miRTarBase - #MIRT050010


—
pre-miRNA Information
pre-miRNA hsa-mir-28   
Genomic Coordinates chr3: 188688781 - 188688866
Synonyms MIRN28, hsa-mir-28, miR-28, MIR28
Description Homo sapiens miR-28 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-28-5p
Sequence 14| AAGGAGCUCACAGUCUAUUGAG |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 3 + 188688795 29233923 MiREDiBase
A-to-I 5 3 + 188688798 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN18185224 6 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1466099417 7 dbSNP
rs1333243027 9 dbSNP
rs1211406812 12 dbSNP
rs1380324091 13 dbSNP
rs1350747725 14 dbSNP
rs564264103 17 dbSNP
rs1315387654 18 dbSNP
rs1380847802 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TUFM   
Synonyms COXPD4, EF-TuMT, EFTU, P43
Description Tu translation elongation factor, mitochondrial
Transcript NM_003321   
Expression
Putative miRNA Targets on TUFM
3'UTR of TUFM
(miRNA target sites are highlighted)		 
>TUFM|NM_003321|3'UTR
   1 GTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTC
  81 ATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGG
 161 AGGTCAGTAAACTTTGAATAGTAAGCCAGCCTGTGTCCTGTGTCCTTTGTGCAAATTGGAGAGGATAGGGGAGGACAAAA
 241 AGGGTGTTGAACCCCAGACAGATGGGGAGCTTGTGAGATCCCAGAGCAGTTTTAACGGATAAATCAAGTCCAGTGAGCTT
 321 AGTGATTGCCTAGACACAGTAGGATGCCGTTATTCAGCCTCCTGGGAGATAGTGGGAAAGAATGTTCTATCGCTCTGGAG
 401 CCAGCATGGCTTCAGCTCAGGTGCCAAACCCATCTTGTTTCCTCGGAATACTAAGTGAATGTCTAGCATCCATTCACATT
 481 CTGTGGGAACAGGGACTGGACAGGCATACCTCAGATGCTGTAGGTTTGCTTCCAGACTACCACAATAAAGCAGGTCACAA
 561 ATTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaGUUAUCUGAC-------ACUC-GAGGAa 5'
            ||:|||: ||       | || ||||| 
Target 5' caCAGTAGGATGCCGTTATTCAGCCTCCTg 3'
 335 - 364 124.00 -12.40
2 
miRNA  3' gaguuaUCU---GAC-ACUCGAGGaa 5'
                |||   ||| | ||||:|  
Target 5' gtgtgcAGATCTCTGCTCAGCTTCcc 3'
 1 - 26 116.00 -9.50
3 
miRNA  3' gaguuaUCUGACACUCGAGGaa 5'
                || :|||||| |||  
Target 5' atggggAGCTTGTGAGATCCca 3'
 262 - 283 116.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
318742 24 ClinVar
318741 37 ClinVar
888046 60 ClinVar
318740 110 ClinVar
318739 149 ClinVar
888045 229 ClinVar
886767 270 ClinVar
318738 300 ClinVar
318737 349 ClinVar
318736 370 ClinVar
318735 398 ClinVar
886766 433 ClinVar
318734 445 ClinVar
318733 517 ClinVar
318732 561 ClinVar
COSN30179282 8 COSMIC
COSN30537335 16 COSMIC
COSN31486863 18 COSMIC
COSN30113743 30 COSMIC
COSN30541551 49 COSMIC
COSN30155398 78 COSMIC
COSN8601048 85 COSMIC
COSN30535634 127 COSMIC
COSN30449534 134 COSMIC
COSN30497409 135 COSMIC
COSN13664048 153 COSMIC
COSN30155876 176 COSMIC
COSN31496794 176 COSMIC
COSN9645344 296 COSMIC
COSN8497236 414 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762084377 2 dbSNP
rs775147317 5 dbSNP
rs754109544 6 dbSNP
rs1351551764 13 dbSNP
rs771944721 14 dbSNP
rs373191561 15 dbSNP
rs757770137 18 dbSNP
rs770524897 20 dbSNP
rs8754 24 dbSNP
rs1416253988 26 dbSNP
rs751866536 29 dbSNP
rs769555744 30 dbSNP
rs747899650 31 dbSNP
rs1413723113 35 dbSNP
rs375508343 37 dbSNP
rs1328521537 39 dbSNP
rs1185486977 40 dbSNP
rs755419385 45 dbSNP
rs927691785 55 dbSNP
rs978443922 58 dbSNP
rs565030775 59 dbSNP
rs545220973 60 dbSNP
rs576560704 61 dbSNP
rs754579415 65 dbSNP
rs35585079 68 dbSNP
rs1347438044 75 dbSNP
rs562976933 86 dbSNP
rs954404253 87 dbSNP
rs959335543 88 dbSNP
rs1184833141 91 dbSNP
rs1028589708 92 dbSNP
rs190216362 96 dbSNP
rs574407904 102 dbSNP
rs554559253 104 dbSNP
rs1247467430 105 dbSNP
rs1194968944 108 dbSNP
rs753564296 110 dbSNP
rs143744958 119 dbSNP
rs1171304888 123 dbSNP
rs1401687479 126 dbSNP
rs1467369370 128 dbSNP
rs1015794203 136 dbSNP
rs1199729319 138 dbSNP
rs1318062101 139 dbSNP
rs1320596588 141 dbSNP
rs886051876 149 dbSNP
rs888577395 157 dbSNP
rs1232155790 159 dbSNP
rs1015748904 160 dbSNP
rs1345142201 171 dbSNP
rs1351668130 179 dbSNP
rs572110958 186 dbSNP
rs1283223663 212 dbSNP
rs1012927296 217 dbSNP
rs1276196498 218 dbSNP
rs1215442236 226 dbSNP
rs1253104639 227 dbSNP
rs558681318 229 dbSNP
rs1191167737 234 dbSNP
rs139913617 238 dbSNP
rs1369870425 241 dbSNP
rs1331768853 243 dbSNP
rs1054982040 245 dbSNP
rs1448780648 245 dbSNP
rs939294187 247 dbSNP
rs1397986342 252 dbSNP
rs569816634 252 dbSNP
rs1383211057 261 dbSNP
rs1463498645 262 dbSNP
rs1327223230 263 dbSNP
rs1169692485 265 dbSNP
rs927786704 269 dbSNP
rs867305584 270 dbSNP
rs563851226 273 dbSNP
rs1394350792 277 dbSNP
rs1409399930 280 dbSNP
rs1336593926 288 dbSNP
rs1238514553 294 dbSNP
rs1042259354 296 dbSNP
rs945118810 297 dbSNP
rs3088215 300 dbSNP
rs900139592 306 dbSNP
rs989519145 314 dbSNP
rs936392572 318 dbSNP
rs903720305 328 dbSNP
rs145987380 336 dbSNP
rs1438080929 337 dbSNP
rs1452796371 345 dbSNP
rs760210915 348 dbSNP
rs749982691 349 dbSNP
rs1459397614 356 dbSNP
rs1166098861 358 dbSNP
rs36083726 363 dbSNP
rs1417848959 368 dbSNP
rs567224368 370 dbSNP
rs1231624706 373 dbSNP
rs1391060677 384 dbSNP
rs965648243 389 dbSNP
rs547344358 391 dbSNP
rs560701501 398 dbSNP
rs1442423322 400 dbSNP
rs1416458045 402 dbSNP
rs938030301 404 dbSNP
rs926604805 405 dbSNP
rs974155708 409 dbSNP
rs1339547996 420 dbSNP
rs962817639 421 dbSNP
rs527678767 433 dbSNP
rs1004386535 438 dbSNP
rs761853090 444 dbSNP
rs542944452 445 dbSNP
rs1241998110 451 dbSNP
rs1027083677 454 dbSNP
rs1297477008 461 dbSNP
rs1448668786 462 dbSNP
rs1461577295 463 dbSNP
rs1166223496 466 dbSNP
rs997083243 470 dbSNP
rs571337265 472 dbSNP
rs1017273975 478 dbSNP
rs1432983866 479 dbSNP
rs1354536465 488 dbSNP
rs572268917 491 dbSNP
rs1394050141 495 dbSNP
rs1297688659 507 dbSNP
rs768538192 510 dbSNP
rs1326950435 511 dbSNP
rs1057086882 515 dbSNP
rs886051875 517 dbSNP
rs1240227585 523 dbSNP
rs1271788902 525 dbSNP
rs906500754 533 dbSNP
rs141736683 537 dbSNP
rs763065235 545 dbSNP
rs184878749 561 dbSNP
rs903606950 562 dbSNP
rs563070419 563 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaguuaUCUG---ACACUCGAGGAa 5'
                ||||   ||||||||||| 
Target 5' -----gAGACGAGTGTGAGCTCCTa 3'
 		1 - 20
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.608 8.1e-4 0.596 1.1e-3 24 Click to see details
GSE21032 Prostate cancer -0.335 9.8e-4 -0.209 2.9e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.571 1.4e-3 -0.593 8.9e-4 25 Click to see details
GSE21849 B cell lymphoma -0.47 5.0e-3 -0.271 7.8e-2 29 Click to see details
GSE32688 Pancreatic cancer -0.415 9.1e-3 -0.131 2.4e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.201 3.8e-2 0.184 5.2e-2 79 Click to see details
GSE28260 Renal cortex and medulla 0.491 4.4e-2 0.385 9.7e-2 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.364 5.7e-2 -0.089 3.5e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.198 5.8e-2 -0.178 8.0e-2 64 Click to see details
GSE19350 CNS germ cell tumors -0.413 9.1e-2 -0.413 9.1e-2 12 Click to see details
GSE14794 Lymphoblastoid cells 0.133 1.1e-1 0.126 1.2e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.316 1.2e-1 0.235 1.9e-1 16 Click to see details
GSE38226 Liver fibrosis 0.253 1.3e-1 0.195 2.0e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.23 1.3e-1 0.185 1.9e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.191 1.9e-1 -0.076 3.6e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.335 1.9e-1 0.450 1.1e-1 9 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.177 2.3e-1 -0.669 6.3e-4 20 Click to see details
GSE19536 Breast cancer 0.075 2.3e-1 -0.008 4.7e-1 99 Click to see details
GSE17498 Multiple myeloma 0.111 2.5e-1 0.097 2.8e-1 40 Click to see details
GSE17306 Multiple myeloma 0.038 4.0e-1 -0.031 4.2e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.046 4.2e-1 0.104 3.2e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.633 0.02 -0.709 0.01 11 Click to see details
LUSC -0.339 0.02 -0.394 0.01 38 Click to see details
CESC 0.995 0.03 1.000 0.5 3 Click to see details
PAAD -0.93 0.03 -1.000 0.5 4 Click to see details
CHOL 0.611 0.04 0.783 0.01 9 Click to see details
THCA -0.218 0.05 -0.233 0.04 59 Click to see details
HNSC -0.233 0.07 -0.281 0.04 42 Click to see details
LUAD -0.45 0.07 -0.469 0.06 12 Click to see details
BRCA -0.157 0.08 -0.097 0.19 84 Click to see details
UCEC -0.215 0.19 -0.193 0.21 19 Click to see details
STAD -0.157 0.2 -0.184 0.16 32 Click to see details
PRAD 0.09 0.27 0.047 0.37 50 Click to see details
KICH 0.13 0.27 0.044 0.42 25 Click to see details
KIRC -0.059 0.32 -0.047 0.35 68 Click to see details
PCPG 0.446 0.35 0.500 0.33 3 Click to see details
COAD 0.112 0.4 0.190 0.33 8 Click to see details
BLCA -0.038 0.44 -0.168 0.25 18 Click to see details
KIRP 0.026 0.44 -0.026 0.44 32 Click to see details
LIHC 0.013 0.46 0.086 0.28 49 Click to see details
LIHC 0.013 0.46 0.086 0.28 49 Click to see details
LIHC 0.013 0.46 0.086 0.28 49 Click to see details
82 hsa-miR-28-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000595 CDKN1A cyclin dependent kinase inhibitor 1A 4 1
MIRT006402 MPL MPL proto-oncogene, thrombopoietin receptor 3 1
MIRT006411 N4BP1 NEDD4 binding protein 1 1 1
MIRT006414 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT006416 TEX261 testis expressed 261 1 1
MIRT006418 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT006419 E2F6 E2F transcription factor 6 1 1
MIRT049989 ZCCHC3 zinc finger CCHC-type containing 3 1 1
MIRT049990 TPM4 tropomyosin 4 1 1
MIRT049991 TULP4 tubby like protein 4 1 1
MIRT049992 SNX1 sorting nexin 1 1 1
MIRT049993 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT049994 AAAS aladin WD repeat nucleoporin 1 1
MIRT049995 CENPV centromere protein V 1 1
MIRT049996 NRN1 neuritin 1 1 1
MIRT049997 GEMIN4 gem nuclear organelle associated protein 4 1 1
MIRT049998 ZBTB47 zinc finger and BTB domain containing 47 1 1
MIRT049999 UNG uracil DNA glycosylase 1 1
MIRT050000 CNN3 calponin 3 1 1
MIRT050001 KLHL12 kelch like family member 12 1 1
MIRT050002 TLK1 tousled like kinase 1 1 1
MIRT050003 SREBF2 sterol regulatory element binding transcription factor 2 4 1
MIRT050004 RAB36 RAB36, member RAS oncogene family 1 1
MIRT050005 ZNF106 zinc finger protein 106 1 1
MIRT050006 SETD7 SET domain containing lysine methyltransferase 7 1 1
MIRT050007 DENND4B DENN domain containing 4B 1 1
MIRT050008 CS citrate synthase 1 1
MIRT050009 CD276 CD276 molecule 1 1
MIRT050010 TUFM Tu translation elongation factor, mitochondrial 1 1
MIRT050011 SMYD1 SET and MYND domain containing 1 2 5
MIRT050012 SIK1 salt inducible kinase 1 1 1
MIRT054748 MAD2L1 mitotic arrest deficient 2 like 1 3 1
MIRT054749 BAG1 BCL2 associated athanogene 1 3 1
MIRT054750 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT317835 CCND3 cyclin D3 2 2
MIRT367642 ARHGAP42 Rho GTPase activating protein 42 2 4
MIRT443876 DDTL D-dopachrome tautomerase like 2 2
MIRT447544 RNF165 ring finger protein 165 2 2
MIRT447611 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT447838 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448193 FAM168A family with sequence similarity 168 member A 2 2
MIRT448713 KLHL11 kelch like family member 11 2 2
MIRT450179 KLF7 Kruppel like factor 7 2 2
MIRT450312 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT460792 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT466332 THRA thyroid hormone receptor, alpha 2 2
MIRT467610 SLC7A5 solute carrier family 7 member 5 2 2
MIRT471609 PAQR5 progestin and adipoQ receptor family member 5 2 2
MIRT472144 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT476588 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT486265 LINC00346 long intergenic non-protein coding RNA 346 2 4
MIRT486480 TSC22D1 TSC22 domain family member 1 2 2
MIRT487978 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489428 TUBB2A tubulin beta 2A class IIa 2 2
MIRT500781 TMED4 transmembrane p24 trafficking protein 4 2 6
MIRT501235 SEMA4C semaphorin 4C 2 6
MIRT511045 NRF1 nuclear respiratory factor 1 2 2
MIRT512837 IER3 immediate early response 3 2 2
MIRT513091 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT513543 PRDM2 PR/SET domain 2 2 4
MIRT532391 UMPS uridine monophosphate synthetase 2 2
MIRT535846 MSI2 musashi RNA binding protein 2 2 2
MIRT537892 EDA2R ectodysplasin A2 receptor 2 2
MIRT552769 YIPF6 Yip1 domain family member 6 2 2
MIRT553549 TMEM167A transmembrane protein 167A 2 4
MIRT557228 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT566756 MORF4L1 mortality factor 4 like 1 2 2
MIRT567505 FOXJ3 forkhead box J3 2 2
MIRT568165 CCDC6 coiled-coil domain containing 6 2 2
MIRT570263 PRSS16 protease, serine 16 2 2
MIRT614727 TEAD3 TEA domain transcription factor 3 2 2
MIRT668894 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT691021 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT697421 ZFP91 ZFP91 zinc finger protein 2 2
MIRT711474 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT720189 CMC4 C-X9-C motif containing 4 2 2
MIRT720622 PIANP PILR alpha associated neural protein 2 2
MIRT731420 IGF1 insulin like growth factor 1 3 1
MIRT732850 LINC00265 long intergenic non-protein coding RNA 265 3 0
MIRT732851 PCNA proliferating cell nuclear antigen 3 0
MIRT736342 FOXO1 forkhead box O1 3 0
MIRT755341 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-28 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-28 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-28 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-28 Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 down-regulated
miR-28 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-28 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-28 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-28-5p Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-28-5p Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-28-5p Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-28-5p Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-28 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-28 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-28-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-28-5p 2-[3-hydroxy-4-(acetylamino)phenyl]benzothiazole 395431 NSC699969 resistant
hsa-miR-28-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-28-5p Michicarcin NSC191959 resistant
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Laryngeal Cancer cell line (Hep2)
hsa-miR-28-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer tissue
hsa-miR-28-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-28-5p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-28-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-28-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-28-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-28-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-28-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-28-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-28-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-28-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-28-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-28-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-28-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-28-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-28-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission