miRTarBase - #MIRT050009


—
pre-miRNA Information
pre-miRNA hsa-mir-28   
Genomic Coordinates chr3: 188688781 - 188688866
Synonyms MIRN28, hsa-mir-28, miR-28, MIR28
Description Homo sapiens miR-28 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-28-5p
Sequence 14| AAGGAGCUCACAGUCUAUUGAG |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 3 + 188688795 29233923 MiREDiBase
A-to-I 5 3 + 188688798 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN18185224 6 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1466099417 7 dbSNP
rs1333243027 9 dbSNP
rs1211406812 12 dbSNP
rs1380324091 13 dbSNP
rs1350747725 14 dbSNP
rs564264103 17 dbSNP
rs1315387654 18 dbSNP
rs1380847802 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CD276   
Synonyms 4Ig-B7-H3, B7-H3, B7H3, B7RP-2
Description CD276 molecule
Transcript NM_001024736   
Other Transcripts NM_025240   
Expression
Putative miRNA Targets on CD276
3'UTR of CD276
(miRNA target sites are highlighted)		 
>CD276|NM_001024736|3'UTR
   1 CCATGAGGACCAGGGAGCTGCTACCCCTCCCTACAGCTCCTACCCTCTGGCTGCAATGGGGCTGCACTGTGAGCCCTGCC
  81 CCCAACAGATGCATCCTGCTCTGACAGGTGGGCTCCTTCTCCAAAGGATGCGATACACAGACCACTGTGCAGCCTTATTT
 161 CTCCAATGGACATGATTCCCAAGTCATCCTGCTGCCTTTTTTCTTATAGACACAATGAACAGACCACCCACAACCTTAGT
 241 TCTCTAAGTCATCCTGCCTGCTGCCTTATTTCACAGTACATACATTTCTTAGGGACACAGTACACTGACCACATCACCAC
 321 CCTCTTCTTCCAGTGCTGCGTGGACCATCTGGCTGCCTTTTTTCTCCAAAAGATGCAATATTCAGACTGACTGACCCCCT
 401 GCCTTATTTCACCAAAGACACGATGCATAGTCACCCCGGCCTTGTTTCTCCAATGGCCGTGATACACTAGTGATCATGTT
 481 CAGCCCTGCTTCCACCTGCATAGAATCTTTTCTTCTCAGACAGGGACAGTGCGGCCTCAACATCTCCTGGAGTCTAGAAG
 561 CTGTTTCCTTTCCCCTCCTTCCTCCTCTTGCTCTAGCCTTAATACTGGCCTTTTCCCTCCCTGCCCCAAGTGAAGACAGG
 641 GCACTCTGCGCCCACCACATGCACAGCTGTGCATGGAGACCTGCAGGTGCACGTGCTGGAACACGTGTGGTTCCCCCCTG
 721 GCCCAGCCTCCTCTGCAGTGCCCCTCTCCCCTGCCCATCCTCCCCACGGAAGCATGTGCTGGTCACACTGGTTCTCCAGG
 801 GGTCTGTGATGGGGCCCCTGGGGGTCAGCTTCTGTCCCTCTGCCTTCTCACCTCTTTGTTCCTTTCTTTTCATGTATCCA
 881 TTCAGTTGATGTTTATTGAGCAACTACAGATGTCAGCACTGTGTTAGGTGCTGGGGGCCCTGCGTGGGAAGATAAAGTTC
 961 CTCCCTCAAGGACTCCCCATCCAGCTGGGAGACAGACAACTAACTACACTGCACCCTGCGGTTTGCAGGGGGCTCCTGCC
1041 TGGCTCCCTGCTCCACACCTCCTCTGTGGCTCAAGGCTTCCTGGATACCTCACCCCCATCCCACCCATAATTCTTACCCA
1121 GAGCATGGGGTTGGGGCGGAAACCTGGAGAGAGGGACATAGCCCCTCGCCACGGCTAGAGAATCTGGTGGTGTCCAAAAT
1201 GTCTGTCCAGGTGTGGGCAGGTGGGCAGGCACCAAGGCCCTCTGGACCTTTCATAGCAGCAGAAAAGGCAGAGCCTGGGG
1281 CAGGGCAGGGCCAGGAATGCTTTGGGGACACCGAGGGGACTGCCCCCCACCCCCACCATGGTGCTATTCTGGGGCTGGGG
1361 CAGTCTTTTCCTGGCTTGCCTCTGGCCAGCTCCTGGCCTCTGGTAGAGTGAGACTTCAGACGTTCTGATGCCTTCCGGAT
1441 GTCATCTCTCCCTGCCCCAGGAATGGAAGATGTGAGGACTTCTAATTTAAATGTGGGACTCGGAGGGATTTTGTAAACTG
1521 GGGGTATATTTTGGGGAAAATAAATGTCTTTGTAAAAAGCTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaguuAUCUGACAC---UCGAGGAa 5'
               | | || ||   ||||||| 
Target 5' ctggcTTGCCTCTGGCCAGCTCCTg 3'
 1371 - 1395 149.00 -13.10
2 
miRNA  3' gaguuauCUG-ACACUCGAGGAa 5'
                 |||  |||:|||||| 
Target 5' ctgctctGACAGGTGGGCTCCTt 3'
 96 - 118 143.00 -23.20
3 
miRNA  3' gaguuaucugacacUCGAGGAa 5'
                        ||||||| 
Target 5' ctacccctccctacAGCTCCTa 3'
 21 - 42 140.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30478963 3 COSMIC
COSN31503253 4 COSMIC
COSN30464935 14 COSMIC
COSN30506083 14 COSMIC
COSN30483303 31 COSMIC
COSN30104764 52 COSMIC
COSN30516643 57 COSMIC
COSN30189601 74 COSMIC
COSN31595411 105 COSMIC
COSN31581721 109 COSMIC
COSN9638745 284 COSMIC
COSN9638746 484 COSMIC
COSN28359211 518 COSMIC
COSN6642683 534 COSMIC
COSN21335422 647 COSMIC
COSN31596413 660 COSMIC
COSN28837842 719 COSMIC
COSN20048425 744 COSMIC
COSN31572254 763 COSMIC
COSN30595014 784 COSMIC
COSN31588458 796 COSMIC
COSN28875007 1021 COSMIC
COSN31562699 1129 COSMIC
COSN31595421 1258 COSMIC
COSN31485318 1314 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746218612 2 dbSNP
rs146613897 3 dbSNP
rs780405407 5 dbSNP
rs749759061 9 dbSNP
rs769175881 11 dbSNP
rs1335567815 14 dbSNP
rs772576905 16 dbSNP
rs746594072 25 dbSNP
rs1019187057 26 dbSNP
rs1254947736 32 dbSNP
rs965530664 34 dbSNP
rs370743733 35 dbSNP
rs776285711 36 dbSNP
rs759262357 37 dbSNP
rs765084107 40 dbSNP
rs1271465785 43 dbSNP
rs1337947083 44 dbSNP
rs1214517215 45 dbSNP
rs918619925 46 dbSNP
rs1281486680 49 dbSNP
rs996526810 49 dbSNP
rs931272574 51 dbSNP
rs1210433073 52 dbSNP
rs575523842 57 dbSNP
rs1227047389 69 dbSNP
rs984389365 71 dbSNP
rs916794833 82 dbSNP
rs890136661 85 dbSNP
rs1360698684 91 dbSNP
rs1204868544 92 dbSNP
rs1233995393 93 dbSNP
rs189728434 96 dbSNP
rs1046592030 108 dbSNP
rs1391293505 115 dbSNP
rs1397726520 130 dbSNP
rs956406496 132 dbSNP
rs906689573 133 dbSNP
rs1181939111 135 dbSNP
rs1010659194 137 dbSNP
rs935118268 138 dbSNP
rs1475913652 139 dbSNP
rs566550688 144 dbSNP
rs1052120489 158 dbSNP
rs1409075136 162 dbSNP
rs1181411886 189 dbSNP
rs969562907 193 dbSNP
rs760341849 201 dbSNP
rs1207847953 203 dbSNP
rs1488002868 205 dbSNP
rs553249180 208 dbSNP
rs981447754 208 dbSNP
rs750765092 213 dbSNP
rs928207381 214 dbSNP
rs1010490954 223 dbSNP
rs960996414 236 dbSNP
rs1385773682 238 dbSNP
rs1336870074 240 dbSNP
rs982706926 247 dbSNP
rs181215978 249 dbSNP
rs1428928630 259 dbSNP
rs908546702 284 dbSNP
rs572948155 285 dbSNP
rs766959402 294 dbSNP
rs1385867035 298 dbSNP
rs1157467471 302 dbSNP
rs1411818441 303 dbSNP
rs3816661 304 dbSNP
rs1196602729 309 dbSNP
rs1432417502 318 dbSNP
rs920447343 323 dbSNP
rs1358580772 329 dbSNP
rs1214609459 334 dbSNP
rs1469985442 339 dbSNP
rs1018804289 340 dbSNP
rs962174090 341 dbSNP
rs1351413318 347 dbSNP
rs972825278 350 dbSNP
rs1025710154 352 dbSNP
rs1304595813 357 dbSNP
rs1370770054 357 dbSNP
rs1442723349 367 dbSNP
rs1362575222 377 dbSNP
rs149943340 380 dbSNP
rs1008572101 387 dbSNP
rs1386443979 389 dbSNP
rs529497803 392 dbSNP
rs1295803746 395 dbSNP
rs952693484 397 dbSNP
rs1170791264 407 dbSNP
rs984087819 409 dbSNP
rs533802051 413 dbSNP
rs1434006921 417 dbSNP
rs369003182 422 dbSNP
rs1052141634 423 dbSNP
rs879158440 425 dbSNP
rs1240588841 435 dbSNP
rs1192677829 436 dbSNP
rs373518338 438 dbSNP
rs186956928 439 dbSNP
rs563018234 445 dbSNP
rs1277476674 449 dbSNP
rs892130103 453 dbSNP
rs1204995528 454 dbSNP
rs1010691634 459 dbSNP
rs533714457 460 dbSNP
rs1236976555 465 dbSNP
rs969972823 469 dbSNP
rs1340421656 473 dbSNP
rs928181372 474 dbSNP
rs1269263157 484 dbSNP
rs1186470037 486 dbSNP
rs1374524240 487 dbSNP
rs1327734094 494 dbSNP
rs1002339400 496 dbSNP
rs1414167883 497 dbSNP
rs1035681416 499 dbSNP
rs1476516101 502 dbSNP
rs1427599848 504 dbSNP
rs1418477180 506 dbSNP
rs1167596564 508 dbSNP
rs1337780785 519 dbSNP
rs551451570 525 dbSNP
rs1243973413 532 dbSNP
rs566878568 533 dbSNP
rs1044540 534 dbSNP
rs962668640 536 dbSNP
rs1213595838 537 dbSNP
rs1482302503 540 dbSNP
rs749049554 549 dbSNP
rs921330055 551 dbSNP
rs931816531 556 dbSNP
rs946463576 559 dbSNP
rs1232168837 560 dbSNP
rs1407508521 568 dbSNP
rs1314681199 569 dbSNP
rs1050092225 579 dbSNP
rs1353754979 582 dbSNP
rs944641534 591 dbSNP
rs549058548 593 dbSNP
rs147193445 598 dbSNP
rs1008845722 603 dbSNP
rs879499482 607 dbSNP
rs892153047 625 dbSNP
rs1316694431 626 dbSNP
rs535250934 632 dbSNP
rs1418627134 638 dbSNP
rs946335209 639 dbSNP
rs1469044467 641 dbSNP
rs1417177390 648 dbSNP
rs775446716 650 dbSNP
rs762960803 651 dbSNP
rs550788538 652 dbSNP
rs149742284 653 dbSNP
rs368822846 653 dbSNP
rs904899791 655 dbSNP
rs745855896 656 dbSNP
rs1240441893 661 dbSNP
rs1162321274 665 dbSNP
rs993290100 667 dbSNP
rs79829424 681 dbSNP
rs1294568646 682 dbSNP
rs767508401 685 dbSNP
rs952807085 692 dbSNP
rs539745058 693 dbSNP
rs1171550668 694 dbSNP
rs1401007329 696 dbSNP
rs1279999504 697 dbSNP
rs1444127016 700 dbSNP
rs1382445161 701 dbSNP
rs1319656376 705 dbSNP
rs1023657829 706 dbSNP
rs1434968518 711 dbSNP
rs756364362 712 dbSNP
rs931787427 715 dbSNP
rs982397085 715 dbSNP
rs191790483 716 dbSNP
rs1232498253 717 dbSNP
rs531060711 719 dbSNP
rs780352101 719 dbSNP
rs1280071520 721 dbSNP
rs1351600033 725 dbSNP
rs1015776342 731 dbSNP
rs962700373 734 dbSNP
rs974010747 739 dbSNP
rs1251486011 753 dbSNP
rs1028829981 757 dbSNP
rs1446542827 761 dbSNP
rs1468629261 762 dbSNP
rs1274576350 764 dbSNP
rs749705856 765 dbSNP
rs772047085 768 dbSNP
rs779528594 769 dbSNP
rs748612481 780 dbSNP
rs1376872182 783 dbSNP
rs988305842 787 dbSNP
rs774799934 798 dbSNP
rs1382109222 801 dbSNP
rs1456199757 803 dbSNP
rs1320955953 807 dbSNP
rs75461818 812 dbSNP
rs74483206 813 dbSNP
rs776311742 816 dbSNP
rs774927839 819 dbSNP
rs1302400349 820 dbSNP
rs1373743421 820 dbSNP
rs915410252 823 dbSNP
rs745468859 824 dbSNP
rs753570415 827 dbSNP
rs946493109 830 dbSNP
rs1278052556 840 dbSNP
rs1372009805 848 dbSNP
rs769617314 850 dbSNP
rs944505957 851 dbSNP
rs910232828 852 dbSNP
rs1214357896 854 dbSNP
rs775393414 857 dbSNP
rs762909809 861 dbSNP
rs765917514 863 dbSNP
rs763927514 864 dbSNP
rs897702557 867 dbSNP
rs774286872 873 dbSNP
rs1048961197 874 dbSNP
rs572883271 875 dbSNP
rs533809963 877 dbSNP
rs1454926718 878 dbSNP
rs1254506738 882 dbSNP
rs571895056 886 dbSNP
rs760288660 890 dbSNP
rs1396105035 892 dbSNP
rs1460332832 898 dbSNP
rs555496186 899 dbSNP
rs1279440688 914 dbSNP
rs547890362 920 dbSNP
rs79333664 925 dbSNP
rs573806288 928 dbSNP
rs1303723800 929 dbSNP
rs182879085 931 dbSNP
rs563112340 933 dbSNP
rs1234152460 935 dbSNP
rs1003921303 939 dbSNP
rs186442060 944 dbSNP
rs937804092 945 dbSNP
rs866697685 951 dbSNP
rs199957112 955 dbSNP
rs879317254 961 dbSNP
rs1427541094 962 dbSNP
rs545685681 966 dbSNP
rs561502193 968 dbSNP
rs1256742009 970 dbSNP
rs776466043 978 dbSNP
rs1211451034 979 dbSNP
rs1486555420 985 dbSNP
rs1209052245 990 dbSNP
rs752100213 992 dbSNP
rs1249384867 998 dbSNP
rs1225597703 1007 dbSNP
rs1307134150 1009 dbSNP
rs140463237 1020 dbSNP
rs1220559662 1025 dbSNP
rs1489923730 1028 dbSNP
rs548993494 1031 dbSNP
rs1415912468 1032 dbSNP
rs561031419 1033 dbSNP
rs910253571 1034 dbSNP
rs1461737920 1036 dbSNP
rs944394955 1038 dbSNP
rs1266224043 1045 dbSNP
rs954173594 1046 dbSNP
rs1008336790 1047 dbSNP
rs1179716551 1049 dbSNP
rs555354761 1054 dbSNP
rs1366090722 1058 dbSNP
rs1454718860 1061 dbSNP
rs1489227670 1063 dbSNP
rs1476141245 1066 dbSNP
rs1040477670 1067 dbSNP
rs531850414 1074 dbSNP
rs1195017439 1081 dbSNP
rs144321764 1086 dbSNP
rs1364030387 1088 dbSNP
rs1426941098 1090 dbSNP
rs374296672 1095 dbSNP
rs1200717841 1096 dbSNP
rs1349469740 1097 dbSNP
rs1292733310 1098 dbSNP
rs1389217061 1100 dbSNP
rs1308464272 1103 dbSNP
rs1234507486 1108 dbSNP
rs1336298721 1116 dbSNP
rs1048992700 1118 dbSNP
rs887621873 1119 dbSNP
rs755309582 1123 dbSNP
rs781590578 1124 dbSNP
rs11072436 1126 dbSNP
rs1393176254 1130 dbSNP
rs1222928846 1138 dbSNP
rs1292831765 1139 dbSNP
rs1480409220 1147 dbSNP
rs1180938867 1148 dbSNP
rs979744611 1154 dbSNP
rs1175580166 1160 dbSNP
rs1180809745 1162 dbSNP
rs1045163740 1168 dbSNP
rs1252691122 1173 dbSNP
rs937649091 1175 dbSNP
rs1056230699 1177 dbSNP
rs1358495217 1178 dbSNP
rs1372447702 1181 dbSNP
rs905311276 1187 dbSNP
rs1238917825 1188 dbSNP
rs1336770236 1196 dbSNP
rs1311906043 1197 dbSNP
rs1438348198 1198 dbSNP
rs1369798151 1220 dbSNP
rs1383912689 1221 dbSNP
rs1446874020 1223 dbSNP
rs1388034731 1228 dbSNP
rs1382093466 1230 dbSNP
rs940195686 1231 dbSNP
rs1454228816 1232 dbSNP
rs1164572823 1233 dbSNP
rs1037201158 1252 dbSNP
rs1453508184 1254 dbSNP
rs1252631984 1255 dbSNP
rs1369592742 1261 dbSNP
rs1259712922 1264 dbSNP
rs777071836 1266 dbSNP
rs995804679 1268 dbSNP
rs1003630690 1285 dbSNP
rs551642207 1292 dbSNP
rs1299395856 1304 dbSNP
rs889814553 1306 dbSNP
rs1035457831 1313 dbSNP
rs1008609289 1314 dbSNP
rs1164817505 1324 dbSNP
rs1384873530 1330 dbSNP
rs1382232032 1332 dbSNP
rs1044570 1336 dbSNP
rs1296536953 1338 dbSNP
rs1307151251 1339 dbSNP
rs892453494 1339 dbSNP
rs1009787656 1340 dbSNP
rs1202614409 1343 dbSNP
rs1310940623 1346 dbSNP
rs566816110 1347 dbSNP
rs1173422320 1350 dbSNP
rs1479119437 1353 dbSNP
rs956146074 1355 dbSNP
rs1266005872 1362 dbSNP
rs968188959 1363 dbSNP
rs1485573589 1364 dbSNP
rs1281466086 1373 dbSNP
rs986669869 1376 dbSNP
rs747829934 1379 dbSNP
rs533744643 1385 dbSNP
rs1203090363 1386 dbSNP
rs1337044789 1387 dbSNP
rs1269165436 1392 dbSNP
rs1044581 1395 dbSNP
rs926502873 1396 dbSNP
rs966226119 1404 dbSNP
rs1414065327 1408 dbSNP
rs1375895991 1409 dbSNP
rs759894707 1422 dbSNP
rs918953317 1423 dbSNP
rs1044589 1426 dbSNP
rs768090983 1428 dbSNP
rs984722531 1430 dbSNP
rs1394626768 1432 dbSNP
rs777506034 1437 dbSNP
rs1478208280 1438 dbSNP
rs948659484 1439 dbSNP
rs939809336 1440 dbSNP
rs573743683 1445 dbSNP
rs1044662989 1451 dbSNP
rs907020380 1462 dbSNP
rs920120606 1470 dbSNP
rs939461482 1477 dbSNP
rs116643657 1478 dbSNP
rs1465147229 1489 dbSNP
rs1334075785 1494 dbSNP
rs892485683 1496 dbSNP
rs1290885181 1497 dbSNP
rs1009485276 1498 dbSNP
rs1453215178 1499 dbSNP
rs1022510178 1502 dbSNP
rs796701267 1503 dbSNP
rs556433067 1506 dbSNP
rs904146867 1507 dbSNP
rs1298061882 1508 dbSNP
rs1466320626 1509 dbSNP
rs1402621752 1510 dbSNP
rs80213726 1512 dbSNP
rs1162875094 1514 dbSNP
rs76695918 1514 dbSNP
rs752733565 1519 dbSNP
rs1223017364 1520 dbSNP
rs1041099617 1522 dbSNP
rs756225323 1523 dbSNP
rs966222089 1524 dbSNP
rs764276353 1526 dbSNP
rs748710470 1535 dbSNP
rs754114582 1540 dbSNP
rs567121944 1547 dbSNP
rs1204789551 1555 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaguuauCUG-ACACUCGAGGAa 5'
                 |||  |||:|||||| 
Target 5' ctgctctGACAGGTGGGCTCCTt 3'
 		2 - 24
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_001024736 | 3UTR | AGCAGCAGAAAAGGCAGAGCCUGGGGCAGGGCAGGGCCAGGAAUGCUUUGGGGACACCGAGGGGACUGCCCCCCACCCCCACCAUGGUGCUAUUCUGGGGCUGGGGCAGUCUUUUCCUGGCUUGCCUCUGGCCAGCUCCUGGCCUCUGGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903826
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_NS
Location of target site NM_025240 | 3UTR | ACCGAGGGGACUGCCCCCCACCCCCACCAUGGUGCUAUUCUGGGGCUGGGGCAGUCUUUUCCUGGCUUGCCUCUGGCCAGCUCCUGGCCUCUGGUAGAGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001024736 | 3UTR | UUGCCUCUGGCCAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER+ ER+ breast cancer 0.348 6.6e-2 0.414 3.5e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.302 7.1e-2 0.210 1.6e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.376 7.6e-2 0.350 9.2e-2 16 Click to see details
GSE19536 Breast cancer -0.122 1.1e-1 0.040 3.5e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.241 1.3e-1 0.143 2.6e-1 23 Click to see details
GSE38226 Liver fibrosis 0.205 1.9e-1 0.247 1.4e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.159 2.3e-1 -0.017 4.7e-1 24 Click to see details
GSE28544 Breast cancer -0.155 2.3e-1 -0.185 1.9e-1 24 Click to see details
GSE21849 B cell lymphoma -0.139 2.4e-1 0.251 9.5e-2 29 Click to see details
GSE21032 Prostate cancer -0.074 2.5e-1 0.015 4.5e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.197 2.6e-1 -0.187 2.7e-1 13 Click to see details
GSE17306 Multiple myeloma 0.093 2.6e-1 0.154 1.5e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.075 2.8e-1 -0.157 1.1e-1 64 Click to see details
GSE14794 Lymphoblastoid cells -0.041 3.5e-1 -0.063 2.8e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.122 3.5e-1 -0.147 3.2e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.147 3.5e-1 -0.417 1.3e-1 9 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.069 3.9e-1 0.614 2.0e-3 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.057 3.9e-1 -0.063 3.8e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.037 4.2e-1 -0.023 4.5e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.006 4.8e-1 0.081 2.4e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.999 0 -1.000 0.5 4 Click to see details
THCA -0.323 0.01 -0.232 0.04 59 Click to see details
HNSC 0.277 0.04 0.172 0.14 42 Click to see details
LUAD 0.496 0.05 0.469 0.06 12 Click to see details
CHOL 0.422 0.13 0.567 0.06 9 Click to see details
KIRC 0.128 0.15 0.192 0.06 68 Click to see details
KIRP 0.176 0.17 0.068 0.36 32 Click to see details
BLCA 0.237 0.17 0.172 0.25 18 Click to see details
CESC 0.794 0.21 1.000 0.5 3 Click to see details
ESCA 0.252 0.23 0.164 0.31 11 Click to see details
UCEC -0.171 0.24 -0.195 0.21 19 Click to see details
KICH 0.133 0.26 0.047 0.41 25 Click to see details
PRAD -0.069 0.32 -0.117 0.21 50 Click to see details
LIHC -0.061 0.34 -0.038 0.4 49 Click to see details
STAD 0.074 0.34 0.389 0.01 32 Click to see details
BRCA 0.036 0.37 0.105 0.17 84 Click to see details
PCPG 0.26 0.42 0.500 0.33 3 Click to see details
COAD 0.06 0.44 -0.024 0.48 8 Click to see details
LUSC -0.003 0.49 -0.047 0.39 38 Click to see details
LUSC -0.003 0.49 -0.047 0.39 38 Click to see details
LUSC -0.003 0.49 -0.047 0.39 38 Click to see details
82 hsa-miR-28-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000595 CDKN1A cyclin dependent kinase inhibitor 1A 4 1
MIRT006402 MPL MPL proto-oncogene, thrombopoietin receptor 3 1
MIRT006411 N4BP1 NEDD4 binding protein 1 1 1
MIRT006414 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT006416 TEX261 testis expressed 261 1 1
MIRT006418 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT006419 E2F6 E2F transcription factor 6 1 1
MIRT049989 ZCCHC3 zinc finger CCHC-type containing 3 1 1
MIRT049990 TPM4 tropomyosin 4 1 1
MIRT049991 TULP4 tubby like protein 4 1 1
MIRT049992 SNX1 sorting nexin 1 1 1
MIRT049993 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT049994 AAAS aladin WD repeat nucleoporin 1 1
MIRT049995 CENPV centromere protein V 1 1
MIRT049996 NRN1 neuritin 1 1 1
MIRT049997 GEMIN4 gem nuclear organelle associated protein 4 1 1
MIRT049998 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT049999 UNG uracil DNA glycosylase 1 1
MIRT050000 CNN3 calponin 3 1 1
MIRT050001 KLHL12 kelch like family member 12 1 1
MIRT050002 TLK1 tousled like kinase 1 1 1
MIRT050003 SREBF2 sterol regulatory element binding transcription factor 2 4 1
MIRT050004 RAB36 RAB36, member RAS oncogene family 1 1
MIRT050005 ZNF106 zinc finger protein 106 1 1
MIRT050006 SETD7 SET domain containing lysine methyltransferase 7 1 1
MIRT050007 DENND4B DENN domain containing 4B 1 1
MIRT050008 CS citrate synthase 1 1
MIRT050009 CD276 CD276 molecule 1 1
MIRT050010 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT050011 SMYD1 SET and MYND domain containing 1 2 5
MIRT050012 SIK1 salt inducible kinase 1 1 1
MIRT054748 MAD2L1 mitotic arrest deficient 2 like 1 3 1
MIRT054749 BAG1 BCL2 associated athanogene 1 3 1
MIRT054750 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT317835 CCND3 cyclin D3 2 2
MIRT367642 ARHGAP42 Rho GTPase activating protein 42 2 4
MIRT443876 DDTL D-dopachrome tautomerase like 2 2
MIRT447544 RNF165 ring finger protein 165 2 2
MIRT447611 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT447838 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448193 FAM168A family with sequence similarity 168 member A 2 2
MIRT448713 KLHL11 kelch like family member 11 2 2
MIRT450179 KLF7 Kruppel like factor 7 2 2
MIRT450312 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT460792 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT466332 THRA thyroid hormone receptor, alpha 2 2
MIRT467610 SLC7A5 solute carrier family 7 member 5 2 2
MIRT471609 PAQR5 progestin and adipoQ receptor family member 5 2 2
MIRT472144 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT476588 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT486265 LINC00346 long intergenic non-protein coding RNA 346 2 4
MIRT486480 TSC22D1 TSC22 domain family member 1 2 2
MIRT487978 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489428 TUBB2A tubulin beta 2A class IIa 2 2
MIRT500781 TMED4 transmembrane p24 trafficking protein 4 2 6
MIRT501235 SEMA4C semaphorin 4C 2 6
MIRT511045 NRF1 nuclear respiratory factor 1 2 2
MIRT512837 IER3 immediate early response 3 2 2
MIRT513091 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT513543 PRDM2 PR/SET domain 2 2 4
MIRT532391 UMPS uridine monophosphate synthetase 2 2
MIRT535846 MSI2 musashi RNA binding protein 2 2 2
MIRT537892 EDA2R ectodysplasin A2 receptor 2 2
MIRT552769 YIPF6 Yip1 domain family member 6 2 2
MIRT553549 TMEM167A transmembrane protein 167A 2 4
MIRT557228 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT566756 MORF4L1 mortality factor 4 like 1 2 2
MIRT567505 FOXJ3 forkhead box J3 2 2
MIRT568165 CCDC6 coiled-coil domain containing 6 2 2
MIRT570263 PRSS16 protease, serine 16 2 2
MIRT614727 TEAD3 TEA domain transcription factor 3 2 2
MIRT668894 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT691021 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT697421 ZFP91 ZFP91 zinc finger protein 2 2
MIRT711474 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT720189 CMC4 C-X9-C motif containing 4 2 2
MIRT720622 PIANP PILR alpha associated neural protein 2 2
MIRT731420 IGF1 insulin like growth factor 1 3 1
MIRT732850 LINC00265 long intergenic non-protein coding RNA 265 3 0
MIRT732851 PCNA proliferating cell nuclear antigen 3 0
MIRT736342 FOXO1 forkhead box O1 3 0
MIRT755341 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-28 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-28 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-28 Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 down-regulated
miR-28 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-28 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-28 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-28-5p Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-28-5p Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-28-5p Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-28-5p Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-28 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-28-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-28-5p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 resistant
hsa-miR-28-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-28-5p Michicarcin NSC191959 resistant
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Laryngeal Cancer cell line (Hep2)
hsa-miR-28-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-28-5p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-28-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-28-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-28-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-28-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-28-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-28-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-28-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-28-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-28-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission