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614701 TRAK1 trafficking kinesin protein 1 2 2
MIRT616468 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618897 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT619615 RNF41 ring finger protein 41 2 2
MIRT621499 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640539 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645511 BSPRY B-box and SPRY domain containing 2 2
MIRT646596 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648785 KLHL40 kelch like family member 40 2 2
MIRT655813 NOTCH2 notch 2 2 3
MIRT658794 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659257 CUL3 cullin 3 2 2
MIRT680983 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682282 RS1 retinoschisin 1 2 2
MIRT682515 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691710 FLOT2 flotillin 2 2 3
MIRT693931 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701507 NEGR1 neuronal growth regulator 1 2 2
MIRT702093 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702874 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713420 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714439 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716433 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717462 ADORA3 adenosine A3 receptor 2 2
MIRT720148 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725128 SYNRG synergin gamma 2 2
MIRT726004 ZNF91 zinc finger protein 91 1 1
MIRT726082 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726125 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726130 CHMP3 charged multivesicular body protein 3 1 1
MIRT726141 VCL vinculin 1 1
MIRT726155 USP3 ubiquitin specific peptidase 3 1 1
MIRT726163 USP31 ubiquitin specific peptidase 31 1 1
MIRT726219 TUBB tubulin beta class I 1 1
MIRT726235 TRAM1 translocation associated membrane protein 1 1 1
MIRT726277 TMEM69 transmembrane protein 69 1 1
MIRT726285 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726304 TMEM135 transmembrane protein 135 1 1
MIRT726316 TLE4 transducin like enhancer of split 4 1 1
MIRT726319 TKTL1 transketolase like 1 1 1
MIRT726323 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726335 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726346 TCF3 transcription factor 3 1 1
MIRT726354 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726365 TBC1D20 TBC1 domain family member 20 1 1
MIRT726370 TBC1D14 TBC1 domain family member 14 1 1
MIRT726382 TASP1 taspase 1 1 1
MIRT726408 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726419 STX17 syntaxin 17 1 1
MIRT726453 SRPK1 SRSF protein kinase 1 1 1
MIRT726460 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726480 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726504 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726508 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726542 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726546 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726675 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726678 RPS5 ribosomal protein S5 1 1
MIRT726682 RPL36 ribosomal protein L36 1 1
MIRT726710 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726714 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726717 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726754 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726760 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726770 RELT RELT, TNF receptor 1 1
MIRT726786 RAP2C RAP2C, member of RAS oncogene family 4 1
MIRT726809 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726824 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726851 PSMB5 proteasome subunit beta 5 1 1
MIRT726872 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726899 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726908 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726965 PGD phosphogluconate dehydrogenase 1 1
MIRT726972 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727019 PANK1 pantothenate kinase 1 1 1
MIRT727025 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727036 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727065 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727094 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727135 MTMR4 myotubularin related protein 4 1 1
MIRT727151 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727174 MLXIP MLX interacting protein 1 1
MIRT727196 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727220 MED11 mediator complex subunit 11 1 1
MIRT727226 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727260 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727265 LRRC57 leucine rich repeat containing 57 1 1
MIRT727269 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727295 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727346 KLC2 kinesin light chain 2 1 1
MIRT727375 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727384 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727423 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727480 HYOU1 hypoxia up-regulated 1 1 1
MIRT727521 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727582 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727603 GANAB glucosidase II alpha subunit 1 1
MIRT727616 GABARAP GABA type A receptor-associated protein 1 1
MIRT727645 FRYL FRY like transcription coactivator 1 1
MIRT727698 FAM73A mitoguardin 1 1 1
MIRT727717 AMER1 APC membrane recruitment protein 1 1 1
MIRT727812 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727854 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727857 DPP8 dipeptidyl peptidase 8 1 1
MIRT727864 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727907 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727911 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727914 CUL2 cullin 2 1 1
MIRT727922 CSDE1 cold shock domain containing E1 1 1
MIRT727934 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727950 CPNE1 copine 1 1 1
MIRT727997 RHOV ras homolog family member V 1 1
MIRT728003 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728017 CDC27 cell division cycle 27 1 1
MIRT728044 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728089 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728098 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728125 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728129 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728192 BSG basigin (Ok blood group) 1 1
MIRT728236 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728263 ATP13A3 ATPase 13A3 1 1
MIRT728287 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728327 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728381 AFF4 AF4/FMR2 family member 4 1 1
MIRT728397 ACOX1 acyl-CoA oxidase 1 1 1
MIRT732257 NKD1 naked cuticle homolog 1 3 1
MIRT734040 CTBP1-AS CTBP1 antisense RNA 3 0
MIRT735246 SGK1 serum/glucocorticoid regulated kinase 1 5 0
MIRT735431 YAP1 Yes associated protein 1 8 1
MIRT736810 GPER1 G protein-coupled estrogen receptor 1 3 0
MIRT755496 FOSL1 FOS like 1, AP-1 transcription factor subunit 3 1
MIRT755897 SNHG1 small nucleolar RNA host gene 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-195 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-195 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-195 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-195 Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-195 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-195 Aidi injection NULL NULL Quantitative real-time PCR human breast cancer cells 21563499 2011 up-regulated
miR-195 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-195 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-195 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-195 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-195 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-195 Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-195 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-195 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-195 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-195-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 resistant
hsa-miR-195-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 resistant
hsa-miR-195-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 resistant
hsa-miR-195-5p (2-azanidylcyclohexyl)azanide;tetrachloroplatinum(2+) 430475 NSC363813 resistant
hsa-miR-195-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-195-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-195-5p (3-sulfanylidene-5,6-dihydroimidazo[2,1-c][1,2,4]thiadiazol-7-yl) 2-[[4-(trifluoromethoxy)phenyl]sulfonylamino]-4,5-dihydroimidazole-1-carbodithioate 24205510 NSC736065 sensitive
hsa-miR-195-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 resistant
hsa-miR-195-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 resistant
hsa-miR-195-5p (4e)-2-(2-hydroxybenzoyl)-5-methyl-4-[(3,4,5-trimethoxyphenyl)methylene]pyrazol-3-one 5467421 NSC652182 sensitive
hsa-miR-195-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-195-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-195-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 resistant
hsa-miR-195-5p [3-methoxy-2-[methyl(octadecyl)amino]propyl] 2-(trimethylazaniumyl)ethyl phosphate 131966 NSC643826 resistant
hsa-miR-195-5p [3,4,5-triacetyloxy-6-[5-[(2-methoxyphenyl)methyl]-3-phenyl-6-sulfanylidene-1,2,4-triazin-1-yl]oxan-2-yl]methyl acetate 362262 NSC625873 sensitive
hsa-miR-195-5p [4-[[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]methyl]phenyl]-phenylmethanone;(Z)-but-2-enedioic acid 5351430 NSC676963 resistant
hsa-miR-195-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 sensitive
hsa-miR-195-5p 1-(2-chloro-6-fluorophenyl)-6-methoxy-1,3-dihydro-[1,3]thiazolo[3,4-a]benzimidazole 396040 NSC701312 sensitive
hsa-miR-195-5p 1-(4,8-dioxothieno[2,3-f][1]benzothiol-2-yl)ethyl acetate 388025 NSC682450 sensitive
hsa-miR-195-5p 1-[(z)-(4-methoxyphenyl)methylideneamino]-3-naphthalen-1-ylurea 5914027 NSC680934 sensitive
hsa-miR-195-5p 1-[4-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406508 NSC724635 resistant
hsa-miR-195-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 resistant
hsa-miR-195-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 resistant
hsa-miR-195-5p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 resistant
hsa-miR-195-5p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 resistant
hsa-miR-195-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 resistant
hsa-miR-195-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethylamino]-5-methoxy-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2(7),3,5,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392061 NSC691851 resistant
hsa-miR-195-5p 1h-indole, 5-bromo-3-[2-(2-pyridinyl)-4-thiazolyl]- 397551 NSC705871 resistant
hsa-miR-195-5p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-195-5p 2-(3-ethoxy-4-hydroxyphenyl)-3-[2-[2-(3-ethoxy-4-hydroxyphenyl)-4-oxo-1,3-thiazolidin-3-yl]-[1,3]thiazolo[5,4-f][1,3]benzothiazol-6-yl]-1,3-thiazolidin-4-one 398511 NSC708422 sensitive
hsa-miR-195-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-195-5p 2-(4-aminobutyl)-1,4-dihydroxyanthracene-9,10-dione;hydrochloride 439019 NSC699139 resistant
hsa-miR-195-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-195-5p 2-[(z)-6-(2-fluorophenyl)hex-3-en-1,5-diynyl]aniline 24204954 NSC733691 sensitive
hsa-miR-195-5p 2-[[1-[[(1r,4s,5r,8s,9r,10s,12r,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadecan-10-yl]oxy]-3-[[(1r,4s,5r,8s,9r,10s,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[ 45027898 NSC735846 resistant
hsa-miR-195-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-195-5p 2-[2-[(z)-1-benzamido-2-(2-hydroxyphenyl)vinyl]-5-oxo-oxazolidin-4-yl]acetic acid 6477540 NSC686413 sensitive
hsa-miR-195-5p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-195-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-195-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-195-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 resistant
hsa-miR-195-5p 2-mercapto-6-(2-phenylhydrazino)-4-pyrimidinol 3005146 NSC677260 resistant
hsa-miR-195-5p 2-methyl-4-methoxy-5-piperidino-6h-furo[2,3-c]xanthen-6-one 389281 NSC685034 resistant
hsa-miR-195-5p 2-phenyl-12-amino-4h-1-oxa-7-azabenz[a]anthracen-4-one 385046 NSC675967 resistant
hsa-miR-195-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-195-5p 2,4-diethoxyestra-1,3,5(10)trien-3,17.beta.-diol 388044 NSC682505 sensitive
hsa-miR-195-5p 2,6-bis[1-(3-ethylthioureidoimino)ethyl]pyridine 6393657 NSC668337 resistant
hsa-miR-195-5p 2,6-dipyridin-2-ylpyridine;4-methylpyridine;platinum(2+);tetrafluoroborate 24202574 NSC694500 resistant
hsa-miR-195-5p 3-(4-chlorophenyl)thieno[2,3-b]pyrrolizin-8-one 388525 NSC683509 sensitive
hsa-miR-195-5p 3-(9-amino-4-methoxy-6-methyl-7,8-dihydro-5h-[1,3]dioxolo[4,5-g]isoquinolin-5-yl)-6,7-dimethoxy-3h-2-benzofuran-1-one;hydrochloride 45028024 NSC740642 sensitive
hsa-miR-195-5p 3-[(3-chlorophenyl)methyl]-5-methyl-4-oxo-N-phenylthieno[2,3-d]pyrimidine-6-carboxamide 1191776 NSC732903 sensitive
hsa-miR-195-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-195-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-195-5p 3-N',5-N'-bis(2-hydroxybenzoyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarbohydrazide 377030 NSC658247 sensitive
hsa-miR-195-5p 3,4-diphenylisoxazolo[3,4-d]pyridazin-7(6h)-one 54613569 NSC749505 sensitive
hsa-miR-195-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 resistant
hsa-miR-195-5p 4-(4-fluorophenyl)-2-[8-[[4-(4-fluorophenyl)-5-propyl-1h-imidazol-2-yl]sulfanyl]octylsulfanyl]-5-propyl-1h-imidazole;methanesulfonic acid 374589 NSC652562 sensitive
hsa-miR-195-5p 4-[(4-methyl-1,2-oxazol-5-yl)amino]naphthalene-1,2-dione 384244 NSC673785 sensitive
hsa-miR-195-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 sensitive
hsa-miR-195-5p 4-[2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethyl]benzene-1,2-diol 24205774 NSC736609 resistant
hsa-miR-195-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-195-5p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 resistant
hsa-miR-195-5p 4,4-dibromo-1-(3-bromo-4-methylpentyl)cyclopentene 382925 NSC670802 resistant
hsa-miR-195-5p 4,4,4-trifluoro-3-hydroxy-1-(3-hydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1h-cyclopenta[a]phenanthren-17-yl)butan-1-one NSC45236 resistant
hsa-miR-195-5p 5-[(E)-3-[4-(diethylamino)phenyl]prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 6376062 NSC684567 sensitive
hsa-miR-195-5p 5-[[4-[5-(4-chloroanilino)-1,3,4-thiadiazol-2-yl]anilino]methyl]-n-(4-chlorophenyl)-1,3,4-thiadiazol-2-amine NSC697140 resistant
hsa-miR-195-5p 5-benzyl-9-hydroxy-5h-indeno[1,2-b]indol-10-one 406582 NSC724794 sensitive
hsa-miR-195-5p 5-bromo-n-(2-methyl-3-oxo-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1h-indole-2-carboxamide 24205438 NSC735532 resistant
hsa-miR-195-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 resistant
hsa-miR-195-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 resistant
hsa-miR-195-5p 6-(11-aminoundecyl)indeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 16221323 NSC740510 resistant
hsa-miR-195-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-195-5p 6-(4-methylphenyl)-8-(4-chlorophenyl)imidazo[1,2-a]pyrazine 11336170 NSC731104 sensitive
hsa-miR-195-5p 6-(aziridin-1-yl)-7-methoxy-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazole-5,8-dione 383842 NSC672472 resistant
hsa-miR-195-5p 6-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027833 NSC726973 resistant
hsa-miR-195-5p 6-[2-[3-[2-(2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027895 NSC735372 resistant
hsa-miR-195-5p 6-[3-[2-[3-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)propylamino]ethylamino]propyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027830 NSC726767 resistant
hsa-miR-195-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 sensitive
hsa-miR-195-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-195-5p 6-chloro-5-(2-piperazin-1-ylethyl)-1,3-dihydroindol-2-one 22181640 NSC762889 sensitive
hsa-miR-195-5p 6,13-bis[2-[(2,3,4-trimethoxyphenyl)methylamino]ethyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone;4-methylbenzenesulfonic acid;hydrate 60147730 NSC752278 resistant
hsa-miR-195-5p 7-methoxy-5,11-dimethyl-10h-pyrido[3,4-b]carbazole 379120 NSC663334 resistant
hsa-miR-195-5p 9-[2-(2,5-dimethylpyrrol-1-yl)phenyl]-7-hydroxy-5,6-di(propan-2-yloxy)-3-oxa-1-azatricyclo[6.3.1.04,12]dodeca-4,6,8(12),10-tetraen-2-one 389261 NSC685014 resistant
hsa-miR-195-5p 9-[4-[(4,6-dimethylpyrimidin-2-yl)sulfamoyl]anilino]-n-(2-hydroxyethyl)acridine-4-carboxamide 384527 NSC674498 resistant
hsa-miR-195-5p Aklavin 264889 NSC100290 resistant
hsa-miR-195-5p Amonafide 50515 NSC308847 resistant
hsa-miR-195-5p Antineoplastic-92909 261046 NSC92909 sensitive
hsa-miR-195-5p Basic yellow k 7081 NSC13973 resistant
hsa-miR-195-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 resistant
hsa-miR-195-5p Chlorodestruxin 370710 NSC644211 resistant
hsa-miR-195-5p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 resistant
hsa-miR-195-5p Crotoxin cd NSC636009 sensitive
hsa-miR-195-5p Deferoxamine hydrochloride 2973 NSC268993 approved resistant
hsa-miR-195-5p Destruxin b NSC236580 resistant
hsa-miR-195-5p Diaziridinone, bis(.alpha.,.alpha.-dimethylphenethyl)- 391928 NSC691608 resistant
hsa-miR-195-5p Diethyl 1,6-dihydropyrrolo[2,3-e]indole-2,7-dicarboxylate 389557 NSC685862 sensitive
hsa-miR-195-5p Diethyl(acetylamino)[(6-nitro-1h-indol-3-yl)methyl]propanedioate 249442 NSC67774 sensitive
hsa-miR-195-5p Dimethyl 12-cyclohexyl-8-oxo-1-phenyl-12-azatricyclo[7.2.1.02,7]dodeca-2,4,6,10-tetraene-10,11-dicarboxylate 394469 NSC697942 resistant
hsa-miR-195-5p Edelfosine 1392 NSC324368 resistant
hsa-miR-195-5p Emofolin sodium 135488934 NSC139490 resistant
hsa-miR-195-5p Entinostat 4261 NSC706995 resistant
hsa-miR-195-5p Ethanol, 2-[4-(2,2':6',2"-terpyridin-4'-yl)phenoxy]- 368990 NSC640499 resistant
hsa-miR-195-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 sensitive
hsa-miR-195-5p Ethyl 4-(1,3-thiazol-2-ylcarbamoylamino)benzoate 307683 NSC205795 sensitive
hsa-miR-195-5p From combretum caffrum plant 5386397 NSC609397 sensitive
hsa-miR-195-5p Hexadecyl-(2-hydroxyethyl)-(1H-imidazol-5-ylmethyl)-methylazanium;chloride 21144688 NSC265875 resistant
hsa-miR-195-5p J-400634 385621 NSC676944 resistant
hsa-miR-195-5p J7x181m78y 395460 NSC700023 sensitive
hsa-miR-195-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-195-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-195-5p L-lys-l-p-no2phe-l-ala-l-p-no2phenh2 386384 NSC678355 resistant
hsa-miR-195-5p Lomondomycin 135426834 NSC156939 sensitive
hsa-miR-195-5p Ls-133613 365597 NSC633398 resistant
hsa-miR-195-5p Massoia lactone 39914 NSC720841 resistant
hsa-miR-195-5p Methanesulfonic acid;10-[3-[3-[(9-methoxy-5,11-dimethyl-6h-pyrido[4,3-b]carbazol-1-yl)amino]propyl-methylamino]propylamino]-1,14-diazatetracyclo[7.6.1.02,7.013,16]hexadeca-2,4,6,9,11,13(16),14-heptaen 438996 NSC695938 resistant
hsa-miR-195-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-195-5p Methyl 2-[33,34,35,36-tetrahydroxy-11,19,27-tris(2-methoxy-2-oxoethyl)-7,15,23,31-tetramethyl-3,11,19,27-tetrazapentacyclo[27.3.1.15,9.113,17.121,25]hexatriaconta-1(32),5,7,9(36),13,15,17(35),21(34),2 395595 NSC700325 resistant
hsa-miR-195-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-195-5p Miltefosin c 3599 NSC605583 resistant
hsa-miR-195-5p N'-(1-(1-hydroxy-1lambda(5)-pyridin-2-yl)ethyl)-4-(2-pyridinyl)-1-piperazinecarbothiohydrazide 3003953 NSC352741 resistant
hsa-miR-195-5p N'-[8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]-4-methylbenzenesulfonohydrazide 383134 NSC671175 sensitive
hsa-miR-195-5p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-2-(4-hydroxy-2-oxochromen-3-yl)-2-oxoacetamide 54693275 NSC649811 sensitive
hsa-miR-195-5p N-(3-methoxyphenethyl)-3,3,3-triphenylpropionamide 11453337 NSC730691 resistant
hsa-miR-195-5p N-[(22s)-13-methoxy-18-methylsulfanyl-19-oxo-4,11-diazapentacyclo[12.10.0.03,12.05,10.015,21]tetracosa-1,3,5,7,9,11,13,15,17,20-decaen-22-yl]acetamide 395872 NSC700913 sensitive
hsa-miR-195-5p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968272 NSC747458 resistant
hsa-miR-195-5p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-3-azabicyclo[3.2.2]nonane-3-carbothioamide 5464837 NSC335789 resistant
hsa-miR-195-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-195-5p N-[(Z)-1-(4-oxo-3,1-benzoxazin-2-yl)-2-phenylethenyl]benzamide 5917766 NSC686428 sensitive
hsa-miR-195-5p N-[2-(1h-indol-3-yl)ethyl]-4-[[[(e)-3-(4-phenylphenyl)prop-2-enoyl]amino]methyl]benzamide 5470491 NSC702137 resistant
hsa-miR-195-5p N-[2-(dimethylamino)ethyl]-9-fluorophenazine-1-carboxamide;hydrochloride 386521 NSC678925 resistant
hsa-miR-195-5p N-[2-[[4,5-dihydroxy-2-methyl-6-(7H-purin-6-ylamino)oxan-3-yl]amino]-2-oxoethyl]-14-methylpentadecanamide 4366047 NSC268251 resistant
hsa-miR-195-5p N-[3-(dimethylamino)propyl]-9-oxo-2-thia-11,14-diazatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7,12,14,16-heptaene-13-carboxamide 385059 NSC675988 resistant
hsa-miR-195-5p N-[8-hydroxy-7-(piperidin-1-ylmethyl)quinolin-5-yl]acetamide 279612 NSC130876 resistant
hsa-miR-195-5p N,N'-bis[(5E)-5-[(3,4-dihydroxyphenyl)methylidene]-2-(2-hydroxynaphthalen-1-yl)-4-oxo-1,3-thiazolidin-3-yl]decanediamide 5470052 NSC697192 resistant
hsa-miR-195-5p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-195-5p Neuro_000347 438571 NSC645835 resistant
hsa-miR-195-5p NSC697653 NSC697653 resistant
hsa-miR-195-5p NSC755523 NSC755523 resistant
hsa-miR-195-5p Octadecylphosphocholine 125219 NSC282880 resistant
hsa-miR-195-5p Oxin 1923 NSC2039 approved resistant
hsa-miR-195-5p P-fuchsin 11292 NSC10460 sensitive
hsa-miR-195-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-195-5p Paullone analog 9 396412 NSC702378 resistant
hsa-miR-195-5p Perifosine 148177 NSC639966 resistant
hsa-miR-195-5p Proflavine hcl 197873 NSC605756 resistant
hsa-miR-195-5p Questiomycin a 72725 NSC94945 sensitive
hsa-miR-195-5p Replaced cas registry number(s): 66835-31-2 312122 NSC220334 sensitive
hsa-miR-195-5p Sc-60646 419381 NSC114382 sensitive
hsa-miR-195-5p Sodium;3-hydroxy-4-[(1-hydroxynaphthalen-2-yl)diazenyl]-8-nitronaphthalene-1-sulfonate 135488931 NSC85561 resistant
hsa-miR-195-5p Sr16388 54612678 NSC745098 sensitive
hsa-miR-195-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-195-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-195-5p Tert-butyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386493 NSC678637 sensitive
hsa-miR-195-5p Thujaplicin mixture 252101 NSC73300 resistant
hsa-miR-195-5p Tris(1,10-phenanthroline)neodymium(iii)-trithiocyanate 24202207 NSC632730 resistant
hsa-miR-195-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 resistant
hsa-miR-195-5p Z24759926 4853660 NSC743408 sensitive
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251MG)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (UMSCC-1, SQ20B)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Colon Cancer cell line (HT-29, LOVO)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive High Non-Small Cell Lung Cancer cell line (SK-MES-1, NCI-H1975, NCI-H460)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-195-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (IOSE386, IOSE397, A2780, KF, SKOV3, TOUS3,TU-OC-1, OVCAR-3, OV2008, CI3)
hsa-miR-195-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (COC1)
hsa-miR-195-5p Prednisolone 5755 NSC9120 approved sensitive Low Ulcerative Colitis tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-195-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-195-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Azacitidine 9444 NSC102816 approved resistant High Acute Myeloid Leukemia tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (Caco-2, HCT8, HCT-116, SW480)
hsa-miR-195-5p Eribulin 73425383 approved sensitive Low Non-Small Cell Lung Cancer cell line (H1299)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive Low Prostate Cancer cell line (DU-145)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (SW620, HT-29)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251MG)
hsa-miR-195-5p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-195-5p Trastuzumab sensitive Low HER2-Positive Breast Cancer cell line (BT-474)
hsa-miR-195-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (SGC-7901, AGS)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, HO8910, ES-2, A2780)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, Hep3B)
hsa-miR-195-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT116)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-195-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-195-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-195-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-195-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-195-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-195-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-195-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-195-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-195-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission