pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol SPECC1   
Synonyms CYTSB, HCMOGT-1, HCMOGT1, NSP
Description sperm antigen with calponin homology and coiled-coil domains 1
Transcript NM_001033554   
Other Transcripts NM_001033553 , NM_001033555 , NM_152904   
Expression
Putative miRNA Targets on SPECC1
3'UTR of SPECC1
(miRNA target sites are highlighted)
>SPECC1|NM_001033554|3'UTR
   1 CAGAGCATTTGGTGGAAGAAAGACAGCCCAGCTCTTGCCATGATTGGGAGCCGCAGCCATCTCTAGATGAAAGGGGGAAT
  81 GTGTAGAGGAGAAATTGCCTCTTTATAAAGAGCCCAGTTGTCTCCTTGTGACATTCTCTGTTTCTCAGAGTCATTGCCGT
 161 CGAGTCTCTGCTTTTTGTCCACATTTTGGGATCAGCTTACTGCATGATCAAAGATGATGTTTCCCTCTTTTTACTTTTCC
 241 TCAGAAGATTGAGCTGTCTTTTATTTGGAGAATAAAATGAAGTTCTGAAAAAAACAAAGTACAAGTCTTATGAAAAGTTA
 321 TTTGCAGCTGGAGTGCTGAAAAGGGCACAGTGGCAGAGCAGATGCAGAGCTGGGTACAGCGCAGGCCCGAGTTCTTTTGT
 401 TTTTTGTTGTTGTTGTTGTTGTTGTTTTGTTTTGTTTTTTTTTTTTTTTTGAGACAGAGTTTCACTCTTGTTGCCCAGGC
 481 TGGAGTGCAATGGTACGATCTCGGCTCACTGCAACCTCTGCCTCCCGGGTTCAAGTGATTCTCTTGCCTCAGCCTTCCAA
 561 GTAGCTGGAATTACAGGCGCCTGCCACCACACCCAGCTAATTTTTGTATTGTTAGTAGAGATGGGGTTTCACCGTGTTGG
 641 CCAGGCTGCTCTTGAACTCCTGACCTCAGGTGATCCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCAC
 721 CGCACCCAGAACCTAAGGCCCAAGTTCTACTTTTTGGTGTTCATTTCTCTGCTTCCTTTTGATCGTGGTGTCTGATCATC
 801 TTGGAATTCACATTACTCAAGGCAAAATAGGAAGCCATCTGCGTGATGTCACATTCCGAAGAAGTCAGAAGGTTCGGCGA
 881 GTTGGAGCTTTACTCTTGTTGCCCAGGCTAGAGTGCAGTGGTGCGATCTTGGCTCATTGCAAGCTCCGCTTCCTGGGTTT
 961 AAGCTATTCTCCTGCCTTGGCCTCCCAAGTAGCTGGGATTACAGGCATGTGCCGTCACTCCTGGCTAATTTTGTATTTTT
1041 AGTAGAGATGCAATTTCACCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATCTGGCCGCCTCAGCCTCCC
1121 AAAGTGCTGGGATTACAGGCTTGAGACCCCATGTCTGGCCCCTTCTGTGGGGTCTTGATTGAGCCCCTTCACTTGGAGTC
1201 TGACTTCATTACCTCGTCTGAAACAAGGTGCCTCCAAGCTTTGGGTTGATTTCCAGAATCTTGTTGGGTTAAACATAAGT
1281 AGAAGTTTGATCATAAAGGATGTTATTAAGCCGGATAGGTAAGCACGGTGACAATGGCAATAGAAATCTAATGGAAAACG
1361 ATTGAATGACAACTACACCAAAGTTTCATGGATGAAACTCACCCCAGAAACTTAGTGTTCAAATCAGAGTGATACACAAT
1441 TCAAAATGTGATTTTAAACTTCTGGAAATATGTGTGTTTGTGAAGATCCAAATCCAATTCAGCAACCTCCATCAGGCAGA
1521 AACCTTCTGCAATCCTCACATGAGGAACTGGTTCACAGTGTACACAGCATGGAGCCATTAGTGACGTTATCCAAAGGATG
1601 AGACAAGACAAAAGTTACTGTCTAATAAAAGGAAAATTAGGAACAGGAATGCTCTTTAAACTCAGGAAGATCTTTTGGGG
1681 TGTCAAACTGGACAGCACAGAATCATTAGAAAAATTAGCTTGGCGTGAGAAGAGACATTGAGGTCTTCTCTGTAAAATTT
1761 ACTTAGATACTTGTGAATAGGACTGAAATTTATATTTTGGGCACTCTTTACCTCAGATTCAGAGTTCTTAGGATTATTTA
1841 AAATTCATTTGCTGGATGTTTTCAAGTATAAACAATAAGAAAACTGCAACTTCAACTTAAAAGGCACTGCTGTATTTGCA
1921 CCCTATATTTTGACCTGTCGTTAGGTACTGTTGAATATTTTTATCTGTAAGCATTTATGAAGTGCAAAATAAACATGTTA
2001 TTATATAGAAGCGTCTGCTGCTTAGTTTTAATCACCAGCTACGTTTCTGCAGGGCCTTTATGTCGTTTTGTTCTACATTT
2081 TTTTCTGAATACAGTTTCAGAACTTCAAAGTCACATCAAGTAACTAGAATTTGAGGTAGAAAAAAGCTGGATGTAAGTTG
2161 TAAATAGGAGGTTGACATGGAATATGAACAGTTTCATTAGTAGAACAAAAGGGCATGGAGTAAAAATGCTAATTTTGCAT
2241 AAATTTTTAAAACTCTAGGGTCTCAGAAAATATAGCATGGACTTAAAGTCTAGATGTGTTTTGTTGACATTTAAATATGA
2321 ATAGATTGATGATTTAATGTATTGGATTTTTTCTTAATTATGAAGTATTATTTAGGTATACTAATAACAAAATGGAGACG
2401 TGTGAAGAAAAATATTAATCTTTCTTCTCCCTCAGTACCACCTGTGAGGAAATCAGTGTTAACAGTGTGTACATTTTTCT
2481 TTACTCATGAATATGTATAGGGTTCATTTTCATATTTTTAATAAAAATTGGATTATATTCTTTTCAGTAAAAAAAAAAAA
2561 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' guGUUUAAGCCUAGAUGUCCCAu 5'
            ::|||    || ||:||||| 
Target 5' caTGAAT----ATGTATAGGGTt 3'
2486 - 2504 139.00 -11.20
2
miRNA  3' guGUUUAA--GCCUAGAUGUCCCAu 5'
            |||| |  :||: :|||||| | 
Target 5' ccCAAAGTGCTGGGATTACAGGCTt 3'
1118 - 1142 135.00 -14.22
3
miRNA  3' guGUUUAAGCCUAGAUGUCCCau 5'
            ||: | ||  |||:|||||  
Target 5' acCAGCTACGTTTCTGCAGGGcc 3'
2034 - 2056 133.00 -17.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30503469 29 COSMIC
COSN20122749 51 COSMIC
COSN30161663 90 COSMIC
COSN20113678 120 COSMIC
COSN24867530 150 COSMIC
COSN18123493 196 COSMIC
COSN5414813 324 COSMIC
COSN7161675 438 COSMIC
COSN5414814 785 COSMIC
COSN15692250 995 COSMIC
COSN23082128 1085 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1355567517 8 dbSNP
rs975379481 12 dbSNP
rs779412971 16 dbSNP
rs1279439086 18 dbSNP
rs772273974 21 dbSNP
rs1294351309 23 dbSNP
rs371421762 25 dbSNP
rs1447754795 29 dbSNP
rs748637082 30 dbSNP
rs756779930 33 dbSNP
rs1239253499 38 dbSNP
rs1479808403 41 dbSNP
rs780900551 45 dbSNP
rs1251770505 46 dbSNP
rs541532626 52 dbSNP
rs769637797 53 dbSNP
rs547335614 54 dbSNP
rs1434836748 59 dbSNP
rs768365404 60 dbSNP
rs775175656 62 dbSNP
rs909002255 63 dbSNP
rs774292773 64 dbSNP
rs761785886 69 dbSNP
rs1243503255 73 dbSNP
rs760466130 73 dbSNP
rs773344135 74 dbSNP
rs940429143 76 dbSNP
rs139284091 77 dbSNP
rs766569548 78 dbSNP
rs1220851798 79 dbSNP
rs754013388 81 dbSNP
rs755333478 89 dbSNP
rs762014006 95 dbSNP
rs150007419 98 dbSNP
rs1245719905 102 dbSNP
rs759014025 102 dbSNP
rs1459390512 104 dbSNP
rs780845506 108 dbSNP
rs1228118142 110 dbSNP
rs1252733821 112 dbSNP
rs1478673437 114 dbSNP
rs918712067 116 dbSNP
rs3214214 118 dbSNP
rs397710392 118 dbSNP
rs397759928 118 dbSNP
rs934279073 132 dbSNP
rs1364706595 135 dbSNP
rs1318690509 138 dbSNP
rs1469346343 146 dbSNP
rs1395136202 147 dbSNP
rs1321222435 151 dbSNP
rs940735506 155 dbSNP
rs1252669958 158 dbSNP
rs1403418944 159 dbSNP
rs1051257734 160 dbSNP
rs890022600 162 dbSNP
rs192786248 163 dbSNP
rs146740583 164 dbSNP
rs1387931847 168 dbSNP
rs1194961630 169 dbSNP
rs1468489456 178 dbSNP
rs1360972864 180 dbSNP
rs1054381655 181 dbSNP
rs1247822445 182 dbSNP
rs893253826 191 dbSNP
rs1221419355 192 dbSNP
rs1010700914 205 dbSNP
rs1023933858 212 dbSNP
rs1020116166 214 dbSNP
rs1229585713 216 dbSNP
rs1285098317 221 dbSNP
rs1341808146 225 dbSNP
rs971611863 238 dbSNP
rs1321260989 243 dbSNP
rs1222380636 251 dbSNP
rs1284302828 253 dbSNP
rs538332059 270 dbSNP
rs557781987 271 dbSNP
rs1428790625 292 dbSNP
rs906373500 294 dbSNP
rs958610900 295 dbSNP
rs73303599 297 dbSNP
rs1423901453 300 dbSNP
rs1016310985 305 dbSNP
rs961824207 309 dbSNP
rs972200800 310 dbSNP
rs1235101308 311 dbSNP
rs918776059 312 dbSNP
rs1241941778 315 dbSNP
rs1490615567 322 dbSNP
rs1213239792 324 dbSNP
rs934188961 327 dbSNP
rs986910680 328 dbSNP
rs1312964874 329 dbSNP
rs553505808 334 dbSNP
rs1480371911 336 dbSNP
rs1375448903 343 dbSNP
rs553669543 347 dbSNP
rs6587060 348 dbSNP
rs554274509 350 dbSNP
rs1466273751 352 dbSNP
rs542489024 353 dbSNP
rs975032687 366 dbSNP
rs1054391524 371 dbSNP
rs922209995 374 dbSNP
rs893084791 379 dbSNP
rs1183473172 381 dbSNP
rs1158649913 382 dbSNP
rs1344446028 384 dbSNP
rs77710816 389 dbSNP
rs187701571 390 dbSNP
rs1318759479 400 dbSNP
rs987659684 400 dbSNP
rs1268723556 401 dbSNP
rs1326963697 404 dbSNP
rs1378000980 404 dbSNP
rs1396391226 404 dbSNP
rs371945933 404 dbSNP
rs374557571 404 dbSNP
rs796622034 404 dbSNP
rs907269098 404 dbSNP
rs373309612 407 dbSNP
rs1343600477 408 dbSNP
rs1034177857 410 dbSNP
rs1279680148 412 dbSNP
rs545099070 413 dbSNP
rs1352178180 415 dbSNP
rs894405071 417 dbSNP
rs151289416 420 dbSNP
rs1037766262 421 dbSNP
rs200924467 421 dbSNP
rs1359640693 422 dbSNP
rs1255763372 424 dbSNP
rs1180291042 427 dbSNP
rs1428466384 429 dbSNP
rs1208169979 430 dbSNP
rs1248774074 430 dbSNP
rs1274902445 431 dbSNP
rs948014258 431 dbSNP
rs1225223253 433 dbSNP
rs1267148312 434 dbSNP
rs10713362 435 dbSNP
rs1166172112 435 dbSNP
rs1295748902 435 dbSNP
rs1310178407 435 dbSNP
rs1491459886 435 dbSNP
rs796436179 435 dbSNP
rs865802064 435 dbSNP
rs1458760597 436 dbSNP
rs1491110611 436 dbSNP
rs1490342704 437 dbSNP
rs1045070495 438 dbSNP
rs1463555362 439 dbSNP
rs906467259 439 dbSNP
rs562224309 440 dbSNP
rs1348548778 441 dbSNP
rs1386098109 442 dbSNP
rs1052233765 443 dbSNP
rs1206345049 445 dbSNP
rs892278262 446 dbSNP
rs1225570137 451 dbSNP
rs76278234 451 dbSNP
rs80307578 452 dbSNP
rs1423983450 456 dbSNP
rs1329455669 457 dbSNP
rs770251760 459 dbSNP
rs1337079549 460 dbSNP
rs1439414695 463 dbSNP
rs1387909749 465 dbSNP
rs1390629200 465 dbSNP
rs1278401693 466 dbSNP
rs527308112 477 dbSNP
rs1383098571 478 dbSNP
rs1431944878 480 dbSNP
rs1010616825 484 dbSNP
rs1290088040 485 dbSNP
rs1168144046 491 dbSNP
rs1359166932 497 dbSNP
rs773736287 502 dbSNP
rs547394609 503 dbSNP
rs560801207 504 dbSNP
rs1432583675 507 dbSNP
rs1265182063 513 dbSNP
rs1197348501 521 dbSNP
rs1483230491 525 dbSNP
rs542021462 527 dbSNP
rs1202631720 529 dbSNP
rs1021967965 536 dbSNP
rs963822897 545 dbSNP
rs996953681 549 dbSNP
rs1331036421 574 dbSNP
rs1299747601 576 dbSNP
rs1029311752 579 dbSNP
rs1006103301 580 dbSNP
rs2703779 592 dbSNP
rs1173304511 596 dbSNP
rs1465553253 598 dbSNP
rs962165489 602 dbSNP
rs1184199847 603 dbSNP
rs973491609 607 dbSNP
rs368917865 609 dbSNP
rs1179732115 612 dbSNP
rs1383226454 615 dbSNP
rs371770774 616 dbSNP
rs548115659 622 dbSNP
rs766555618 625 dbSNP
rs1342200694 631 dbSNP
rs1254797025 632 dbSNP
rs948145694 634 dbSNP
rs755098786 635 dbSNP
rs1288184984 636 dbSNP
rs1408385786 644 dbSNP
rs1408092297 652 dbSNP
rs1335040576 654 dbSNP
rs1395554282 663 dbSNP
rs765017868 671 dbSNP
rs145601167 672 dbSNP
rs986963085 678 dbSNP
rs1457758030 681 dbSNP
rs939290985 683 dbSNP
rs113062303 685 dbSNP
rs146508612 698 dbSNP
rs1454306340 701 dbSNP
rs1052266994 703 dbSNP
rs942955679 704 dbSNP
rs1312443678 708 dbSNP
rs1440309275 710 dbSNP
rs1381509112 711 dbSNP
rs1208800400 712 dbSNP
rs990782110 715 dbSNP
rs914818666 717 dbSNP
rs1272248387 722 dbSNP
rs1358859198 723 dbSNP
rs1043562591 725 dbSNP
rs538013962 733 dbSNP
rs899602074 737 dbSNP
rs551475538 750 dbSNP
rs1263878552 754 dbSNP
rs1322720727 764 dbSNP
rs1435819554 768 dbSNP
rs1387832159 769 dbSNP
rs1318406734 770 dbSNP
rs1406910016 772 dbSNP
rs1414310277 785 dbSNP
rs1462708134 789 dbSNP
rs571376336 790 dbSNP
rs533957480 795 dbSNP
rs955043329 807 dbSNP
rs1188649481 810 dbSNP
rs1448291882 812 dbSNP
rs35902356 821 dbSNP
rs1009154528 827 dbSNP
rs1214325206 829 dbSNP
rs1453806804 831 dbSNP
rs907316314 838 dbSNP
rs1015150964 840 dbSNP
rs553732839 843 dbSNP
rs1055638937 844 dbSNP
rs1229256890 854 dbSNP
rs1193675963 859 dbSNP
rs920761129 867 dbSNP
rs867264028 870 dbSNP
rs894290359 873 dbSNP
rs1006155670 874 dbSNP
rs191380712 875 dbSNP
rs1169863413 876 dbSNP
rs1322730455 879 dbSNP
rs980857225 880 dbSNP
rs927958987 884 dbSNP
rs1428667621 886 dbSNP
rs939323596 890 dbSNP
rs988096567 892 dbSNP
rs1470676719 896 dbSNP
rs533397379 897 dbSNP
rs897723388 899 dbSNP
rs1198611796 903 dbSNP
rs183513530 908 dbSNP
rs1277076755 910 dbSNP
rs1206191116 912 dbSNP
rs1043979192 913 dbSNP
rs556145682 925 dbSNP
rs374855231 926 dbSNP
rs1325019040 934 dbSNP
rs899634144 935 dbSNP
rs576204479 937 dbSNP
rs1402899037 939 dbSNP
rs1352137172 941 dbSNP
rs954467545 948 dbSNP
rs1007223122 949 dbSNP
rs545198160 959 dbSNP
rs558714147 967 dbSNP
rs555130769 970 dbSNP
rs751444331 972 dbSNP
rs1426510384 982 dbSNP
rs1326206053 983 dbSNP
rs1479725486 985 dbSNP
rs549728784 989 dbSNP
rs1183334626 994 dbSNP
rs1003915078 996 dbSNP
rs1231331906 998 dbSNP
rs1212359012 1003 dbSNP
rs572155543 1006 dbSNP
rs1277872836 1008 dbSNP
rs1262545838 1011 dbSNP
rs1331114090 1012 dbSNP
rs964149678 1014 dbSNP
rs990318309 1015 dbSNP
rs1408921045 1029 dbSNP
rs1370743234 1030 dbSNP
rs1304169981 1035 dbSNP
rs914849949 1048 dbSNP
rs1358114253 1050 dbSNP
rs541069701 1054 dbSNP
rs1468755093 1059 dbSNP
rs1263665359 1071 dbSNP
rs1445049429 1079 dbSNP
rs560864998 1081 dbSNP
rs928582835 1082 dbSNP
rs529610820 1087 dbSNP
rs1406093729 1088 dbSNP
rs1055860191 1092 dbSNP
rs745310944 1095 dbSNP
rs1483686818 1097 dbSNP
rs113198159 1098 dbSNP
rs1201842864 1103 dbSNP
rs941882278 1108 dbSNP
rs1376552891 1109 dbSNP
rs1227581072 1112 dbSNP
rs1314868556 1117 dbSNP
rs1454029694 1122 dbSNP
rs1037536656 1127 dbSNP
rs897769794 1132 dbSNP
rs1383333226 1136 dbSNP
rs769347900 1139 dbSNP
rs969545317 1140 dbSNP
rs981273957 1141 dbSNP
rs987102347 1144 dbSNP
rs1453538574 1150 dbSNP
rs993392470 1152 dbSNP
rs1167328267 1180 dbSNP
rs1304064435 1184 dbSNP
rs1413255248 1193 dbSNP
rs1181836253 1203 dbSNP
rs1051869070 1208 dbSNP
rs1035147058 1216 dbSNP
rs779246214 1217 dbSNP
rs1208071831 1233 dbSNP
rs1007275273 1235 dbSNP
rs748709571 1240 dbSNP
rs1317585857 1254 dbSNP
rs1241514467 1255 dbSNP
rs772615150 1256 dbSNP
rs1312391847 1265 dbSNP
rs1230010637 1271 dbSNP
rs1365242582 1275 dbSNP
rs913888648 1276 dbSNP
rs1382211151 1280 dbSNP
rs1012194732 1294 dbSNP
rs773534408 1299 dbSNP
rs1021762380 1307 dbSNP
rs1458678404 1310 dbSNP
rs761094982 1313 dbSNP
rs977679380 1314 dbSNP
rs1375846687 1320 dbSNP
rs1292168672 1325 dbSNP
rs1431827588 1326 dbSNP
rs921099031 1327 dbSNP
rs928633287 1328 dbSNP
rs1266139432 1334 dbSNP
rs960057918 1335 dbSNP
rs1051363098 1341 dbSNP
rs1488009403 1344 dbSNP
rs1289187718 1345 dbSNP
rs991468975 1353 dbSNP
rs543314056 1360 dbSNP
rs890918361 1364 dbSNP
rs939739369 1367 dbSNP
rs1224521106 1369 dbSNP
rs563005973 1374 dbSNP
rs1036711719 1378 dbSNP
rs898141446 1387 dbSNP
rs1345320066 1399 dbSNP
rs995501087 1407 dbSNP
rs1361713688 1408 dbSNP
rs916036561 1413 dbSNP
rs1418679576 1414 dbSNP
rs1371397646 1416 dbSNP
rs531954044 1425 dbSNP
rs1027873826 1428 dbSNP
rs1460480416 1433 dbSNP
rs905437226 1436 dbSNP
rs1176655164 1437 dbSNP
rs1002417690 1440 dbSNP
rs1480054403 1454 dbSNP
rs1035134875 1461 dbSNP
rs1329891083 1462 dbSNP
rs1241305502 1463 dbSNP
rs960804835 1466 dbSNP
rs1193593404 1469 dbSNP
rs551535093 1472 dbSNP
rs988153937 1477 dbSNP
rs1293441885 1498 dbSNP
rs1020929293 1503 dbSNP
rs967980864 1506 dbSNP
rs72830194 1510 dbSNP
rs919056424 1512 dbSNP
rs929231028 1517 dbSNP
rs1376467605 1523 dbSNP
rs763757554 1524 dbSNP
rs1051600666 1525 dbSNP
rs189370038 1528 dbSNP
rs1007221525 1529 dbSNP
rs1292280839 1530 dbSNP
rs143004164 1533 dbSNP
rs1427029631 1541 dbSNP
rs759496179 1547 dbSNP
rs1161114719 1548 dbSNP
rs1219357525 1550 dbSNP
rs1010617724 1555 dbSNP
rs1362891754 1583 dbSNP
rs1179271031 1585 dbSNP
rs1022230030 1587 dbSNP
rs1480881850 1588 dbSNP
rs1256316704 1590 dbSNP
rs1036744326 1595 dbSNP
rs1197073195 1603 dbSNP
rs192302725 1605 dbSNP
rs1230648266 1610 dbSNP
rs765382182 1612 dbSNP
rs1330197119 1615 dbSNP
rs931029801 1623 dbSNP
rs536219523 1625 dbSNP
rs1313534315 1630 dbSNP
rs1183812496 1639 dbSNP
rs999417129 1645 dbSNP
rs1451927221 1650 dbSNP
rs1035968491 1651 dbSNP
rs1322412100 1654 dbSNP
rs1457673858 1655 dbSNP
rs1384033434 1663 dbSNP
rs867014877 1665 dbSNP
rs369631020 1669 dbSNP
rs1002854115 1670 dbSNP
rs1368618465 1673 dbSNP
rs75741679 1680 dbSNP
rs185348501 1683 dbSNP
rs1442190046 1687 dbSNP
rs991520742 1688 dbSNP
rs1241868926 1689 dbSNP
rs544102061 1697 dbSNP
rs190191661 1700 dbSNP
rs532959805 1705 dbSNP
rs1296572922 1715 dbSNP
rs1284085951 1721 dbSNP
rs1399601242 1723 dbSNP
rs1203754373 1724 dbSNP
rs1020960453 1725 dbSNP
rs963795218 1726 dbSNP
rs1245375114 1730 dbSNP
rs1000912673 1735 dbSNP
rs973487579 1737 dbSNP
rs1435795087 1742 dbSNP
rs1317413728 1744 dbSNP
rs1315967631 1749 dbSNP
rs1406819364 1751 dbSNP
rs1380784745 1758 dbSNP
rs529299436 1759 dbSNP
rs1028723312 1762 dbSNP
rs919096062 1767 dbSNP
rs1308034532 1768 dbSNP
rs929182501 1772 dbSNP
rs762919199 1793 dbSNP
rs1241982144 1796 dbSNP
rs1191510188 1798 dbSNP
rs181402200 1800 dbSNP
rs911846549 1802 dbSNP
rs943256491 1806 dbSNP
rs1357533836 1807 dbSNP
rs986692520 1807 dbSNP
rs1272705931 1809 dbSNP
rs1203679455 1812 dbSNP
rs79740973 1819 dbSNP
rs1459668046 1821 dbSNP
rs1268298456 1822 dbSNP
rs961167165 1824 dbSNP
rs893449826 1832 dbSNP
rs1302284067 1833 dbSNP
rs751391207 1834 dbSNP
rs1430850633 1849 dbSNP
rs186424039 1855 dbSNP
rs1423080907 1860 dbSNP
rs902242377 1871 dbSNP
rs1044099017 1881 dbSNP
rs1166700952 1887 dbSNP
rs999063549 1896 dbSNP
rs1479275557 1897 dbSNP
rs1035853289 1902 dbSNP
rs896076706 1905 dbSNP
rs1199140448 1919 dbSNP
rs1470353015 1923 dbSNP
rs1489922143 1926 dbSNP
rs1254176267 1935 dbSNP
rs1205339484 1940 dbSNP
rs1338708137 1941 dbSNP
rs1404227869 1942 dbSNP
rs1447514460 1947 dbSNP
rs189458886 1956 dbSNP
rs574389071 1982 dbSNP
rs1282478933 1995 dbSNP
rs963381125 1996 dbSNP
rs1298351346 1998 dbSNP
rs1440984032 1998 dbSNP
rs200745397 1998 dbSNP
rs973795987 2001 dbSNP
rs780921198 2003 dbSNP
rs543022635 2004 dbSNP
rs1176179356 2007 dbSNP
rs1026420719 2014 dbSNP
rs1223625727 2026 dbSNP
rs1264406762 2034 dbSNP
rs750119717 2039 dbSNP
rs755527438 2040 dbSNP
rs1042529999 2042 dbSNP
rs148190603 2043 dbSNP
rs943310141 2044 dbSNP
rs1001343462 2050 dbSNP
rs1243124635 2056 dbSNP
rs1028343497 2063 dbSNP
rs1487046591 2065 dbSNP
rs531893271 2066 dbSNP
rs1452654588 2068 dbSNP
rs915131358 2071 dbSNP
rs1201374817 2087 dbSNP
rs1263110050 2088 dbSNP
rs1008156532 2091 dbSNP
rs946427901 2093 dbSNP
rs961283134 2105 dbSNP
rs1427269806 2107 dbSNP
rs1042444540 2109 dbSNP
rs1391351522 2110 dbSNP
rs923747530 2113 dbSNP
rs1347123158 2116 dbSNP
rs1432640309 2118 dbSNP
rs939048315 2119 dbSNP
rs141228760 2121 dbSNP
rs1405457951 2127 dbSNP
rs565132351 2137 dbSNP
rs1183689010 2150 dbSNP
rs1027223007 2154 dbSNP
rs373548284 2163 dbSNP
rs1013186565 2164 dbSNP
rs1364869751 2166 dbSNP
rs1261160445 2168 dbSNP
rs1218339006 2169 dbSNP
rs1314778377 2171 dbSNP
rs1291519660 2172 dbSNP
rs1246116610 2176 dbSNP
rs748788142 2185 dbSNP
rs1312254025 2187 dbSNP
rs547503299 2196 dbSNP
rs567628195 2197 dbSNP
rs1364696274 2198 dbSNP
rs1289826824 2201 dbSNP
rs1318280381 2202 dbSNP
rs938315394 2213 dbSNP
rs994884343 2214 dbSNP
rs1026702402 2219 dbSNP
rs778816363 2228 dbSNP
rs945613364 2231 dbSNP
rs1042562340 2238 dbSNP
rs950806913 2240 dbSNP
rs1008914829 2244 dbSNP
rs10549056 2253 dbSNP
rs796988661 2253 dbSNP
rs1018747502 2256 dbSNP
rs1245129427 2257 dbSNP
rs964544042 2261 dbSNP
rs1222835387 2273 dbSNP
rs778311047 2274 dbSNP
rs530138601 2277 dbSNP
rs1229967005 2279 dbSNP
rs1008272662 2280 dbSNP
rs1177784106 2281 dbSNP
rs1382120907 2285 dbSNP
rs1360344566 2297 dbSNP
rs1410475984 2304 dbSNP
rs34106745 2310 dbSNP
rs1019610432 2318 dbSNP
rs563407549 2320 dbSNP
rs530812353 2321 dbSNP
rs1161815761 2324 dbSNP
rs1026835178 2325 dbSNP
rs781497672 2333 dbSNP
rs1169694112 2348 dbSNP
rs1426615459 2352 dbSNP
rs1304864825 2357 dbSNP
rs977793722 2359 dbSNP
rs1329219303 2362 dbSNP
rs1435137184 2366 dbSNP
rs1490102919 2366 dbSNP
rs923562264 2368 dbSNP
rs1266307953 2375 dbSNP
rs1279594179 2384 dbSNP
rs939100846 2394 dbSNP
rs979881887 2398 dbSNP
rs1237482417 2400 dbSNP
rs538933068 2400 dbSNP
rs1056195920 2401 dbSNP
rs1306202152 2408 dbSNP
rs1309044495 2412 dbSNP
rs1285662034 2416 dbSNP
rs1224496668 2419 dbSNP
rs1360616159 2422 dbSNP
rs1301491801 2424 dbSNP
rs1393320927 2424 dbSNP
rs916319443 2425 dbSNP
rs1225104751 2428 dbSNP
rs1460407604 2429 dbSNP
rs1408200971 2430 dbSNP
rs959777943 2433 dbSNP
rs1451494850 2439 dbSNP
rs1479973507 2441 dbSNP
rs180926200 2442 dbSNP
rs1234649053 2445 dbSNP
rs912885305 2455 dbSNP
rs1419246302 2463 dbSNP
rs1044953445 2464 dbSNP
rs1193569592 2464 dbSNP
rs141841808 2464 dbSNP
rs755026277 2464 dbSNP
rs1479978768 2465 dbSNP
rs978710069 2467 dbSNP
rs899423490 2473 dbSNP
rs1204759088 2474 dbSNP
rs7220746 2475 dbSNP
rs534773915 2481 dbSNP
rs1047744229 2485 dbSNP
rs1241466637 2489 dbSNP
rs778327195 2492 dbSNP
rs886415787 2498 dbSNP
rs554671019 2501 dbSNP
rs1408269440 2503 dbSNP
rs185148195 2511 dbSNP
rs1469189180 2513 dbSNP
rs889893305 2517 dbSNP
rs1019009788 2524 dbSNP
rs964764177 2531 dbSNP
rs1454055790 2536 dbSNP
rs1412183203 2538 dbSNP
rs1362851641 2541 dbSNP
rs996058415 2547 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gugUUUA--AGCCUAGAUGUCCCAu 5'
             | ||  || | |:  ||| || 
Target 5' gtgACATTCTCTGTTTCTCAGAGTc 3'
2 - 26
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.435 6.4e-3 0.497 1.9e-3 32 Click to see details
GSE14794 Lymphoblastoid cells -0.256 7.4e-3 -0.253 8.1e-3 90 Click to see details
GSE17306 Multiple myeloma -0.29 2.2e-2 -0.186 1.0e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.235 3.1e-2 -0.321 4.9e-3 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.368 3.8e-2 0.053 4.0e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.386 4.6e-2 0.681 4.7e-4 20 Click to see details
GSE27834 Pluripotent stem cells 0.422 5.2e-2 0.374 7.7e-2 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.312 9.0e-2 0.227 1.7e-1 20 Click to see details
GSE21032 Prostate cancer 0.12 1.4e-1 0.093 2.0e-1 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.205 1.7e-1 -0.306 7.8e-2 23 Click to see details
GSE28544 Breast cancer 0.173 2.1e-1 -0.182 2.0e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.134 2.6e-1 0.041 4.2e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.071 2.7e-1 0.006 4.8e-1 79 Click to see details
GSE19536 Breast cancer -0.052 3.0e-1 -0.004 4.8e-1 100 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.192 3.2e-1 -0.071 4.3e-1 8 Click to see details
GSE28260 Renal cortex and medulla -0.077 4.0e-1 0.022 4.7e-1 13 Click to see details
GSE21849 B cell lymphoma 0.043 4.1e-1 0.312 5.0e-2 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.032 4.4e-1 -0.002 5.0e-1 25 Click to see details
GSE38226 Liver fibrosis 0.027 4.5e-1 -0.056 4.0e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.016 4.8e-1 0.070 4.1e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.619 0 -0.412 0 50 Click to see details
LIHC 0.366 0 0.384 0 49 Click to see details
HNSC 0.343 0.01 0.370 0.01 42 Click to see details
PCPG 0.995 0.03 1.000 0.5 3 Click to see details
KIRP 0.324 0.04 0.419 0.01 32 Click to see details
LUSC -0.279 0.04 -0.331 0.02 38 Click to see details
CHOL -0.565 0.06 -0.533 0.07 9 Click to see details
COAD 0.575 0.07 0.690 0.03 8 Click to see details
BRCA 0.163 0.07 0.098 0.19 84 Click to see details
BLCA 0.363 0.07 0.327 0.09 18 Click to see details
UCEC -0.293 0.11 -0.260 0.14 19 Click to see details
ESCA -0.351 0.14 -0.318 0.17 11 Click to see details
STAD -0.182 0.16 -0.057 0.38 32 Click to see details
LUAD 0.25 0.22 0.413 0.09 12 Click to see details
KIRC 0.084 0.25 0.077 0.27 68 Click to see details
CESC 0.652 0.27 0.500 0.33 3 Click to see details
PAAD -0.398 0.3 0.200 0.4 4 Click to see details
KICH 0.085 0.34 0.208 0.16 25 Click to see details
THCA -0.017 0.45 -0.073 0.29 59 Click to see details
THCA -0.017 0.45 -0.073 0.29 59 Click to see details
THCA -0.017 0.45 -0.073 0.29 59 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission