miRTarBase - #MIRT050000


—
pre-miRNA Information
pre-miRNA hsa-mir-28   
Genomic Coordinates chr3: 188688781 - 188688866
Synonyms MIRN28, hsa-mir-28, miR-28, MIR28
Description Homo sapiens miR-28 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-28-5p
Sequence 14| AAGGAGCUCACAGUCUAUUGAG |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 3 + 188688795 29233923 MiREDiBase
A-to-I 5 3 + 188688798 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN18185224 6 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1466099417 7 dbSNP
rs1333243027 9 dbSNP
rs1211406812 12 dbSNP
rs1380324091 13 dbSNP
rs1350747725 14 dbSNP
rs564264103 17 dbSNP
rs1315387654 18 dbSNP
rs1380847802 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CNN3   
Synonyms -
Description calponin 3
Transcript NM_001839   
Expression
Putative miRNA Targets on CNN3
3'UTR of CNN3
(miRNA target sites are highlighted)		 
>CNN3|NM_001839|3'UTR
   1 ATCCACACAGAAGGAGCTCAGTATTTAGTCCTTTGTTTTTATTCAGTGAGAACCAAGCTAGCCTTGAGTAATTTTTATCT
  81 TGTCTTCCTAAAACACTATTAAGCTTATTGTACTTTTAAGAAAAATTGCCTTACGTACATTCCTTTTTCCTTTTTCTGCC
 161 TCTTCCCTCAATAGTTGCCTTTTAGTGCTGTAATAGTTAAATCCTACAGCATAATCAATAACTCGCATATGAAGTAAAAA
 241 GGAATACTGTGAAAGGGGAGTACTCTTGTACAGCCAGTTCTTTTATGCAAAAATCTATGCATTTTTACAATCTTATATTA
 321 AACTGGTATTTTCAAACAATAGGAAACTTTTTTTTTTTTTTTTTTTTTTTACAGTTTAGTGTATCTGGTTTCTACATGGA
 401 AGACTAAACTCATGCTTATTGCTAAATGTGGTCTTTGCCAACTAAATTTAAGATGCAGCATTTTAGAAATTTACATATCA
 481 ATGTTTCTACAGTATTGTTTGCTAATTTTTAAATAAAGTCATGATCAGTGTGCATTTGTGATTATATGTGTACTCATTCT
 561 CTTACCTAGCGAACAAGATCTTTTCAGAGTGGTGTTTCTAAAAGAGCATGTACAAAAGTGGCCTGTGGACATTTAGGCCT
 641 GGGTGATGCATTTGCTCTTCCTGTTTGTGCCAATGTATCAATGTAGAGTTGCTCTGTTTTCTTCAACTGTATTTATTGCT
 721 GCATTTCTCAGCATAAACTTATCCCATTGTATTTTTTATAAATAAATATTTTTTTTGAACTTTCATATGAACC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaguuAUCUGACACUCGAGGAa 5'
               |: || |  ||:||:| 
Target 5' actctTGTACAGCCAGTTCTTt 3'
 262 - 283 117.00 -8.30
2 
miRNA  3' gaGUUAUCUG---ACA-CUCGAGGAa 5'
            ||||: |:   ||| |||:| || 
Target 5' gcCAATGTATCAATGTAGAGTTGCTc 3'
 669 - 694 116.00 -10.20
3 
miRNA  3' gaGU-UAUCUGACACUCGAGgaa 5'
            || | |||  | ||||||   
Target 5' tcCACACAGA-AG-GAGCTCagt 3'
 2 - 22 110.00 -10.32
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26971149 9 COSMIC
COSN30115242 70 COSMIC
COSN1110393 73 COSMIC
COSN30690123 84 COSMIC
COSN31584702 91 COSMIC
COSN31593503 104 COSMIC
COSN30163675 109 COSMIC
COSN30508242 135 COSMIC
COSN30127507 149 COSMIC
COSN31550034 180 COSMIC
COSN31536785 261 COSMIC
COSN30543583 274 COSMIC
COSN20095061 348 COSMIC
COSN7472368 389 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1217442978 4 dbSNP
rs897359252 6 dbSNP
rs1353803328 8 dbSNP
rs747438073 9 dbSNP
rs758733559 14 dbSNP
rs1385711806 15 dbSNP
rs10803 19 dbSNP
rs1206253765 21 dbSNP
rs748610679 23 dbSNP
rs375439592 34 dbSNP
rs192297808 40 dbSNP
rs1176514596 47 dbSNP
rs1033620439 53 dbSNP
rs1425267776 55 dbSNP
rs941650125 56 dbSNP
rs1000274083 57 dbSNP
rs1173330135 66 dbSNP
rs1428213593 77 dbSNP
rs1296501064 82 dbSNP
rs547326662 109 dbSNP
rs1048777595 110 dbSNP
rs1294568387 111 dbSNP
rs1020296745 112 dbSNP
rs1385226341 116 dbSNP
rs1300645072 118 dbSNP
rs1318935929 124 dbSNP
rs927039265 131 dbSNP
rs1014267359 134 dbSNP
rs971636516 135 dbSNP
rs757600317 136 dbSNP
rs1373574339 138 dbSNP
rs1309704449 142 dbSNP
rs896370487 143 dbSNP
rs1056409779 148 dbSNP
rs913100911 155 dbSNP
rs1188999854 157 dbSNP
rs1489421795 157 dbSNP
rs1371233017 158 dbSNP
rs1167610289 161 dbSNP
rs1477961218 169 dbSNP
rs989123671 171 dbSNP
rs1421946230 174 dbSNP
rs1474533893 182 dbSNP
rs1409806079 184 dbSNP
rs1002423581 190 dbSNP
rs1352156787 203 dbSNP
rs1456823194 206 dbSNP
rs1188703454 218 dbSNP
rs1302657565 222 dbSNP
rs551288924 225 dbSNP
rs1006853142 227 dbSNP
rs3789700 244 dbSNP
rs954087790 256 dbSNP
rs1213844120 259 dbSNP
rs146582464 260 dbSNP
rs1323452406 262 dbSNP
rs1219232938 264 dbSNP
rs998313879 267 dbSNP
rs1488296493 272 dbSNP
rs1273253224 279 dbSNP
rs1195190745 285 dbSNP
rs571604039 289 dbSNP
rs1474857750 292 dbSNP
rs531084514 293 dbSNP
rs930408175 295 dbSNP
rs3789699 297 dbSNP
rs531558706 315 dbSNP
rs1035950873 316 dbSNP
rs1243805494 317 dbSNP
rs562537097 319 dbSNP
rs549074175 326 dbSNP
rs1296417394 329 dbSNP
rs1410338741 333 dbSNP
rs1351233047 337 dbSNP
rs1328313327 340 dbSNP
rs1448967137 340 dbSNP
rs1408226490 342 dbSNP
rs1393159381 346 dbSNP
rs1163983534 347 dbSNP
rs1284597119 350 dbSNP
rs1461309096 351 dbSNP
rs1006194015 355 dbSNP
rs1243700617 361 dbSNP
rs1416124381 364 dbSNP
rs1185034770 369 dbSNP
rs1473186792 370 dbSNP
rs1218210479 371 dbSNP
rs1239589812 371 dbSNP
rs1253498722 371 dbSNP
rs1314363797 371 dbSNP
rs1354317420 371 dbSNP
rs1482450215 371 dbSNP
rs377001315 371 dbSNP
rs56226800 371 dbSNP
rs58217295 371 dbSNP
rs745741865 371 dbSNP
rs769477904 371 dbSNP
rs779933325 371 dbSNP
rs879041563 371 dbSNP
rs879075272 371 dbSNP
rs944388072 371 dbSNP
rs1336337741 372 dbSNP
rs1491434464 372 dbSNP
rs888713806 372 dbSNP
rs79385426 373 dbSNP
rs912120713 377 dbSNP
rs3182732 392 dbSNP
rs986329984 396 dbSNP
rs188421793 399 dbSNP
rs1452768472 414 dbSNP
rs111824275 416 dbSNP
rs11540277 420 dbSNP
rs1208857931 422 dbSNP
rs770375059 433 dbSNP
rs1203478038 442 dbSNP
rs979381205 449 dbSNP
rs967449864 450 dbSNP
rs1020388511 457 dbSNP
rs1014236247 462 dbSNP
rs1459501562 473 dbSNP
rs774950822 475 dbSNP
rs1177242429 477 dbSNP
rs1219873131 478 dbSNP
rs1232385702 481 dbSNP
rs960046754 488 dbSNP
rs1478430267 500 dbSNP
rs531865234 527 dbSNP
rs1423367822 538 dbSNP
rs1328424407 544 dbSNP
rs1002118216 549 dbSNP
rs1400711807 554 dbSNP
rs1448914620 555 dbSNP
rs1326708280 556 dbSNP
rs552260175 562 dbSNP
rs539885923 565 dbSNP
rs572680265 566 dbSNP
rs1267436778 567 dbSNP
rs1277637661 571 dbSNP
rs949861988 580 dbSNP
rs1276076284 586 dbSNP
rs1321034227 594 dbSNP
rs905148040 601 dbSNP
rs1222471375 604 dbSNP
rs1048848455 610 dbSNP
rs1320376987 611 dbSNP
rs1194423516 614 dbSNP
rs1273000733 631 dbSNP
rs995084440 642 dbSNP
rs1452659360 648 dbSNP
rs1201151566 655 dbSNP
rs1245002619 667 dbSNP
rs1440112799 673 dbSNP
rs1194578304 679 dbSNP
rs1424093540 680 dbSNP
rs756242919 683 dbSNP
rs59784221 686 dbSNP
rs897547786 688 dbSNP
rs1467047332 689 dbSNP
rs183826383 696 dbSNP
rs532005914 707 dbSNP
rs1395737116 711 dbSNP
rs1405860998 721 dbSNP
rs548363848 727 dbSNP
rs925873145 742 dbSNP
rs556197238 743 dbSNP
rs911547310 746 dbSNP
rs1278508270 756 dbSNP
rs1392789551 758 dbSNP
rs1225742697 766 dbSNP
rs1341985682 767 dbSNP
rs1212109054 769 dbSNP
rs1251081751 769 dbSNP
rs1289693392 770 dbSNP
rs1161863463 777 dbSNP
rs1265705493 777 dbSNP
rs985381510 777 dbSNP
rs1476946784 779 dbSNP
rs1190821973 786 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gagUUAUCUGACAC-UCGAGGAa 5'
             |||  ||||||  |||||| 
Target 5' --aAAT--ACTGTGCTGCTCCTa 3'
 		1 - 19
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17498 Multiple myeloma 0.547 1.3e-4 0.317 2.3e-2 40 Click to see details
GSE21032 Prostate cancer 0.284 4.6e-3 0.273 6.3e-3 83 Click to see details
GSE17306 Multiple myeloma 0.274 2.8e-2 0.345 7.6e-3 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.369 3.5e-2 0.287 8.2e-2 25 Click to see details
GSE14794 Lymphoblastoid cells -0.186 4.0e-2 -0.149 8.1e-2 90 Click to see details
GSE27834 Pluripotent stem cells -0.424 5.1e-2 -0.344 9.6e-2 16 Click to see details
GSE38226 Liver fibrosis -0.284 1.1e-1 -0.238 1.5e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.182 1.6e-1 -0.203 1.3e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.291 1.8e-1 0.098 3.8e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.182 1.9e-1 0.184 1.9e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.17 2.1e-1 0.120 2.9e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.233 2.7e-1 0.083 4.2e-1 9 Click to see details
GSE19536 Breast cancer -0.046 3.2e-1 0.037 3.6e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer 0.093 3.5e-1 -0.014 4.8e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.074 3.8e-1 0.137 2.8e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.035 3.8e-1 0.085 2.3e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.036 3.9e-1 0.045 3.6e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.062 3.9e-1 -0.036 4.4e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.078 4.0e-1 -0.060 4.2e-1 13 Click to see details
GSE21849 B cell lymphoma -0.045 4.1e-1 0.429 1.0e-2 29 Click to see details
GSE28544 Breast cancer 0.024 4.6e-1 -0.045 4.2e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.401 0.01 0.434 0.01 32 Click to see details
KICH -0.428 0.02 -0.389 0.03 25 Click to see details
UCEC 0.462 0.02 0.509 0.01 19 Click to see details
PAAD -0.898 0.05 -0.800 0.1 4 Click to see details
LIHC 0.231 0.06 0.117 0.21 49 Click to see details
STAD 0.26 0.08 0.304 0.05 32 Click to see details
LUSC -0.2 0.11 -0.226 0.09 38 Click to see details
LUAD 0.316 0.16 0.357 0.13 12 Click to see details
ESCA 0.296 0.19 0.273 0.21 11 Click to see details
BLCA -0.214 0.2 -0.259 0.15 18 Click to see details
PCPG 0.76 0.23 0.500 0.33 3 Click to see details
THCA -0.092 0.24 0.020 0.44 59 Click to see details
PRAD 0.088 0.27 0.110 0.22 50 Click to see details
COAD 0.165 0.35 0.167 0.35 8 Click to see details
CESC -0.379 0.38 -0.500 0.33 3 Click to see details
BRCA -0.034 0.38 -0.010 0.46 84 Click to see details
HNSC -0.041 0.4 0.064 0.34 42 Click to see details
KIRC -0.025 0.42 0.018 0.44 68 Click to see details
CHOL -0.005 0.49 0.017 0.48 9 Click to see details
CHOL -0.005 0.49 0.017 0.48 9 Click to see details
CHOL -0.005 0.49 0.017 0.48 9 Click to see details
82 hsa-miR-28-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000595 CDKN1A cyclin dependent kinase inhibitor 1A 4 1
MIRT006402 MPL MPL proto-oncogene, thrombopoietin receptor 3 1
MIRT006411 N4BP1 NEDD4 binding protein 1 1 1
MIRT006414 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT006416 TEX261 testis expressed 261 1 1
MIRT006418 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT006419 E2F6 E2F transcription factor 6 1 1
MIRT049989 ZCCHC3 zinc finger CCHC-type containing 3 1 1
MIRT049990 TPM4 tropomyosin 4 1 1
MIRT049991 TULP4 tubby like protein 4 1 1
MIRT049992 SNX1 sorting nexin 1 1 1
MIRT049993 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT049994 AAAS aladin WD repeat nucleoporin 1 1
MIRT049995 CENPV centromere protein V 1 1
MIRT049996 NRN1 neuritin 1 1 1
MIRT049997 GEMIN4 gem nuclear organelle associated protein 4 1 1
MIRT049998 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT049999 UNG uracil DNA glycosylase 1 1
MIRT050000 CNN3 calponin 3 1 1
MIRT050001 KLHL12 kelch like family member 12 1 1
MIRT050002 TLK1 tousled like kinase 1 1 1
MIRT050003 SREBF2 sterol regulatory element binding transcription factor 2 4 1
MIRT050004 RAB36 RAB36, member RAS oncogene family 1 1
MIRT050005 ZNF106 zinc finger protein 106 1 1
MIRT050006 SETD7 SET domain containing lysine methyltransferase 7 1 1
MIRT050007 DENND4B DENN domain containing 4B 1 1
MIRT050008 CS citrate synthase 1 1
MIRT050009 CD276 CD276 molecule 1 1
MIRT050010 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT050011 SMYD1 SET and MYND domain containing 1 2 5
MIRT050012 SIK1 salt inducible kinase 1 1 1
MIRT054748 MAD2L1 mitotic arrest deficient 2 like 1 3 1
MIRT054749 BAG1 BCL2 associated athanogene 1 3 1
MIRT054750 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT317835 CCND3 cyclin D3 2 2
MIRT367642 ARHGAP42 Rho GTPase activating protein 42 2 4
MIRT443876 DDTL D-dopachrome tautomerase like 2 2
MIRT447544 RNF165 ring finger protein 165 2 2
MIRT447611 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT447838 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448193 FAM168A family with sequence similarity 168 member A 2 2
MIRT448713 KLHL11 kelch like family member 11 2 2
MIRT450179 KLF7 Kruppel like factor 7 2 2
MIRT450312 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT460792 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT466332 THRA thyroid hormone receptor, alpha 2 2
MIRT467610 SLC7A5 solute carrier family 7 member 5 2 2
MIRT471609 PAQR5 progestin and adipoQ receptor family member 5 2 2
MIRT472144 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT476588 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT486265 LINC00346 long intergenic non-protein coding RNA 346 2 4
MIRT486480 TSC22D1 TSC22 domain family member 1 2 2
MIRT487978 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489428 TUBB2A tubulin beta 2A class IIa 2 2
MIRT500781 TMED4 transmembrane p24 trafficking protein 4 2 6
MIRT501235 SEMA4C semaphorin 4C 2 6
MIRT511045 NRF1 nuclear respiratory factor 1 2 2
MIRT512837 IER3 immediate early response 3 2 2
MIRT513091 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT513543 PRDM2 PR/SET domain 2 2 4
MIRT532391 UMPS uridine monophosphate synthetase 2 2
MIRT535846 MSI2 musashi RNA binding protein 2 2 2
MIRT537892 EDA2R ectodysplasin A2 receptor 2 2
MIRT552769 YIPF6 Yip1 domain family member 6 2 2
MIRT553549 TMEM167A transmembrane protein 167A 2 4
MIRT557228 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT566756 MORF4L1 mortality factor 4 like 1 2 2
MIRT567505 FOXJ3 forkhead box J3 2 2
MIRT568165 CCDC6 coiled-coil domain containing 6 2 2
MIRT570263 PRSS16 protease, serine 16 2 2
MIRT614727 TEAD3 TEA domain transcription factor 3 2 2
MIRT668894 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT691021 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT697421 ZFP91 ZFP91 zinc finger protein 2 2
MIRT711474 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT720189 CMC4 C-X9-C motif containing 4 2 2
MIRT720622 PIANP PILR alpha associated neural protein 2 2
MIRT731420 IGF1 insulin like growth factor 1 3 1
MIRT732850 LINC00265 long intergenic non-protein coding RNA 265 3 0
MIRT732851 PCNA proliferating cell nuclear antigen 3 0
MIRT736342 FOXO1 forkhead box O1 3 0
MIRT755341 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-28 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-28 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-28 Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 down-regulated
miR-28 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-28 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-28 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-28-5p Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-28-5p Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-28-5p Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-28-5p Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-28 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-28-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-28-5p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 resistant
hsa-miR-28-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-28-5p Michicarcin NSC191959 resistant
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Laryngeal Cancer cell line (Hep2)
hsa-miR-28-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-28-5p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-28-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-28-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-28-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-28-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-28-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-28-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-28-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-28-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-28-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission