miRTarBase - #MIRT046559


—
pre-miRNA Information
pre-miRNA hsa-let-7g   
Genomic Coordinates chr3: 52268278 - 52268361
Synonyms LET7G, MIRNLET7G, hsa-let-7g, MIRLET7G
Description Homo sapiens let-7g stem-loop
Comment let-7g-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7g-5p
Sequence 5| UGAGGUAGUAGUUUGUACAGUU |26
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 3 - 52268351 18684997 MiREDiBase
A-to-I 10 3 - 52268348 18684997, 29950133, 29233923 MiREDiBase
A-to-I 17 3 - 52268341 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN1278471 5 COSMIC
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SFT2D1   
Synonyms C6orf83, pRGR1
Description SFT2 domain containing 1
Transcript NM_145169   
Expression
Putative miRNA Targets on SFT2D1
3'UTR of SFT2D1
(miRNA target sites are highlighted)		 
>SFT2D1|NM_145169|3'UTR
   1 AAATCAGAAACTTGTGGAAAAGAGCACTTGAATGTTGGTACTCTATGTTTGGTGAAGTTTGCTTTTCCCCATAAAACACT
  81 CCAGGAACAACTGACGTGACAGTTGAAGACCGTTTTGTACTAAGTCTCATTTTGTATACTGGTAAAAACTACATGCTTGA
 161 TTAAACCATTAAATGCTTGTAACTTTAAATTCATTATGTGTCATTAATATACTTTTCCAAAGATAAGATTTTTAATCACT
 241 GCCAGTTGTAAATTATTTTTAGCCAATTTTTAAATCTTTTCAAAGCAGCTTTGAAATGTGAATATTTAAAGGTAGACCTG
 321 TGCTGCAAGATAATTAAACTTTTTTGCTTTTAAAAAATGTCTGCATTTTTAAGATTTTTTTTACTTTAAATGTGAAACTT
 401 ATTTTAAGCTAAAAATTGCTTATTATATGTAATAAAAATAATATATAAATCTTTACAATTTTGAAATAAACCCATCCTTG
 481 GAAAAATAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGACAUGU-----UUGAUGAUGGAgu 5'
            :||||:|     ||  ||||| |  
Target 5' ttTTGTATACTGGTAAAAACTACATgc 3'
 130 - 156 108.00 -11.50
2 
miRNA  3' uuGACAUGUUU---GAUGAUGGAGu 5'
            :| || |:|   :| :|||:|: 
Target 5' atTTTTA-AGATTTTTTTTACTTTa 3'
 365 - 388 99.00 -5.50
3 
miRNA  3' uugACAUGUUUGAUGAUGGagu 5'
             | | :|| | |||:||   
Target 5' agaTTTTTAATC-ACTGCCagt 3'
 226 - 246 98.00 -5.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30191404 14 COSMIC
COSN30456316 16 COSMIC
COSN26642425 17 COSMIC
COSN31499130 51 COSMIC
COSN30737404 62 COSMIC
COSN31785768 63 COSMIC
COSN31575735 77 COSMIC
COSN32018327 79 COSMIC
COSN31611661 94 COSMIC
COSN31539992 96 COSMIC
COSN23816646 98 COSMIC
COSN30120296 103 COSMIC
COSN30135710 143 COSMIC
COSN19707389 229 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1051559301 5 dbSNP
rs756208650 6 dbSNP
rs371169424 11 dbSNP
rs781559985 13 dbSNP
rs757728729 17 dbSNP
rs751892686 22 dbSNP
rs202112052 26 dbSNP
rs758806515 28 dbSNP
rs367730755 34 dbSNP
rs1439675687 39 dbSNP
rs996308175 41 dbSNP
rs764975754 43 dbSNP
rs758972323 44 dbSNP
rs748330040 45 dbSNP
rs80172274 45 dbSNP
rs1427269922 46 dbSNP
rs764002371 51 dbSNP
rs1465197084 53 dbSNP
rs1172820259 60 dbSNP
rs1043084982 62 dbSNP
rs895471706 67 dbSNP
rs1473693858 69 dbSNP
rs1307329467 70 dbSNP
rs1351089455 77 dbSNP
rs1393077240 81 dbSNP
rs1299238625 88 dbSNP
rs1158915364 91 dbSNP
rs1440675354 95 dbSNP
rs529953396 96 dbSNP
rs1282788938 100 dbSNP
rs1410648717 101 dbSNP
rs1340479249 102 dbSNP
rs947326222 110 dbSNP
rs891676228 111 dbSNP
rs1052894304 112 dbSNP
rs1470080523 113 dbSNP
rs938553774 117 dbSNP
rs999476068 119 dbSNP
rs761599388 136 dbSNP
rs1193841104 141 dbSNP
rs112061792 144 dbSNP
rs1447415417 149 dbSNP
rs982242228 153 dbSNP
rs1370977558 159 dbSNP
rs1463421740 165 dbSNP
rs948123037 176 dbSNP
rs916602959 182 dbSNP
rs572555618 187 dbSNP
rs973362261 190 dbSNP
rs1217689012 197 dbSNP
rs1305885163 201 dbSNP
rs1355531908 206 dbSNP
rs532007279 209 dbSNP
rs963629600 212 dbSNP
rs1015218279 215 dbSNP
rs759971570 217 dbSNP
rs1298742736 218 dbSNP
rs1309656659 222 dbSNP
rs114469365 229 dbSNP
rs1219975111 241 dbSNP
rs1041137494 243 dbSNP
rs954922963 248 dbSNP
rs1213832447 251 dbSNP
rs1254342743 252 dbSNP
rs751238072 266 dbSNP
rs1368194128 271 dbSNP
rs1187567038 276 dbSNP
rs995951765 277 dbSNP
rs900227242 279 dbSNP
rs765758309 282 dbSNP
rs1402517397 284 dbSNP
rs1344374415 285 dbSNP
rs929180206 298 dbSNP
rs1421174110 317 dbSNP
rs1021250230 325 dbSNP
rs1157394340 333 dbSNP
rs1400553202 335 dbSNP
rs1011165069 337 dbSNP
rs1321522078 342 dbSNP
rs1227027219 346 dbSNP
rs149122456 346 dbSNP
rs762814450 359 dbSNP
rs891456883 362 dbSNP
rs1022697818 363 dbSNP
rs1235680476 368 dbSNP
rs1053005577 370 dbSNP
rs1194568188 375 dbSNP
rs1463203048 383 dbSNP
rs532076557 383 dbSNP
rs1489399274 390 dbSNP
rs1240635733 392 dbSNP
rs1179845680 398 dbSNP
rs959703585 401 dbSNP
rs1167040845 402 dbSNP
rs1214796884 402 dbSNP
rs1312596838 404 dbSNP
rs202171522 407 dbSNP
rs201178161 408 dbSNP
rs938583068 411 dbSNP
rs1347231096 417 dbSNP
rs1446106953 419 dbSNP
rs907064647 420 dbSNP
rs1302558636 427 dbSNP
rs1322162267 427 dbSNP
rs1417141884 427 dbSNP
rs1287051863 440 dbSNP
rs1278284383 443 dbSNP
rs1227308468 446 dbSNP
rs1401400139 450 dbSNP
rs998526595 455 dbSNP
rs1044595670 474 dbSNP
rs1207625552 476 dbSNP
rs948163960 486 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.643 0 0.666 0 32 Click to see details
BLCA 0.58 0.01 0.531 0.01 18 Click to see details
BRCA 0.226 0.02 0.268 0.01 84 Click to see details
ESCA 0.61 0.02 0.627 0.02 11 Click to see details
HNSC -0.256 0.05 -0.247 0.06 42 Click to see details
LIHC -0.208 0.08 -0.230 0.06 49 Click to see details
COAD -0.462 0.12 -0.238 0.29 8 Click to see details
PRAD 0.165 0.13 0.083 0.28 50 Click to see details
LUAD 0.343 0.14 0.273 0.2 12 Click to see details
LUSC 0.156 0.17 0.196 0.12 38 Click to see details
KIRC -0.067 0.29 -0.086 0.24 68 Click to see details
KICH 0.067 0.38 -0.074 0.36 25 Click to see details
THCA 0.035 0.4 0.095 0.24 59 Click to see details
CESC 0.317 0.4 0.500 0.33 3 Click to see details
CHOL 0.092 0.41 -0.033 0.47 9 Click to see details
KIRP 0.036 0.42 -0.041 0.41 32 Click to see details
PCPG 0.236 0.42 0.500 0.33 3 Click to see details
UCEC 0.041 0.43 0.018 0.47 19 Click to see details
PAAD -0.054 0.47 0.000 0.5 4 Click to see details
PAAD -0.054 0.47 0.000 0.5 4 Click to see details
PAAD -0.054 0.47 0.000 0.5 4 Click to see details
310 hsa-let-7g-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000396 CDK6 cyclin dependent kinase 6 1 1
MIRT000397 CDC25A cell division cycle 25A 1 1
MIRT000399 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT000472 COL1A2 collagen type I alpha 2 chain 4 1
MIRT000475 MYC MYC proto-oncogene, bHLH transcription factor 4 3
MIRT002097 HMGA2 high mobility group AT-hook 2 6 8
MIRT003831 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 6 4
MIRT004489 CDKN2A cyclin dependent kinase inhibitor 2A 4 1
MIRT004490 BCL2L1 BCL2 like 1 4 1
MIRT006161 GAB2 GRB2 associated binding protein 2 3 1
MIRT006162 FN1 fibronectin 1 3 1
MIRT006399 IL13 interleukin 13 2 1
MIRT024117 DAD1 defender against cell death 1 1 1
MIRT024118 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 3 5
MIRT024119 TBC1D9 TBC1 domain family member 9 2 1
MIRT024120 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 1
MIRT046555 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT046556 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT046557 UBE3C ubiquitin protein ligase E3C 1 1
MIRT046558 RPL12 ribosomal protein L12 1 1
MIRT046559 SFT2D1 SFT2 domain containing 1 1 1
MIRT046560 MAP3K1 mitogen-activated protein kinase kinase kinase 1 1 1
MIRT046561 BRD1 bromodomain containing 1 1 1
MIRT046562 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT046563 RAB21 RAB21, member RAS oncogene family 1 1
MIRT046564 HMGB1 high mobility group box 1 1 1
MIRT046565 RRM2 ribonucleotide reductase regulatory subunit M2 2 3
MIRT046566 AKAP11 A-kinase anchoring protein 11 1 1
MIRT046567 RANBP2 RAN binding protein 2 1 1
MIRT046568 SART3 squamous cell carcinoma antigen recognized by T-cells 3 1 1
MIRT054642 CASP3 caspase 3 2 1
MIRT054662 THBS1 thrombospondin 1 5 4
MIRT054663 TGFBR1 transforming growth factor beta receptor 1 3 1
MIRT054664 SMAD2 SMAD family member 2 3 1
MIRT063199 ADIPOR2 adiponectin receptor 2 2 2
MIRT065691 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067403 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068157 TXLNA taxilin alpha 2 2
MIRT068532 NHLRC3 NHL repeat containing 3 2 6
MIRT068792 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073008 ARID3B AT-rich interaction domain 3B 2 6
MIRT073672 IGF1R insulin like growth factor 1 receptor 2 8
MIRT076227 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT080402 ONECUT2 one cut homeobox 2 2 2
MIRT083304 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084979 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094164 PCGF3 polycomb group ring finger 3 2 6
MIRT094464 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095770 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100096 ABT1 activator of basal transcription 1 2 8
MIRT112245 MDM4 MDM4, p53 regulator 2 4
MIRT118589 STK4 serine/threonine kinase 4 2 2
MIRT120924 PDE12 phosphodiesterase 12 2 8
MIRT123321 CALU calumenin 2 2
MIRT123980 POLR3D RNA polymerase III subunit D 2 2
MIRT152281 TNFSF9 TNF superfamily member 9 2 2
MIRT153856 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168587 HMGA1 high mobility group AT-hook 1 2 4
MIRT180606 CRY2 cryptochrome circadian clock 2 2 2
MIRT187721 SUOX sulfite oxidase 2 2
MIRT191407 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193104 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215724 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218816 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240333 UBXN2B UBX domain protein 2B 2 2
MIRT243476 TRIM71 tripartite motif containing 71 2 2
MIRT244074 EDN1 endothelin 1 2 2
MIRT252334 SALL3 spalt like transcription factor 3 2 2
MIRT255318 CDV3 CDV3 homolog 2 2
MIRT259280 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259483 TXLNG taxilin gamma 2 2
MIRT260711 CLDN12 claudin 12 2 6
MIRT264695 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266216 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266629 CHTOP chromatin target of PRMT1 2 2
MIRT268842 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT284531 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT294449 ZNF264 zinc finger protein 264 2 2
MIRT297445 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300041 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300896 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303323 MXD1 MAX dimerization protein 1 2 2
MIRT309849 NAT8L N-acetyltransferase 8 like 2 2
MIRT322431 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324735 ACER2 alkaline ceramidase 2 2 2
MIRT402061 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437976 AKT2 AKT serine/threonine kinase 2 3 1
MIRT438631 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT442018 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445656 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447134 KIF27 kinesin family member 27 2 2
MIRT448256 ZNF774 zinc finger protein 774 2 2
MIRT449009 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449951 FMNL3 formin like 3 2 2
MIRT451153 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451622 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451691 C1RL complement C1r subcomponent like 2 2
MIRT452090 NUCB2 nucleobindin 2 2 2
MIRT452429 QDPR quinoid dihydropteridine reductase 2 2
MIRT452941 DISC1 disrupted in schizophrenia 1 2 2
MIRT453399 RHD Rh blood group D antigen 2 6
MIRT454162 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454278 FXN frataxin 2 2
MIRT454537 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454852 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455674 GLO1 glyoxalase I 2 2
MIRT457246 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457675 ZNF587 zinc finger protein 587 2 2
MIRT457885 THEM6 thioesterase superfamily member 6 2 4
MIRT458014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458277 FUT10 fucosyltransferase 10 2 2
MIRT459734 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460451 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460498 FAM105A family with sequence similarity 105 member A 2 6
MIRT460936 NOA1 nitric oxide associated 1 2 4
MIRT461090 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461167 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461362 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462380 YAE1D1 Yae1 domain containing 1 2 2
MIRT462778 ZNF8 zinc finger protein 8 2 2
MIRT463416 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463660 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464263 VCL vinculin 2 2
MIRT465128 TSC22D2 TSC22 domain family member 2 2 4
MIRT466187 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466723 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469100 RNF144B ring finger protein 144B 2 2
MIRT469716 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470420 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470681 POLR2D RNA polymerase II subunit D 2 4
MIRT470863 PLXND1 plexin D1 2 2
MIRT471273 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471964 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472674 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472734 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473130 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473238 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473826 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473938 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474026 LRRC20 leucine rich repeat containing 20 2 2
MIRT474503 KLHDC8B kelch domain containing 8B 2 2
MIRT474764 KIAA0930 KIAA0930 2 2
MIRT474909 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475329 IFNLR1 interferon lambda receptor 1 2 2
MIRT475377 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475731 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476546 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476979 FAM83G family with sequence similarity 83 member G 2 4
MIRT477680 EFHD2 EF-hand domain family member D2 2 2
MIRT479748 CCND1 cyclin D1 2 2
MIRT481191 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481234 ATXN7L3 ataxin 7 like 3 2 2
MIRT481361 ATG9A autophagy related 9A 2 2
MIRT481386 ATG12 autophagy related 12 2 2
MIRT481650 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481850 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482182 AHR aryl hydrocarbon receptor 2 2
MIRT482218 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485294 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486657 ZNF28 zinc finger protein 28 2 2
MIRT489411 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491858 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492212 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492627 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493327 LIMD2 LIM domain containing 2 2 2
MIRT493899 FAM43A family with sequence similarity 43 member A 2 4
MIRT494261 CEP120 centrosomal protein 120 2 2
MIRT494683 ARID3A AT-rich interaction domain 3A 2 2
MIRT495966 TBC1D19 TBC1 domain family member 19 2 2
MIRT496109 SNX17 sorting nexin 17 2 2
MIRT497873 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498120 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499403 PLCG2 phospholipase C gamma 2 2 4
MIRT499491 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499651 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499940 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499995 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500905 STRN striatin 2 4
MIRT501114 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501177 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501208 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501244 SEMA4C semaphorin 4C 2 6
MIRT501330 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501353 RNF44 ring finger protein 44 2 4
MIRT501391 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501436 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501756 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501947 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502105 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502131 KMT2D lysine methyltransferase 2D 2 4
MIRT502786 CEP135 centrosomal protein 135 2 2
MIRT502844 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504787 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505021 ZNF644 zinc finger protein 644 2 2
MIRT505578 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506363 NUP155 nucleoporin 155 2 6
MIRT506934 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507249 FIGN fidgetin, microtubule severing factor 2 8
MIRT507695 COIL coilin 2 6
MIRT508399 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508663 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508930 AK4 adenylate kinase 4 2 4
MIRT510398 ZNF566 zinc finger protein 566 2 6
MIRT510517 YOD1 YOD1 deubiquitinase 2 6
MIRT511384 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512743 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515952 C9orf156 tRNA methyltransferase O 2 2
MIRT516081 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT521388 RDX radixin 2 4
MIRT522347 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT523624 FZD9 frizzled class receptor 9 2 4
MIRT523731 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523988 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524114 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525725 SOD2 superoxide dismutase 2 2 2
MIRT527761 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529725 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533186 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536376 LEFTY1 left-right determination factor 1 2 2
MIRT543783 RBM12B RNA binding motif protein 12B 2 4
MIRT543866 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545385 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545889 ZNF200 zinc finger protein 200 2 4
MIRT546331 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547376 MSI2 musashi RNA binding protein 2 2 2
MIRT547574 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547835 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT548263 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548349 EPHA4 EPH receptor A4 2 2
MIRT548530 DUSP1 dual specificity phosphatase 1 2 2
MIRT548558 DNAL1 dynein axonemal light chain 1 2 2
MIRT548778 COLEC12 collectin subfamily member 12 2 2
MIRT548973 CCNT2 cyclin T2 2 2
MIRT549023 CBX5 chromobox 5 2 2
MIRT549210 BEND4 BEN domain containing 4 2 4
MIRT549761 ZNF611 zinc finger protein 611 2 6
MIRT549797 KIAA0391 KIAA0391 2 2
MIRT549845 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550725 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550896 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551281 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551316 GSG2 histone H3 associated protein kinase 2 6
MIRT551930 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552001 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552408 ZNF460 zinc finger protein 460 2 4
MIRT553015 USP38 ubiquitin specific peptidase 38 2 2
MIRT555548 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555713 PDZD8 PDZ domain containing 8 2 2
MIRT557379 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557963 FAM222B family with sequence similarity 222 member B 2 2
MIRT559083 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559495 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561780 PEG10 paternally expressed 10 2 2
MIRT564400 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565447 SURF4 surfeit 4 2 2
MIRT566516 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567433 GNG5 G protein subunit gamma 5 2 2
MIRT567713 E2F6 E2F transcription factor 6 2 2
MIRT568659 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569496 THYN1 thymocyte nuclear protein 1 2 2
MIRT573818 TGOLN2 trans-golgi network protein 2 2 2
MIRT574361 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574745 GOLGA4 golgin A4 2 2
MIRT574784 FAM104A family with sequence similarity 104 member A 2 2
MIRT576084 Poteg POTE ankyrin domain family, member G 2 2
MIRT576809 Thbs1 thrombospondin 1 2 3
MIRT616368 RWDD1 RWD domain containing 1 2 2
MIRT617849 FMO4 flavin containing monooxygenase 4 2 2
MIRT642392 ZNF556 zinc finger protein 556 2 2
MIRT680517 PRIM2 DNA primase subunit 2 2 2
MIRT680545 ZNF584 zinc finger protein 584 2 2
MIRT680798 ZNF578 zinc finger protein 578 2 2
MIRT680836 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681139 INTS7 integrator complex subunit 7 2 2
MIRT681269 RFC2 replication factor C subunit 2 2 2
MIRT681321 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681357 BRI3BP BRI3 binding protein 2 2
MIRT681504 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681534 ZNF738 zinc finger protein 738 2 2
MIRT681656 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681736 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681759 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681795 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681867 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681939 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682100 ITGA3 integrin subunit alpha 3 2 4
MIRT682179 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682236 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682382 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682442 MTX3 metaxin 3 2 2
MIRT682602 CPA4 carboxypeptidase A4 2 2
MIRT682638 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689325 FPR1 formyl peptide receptor 1 2 2
MIRT689728 ATXN2 ataxin 2 2 2
MIRT691034 ZNF799 zinc finger protein 799 2 2
MIRT691933 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694882 ZNF417 zinc finger protein 417 2 2
MIRT695253 ZNF443 zinc finger protein 443 2 2
MIRT695411 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700591 PRSS22 protease, serine 22 2 2
MIRT701432 NHLRC2 NHL repeat containing 2 2 2
MIRT702482 KIAA1328 KIAA1328 2 2
MIRT702708 IPO9 importin 9 2 2
MIRT704033 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704421 CTPS1 CTP synthase 1 2 2
MIRT705748 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712368 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713518 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT732950 HOXB1 homeobox B1 3 0
MIRT735294 MMP16 matrix metallopeptidase 16 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7g Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7g Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 down-regulated
let-7g 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7g Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7g Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines 3A 20417706 2010 up-regulated
let-7g Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
let-7g Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7g 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7g 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7g Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
let-7g 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
let-7g 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
let-7g Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
let-7g 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cell line 22403704 2012 down-regulated
let-7g Bisphenol A NULL 6623 Microarray MCF-7 breast cancer cell line 22403704 2012 down-regulated
let-7g Doxorubicin approved 31703 Quantitative real-time PCR myocardial injury 22301161 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7g Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7g Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7g Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7g Doxorubicin 31703 NSC123127 approved sensitive High Leukemia cell line (K562)
hsa-let-7g 10-Hydroxycamptothecin 97226 NSC107124 resistant High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-let-7g Modified Allic Bfm 2002 Protocol sensitive High Childhood Acute Lymphoblastic Leukemia tissue
hsa-let-7g Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7g Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (C13*, A2780, OV2008)
hsa-let-7g Fluorouracil 3385 NSC19893 approved sensitive Low Hepatoma cell line (BEL-7402)
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (COC1)
hsa-let-7g Paclitaxel 36314 NSC125973 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Cancer cell line (EC109, TE10)
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Cancer cell line (EC109, TE10)
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive Low Epithelial Ovarian Cancer cell line (OVCAR3, HEY-A8)
hsa-let-7g Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7g Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7g Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-let-7g Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-let-7g Testosterone+Letrozole resistant cell line (MCF-7)
hsa-let-7g Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7g Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7g Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7g Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-let-7g Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-let-7g Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-let-7g Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-let-7g Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7g Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7g-5p 1h-indole-3-methanol, 1-[(4-chlorophenyl)methyl]- 11821732 NSC741909 resistant
hsa-let-7g-5p N'-(cyano(3-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375018 NSC653844 resistant
hsa-let-7g-5p N-(5-aminopentyl)-n-(3-aminopropoxy)-2,2,5,7,8-pentamethyl-3,4-dihydrochromene-6-sulfonamide;hydrochloride 396614 NSC703117 sensitive
hsa-let-7g-5p Vfbduqdkojtrni-pknbqfbnsa-n 5468519 NSC671184 sensitive
hsa-let-7g-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7g-5p Paclitaxel 36314 NSC125973 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7g-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-let-7g-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7g-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7g-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7g-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7g-5p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7g-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-let-7g-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, U251, HEK)
hsa-let-7g-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7g-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-let-7g-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-let-7g-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7g-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7g-5p Palbociclib 5330286 NSC758247 approved sensitive tissue (breast cancer)
hsa-let-7g-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7g-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-let-7g-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-let-7g-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7g-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-let-7g-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-let-7g-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-let-7g-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission