pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-150 |
Genomic Coordinates | chr19: 49500785 - 49500868 |
Description | Homo sapiens miR-150 stem-loop |
Comment | This miRNA sequence is predicted based on homology to a verified miRNA from mouse . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-150-5p | |||||||||||||||||||||
Sequence | 16| UCUCCCAACCCUUGUACCAGUG |37 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Cloned | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TP53 | ||||||||||||||||||||
Synonyms | BCC7, LFS1, P53, TRP53 | ||||||||||||||||||||
Description | tumor protein p53 | ||||||||||||||||||||
Transcript | NM_001126114 | ||||||||||||||||||||
Other Transcripts | NM_001126112 , NM_000546 , NM_001126113 , NM_001126115 , NM_001126116 , NM_001126117 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TP53 | |||||||||||||||||||||
3'UTR of TP53 (miRNA target sites are highlighted) |
>TP53|NM_001126114|3'UTR 1 AGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAAACT 81 CGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAG 161 GATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTC 241 CCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGACAGC 321 CTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGA 401 AGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGG 481 AGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCT 561 TGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCT 641 CACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTG 721 AGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAGGGT 801 GCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAG 881 TCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATCCCA 961 CACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCTTTT 1041 TTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATC 1121 TTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATG 1201 CCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCCTGG 1281 GCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGGTCA 1361 ACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTA 1441 TATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | SPCA-1 , A549 , HCC827 , 95-D , HEK293T , BEAS-2B) |
Location of target site | 3'UTR |
Tools used in this research | TargetScan |
Original Description (Extracted from the article) |
...
miR-150 directly targets the p53 gene by interaction with the 3'-UTR.
... - Wang DT; Ma ZL; Li YL; Wang YQ; Zhao BT; et al., 2013, Oncology reports. |
Article |
- Wang DT; Ma ZL; Li YL; Wang YQ; Zhao BT; et al. - Oncology reports, 2013
microRNAs (miRNAs) are a class of non-coding small RNAs that act as negative regulators of gene expression by binding to the 3'-untranslated region (3'-UTR) of target mRNAs. Tumor protein p53, a transcriptional factor, plays an important role in the progression of tumorigenesis. miR-150 was the only miRNA predicted to target 3'-UTR of p53 by Targetscan. In order to investigate the function of miR-150, p53 and relevant miRNAs in non-small cell lung cancer (NSCLC), we constructed two expression vectors of p53 (pcDNA3.1-p53 and pcDNA3.1-p53-3'-UTR) and two report vectors (pGL3-p53-3'-UTR and pGL3-p53-3'-mUTR). The activity of luciferase transfected with miR-150 mimics was lower by 30% when compared to that of the miRNA-negative control (miRNA-NC). Moreover, the p53 protein was downregulated by at least 50% when miR-150 mimics were cotransfected with pcDNA3.1-p53-3'-UTR when compared to miRNA-NC. We also determined the expression of miR-150 and p53 in NSCLC patient tissue samples. The expression of miR-150 in T2 stage tissue samples was higher than that in T1 stage tissue samples. The corresponding target gene p53 was correlated with miR-150 expression. In the present study, we further analyzed the cell cycle distribution. The cells transfected with pcDNA3.1-p53 were significantly arrested in the G1 phase when compared to the control cells. When miR-150 mimics were cotransfected with pcDNA3.1-p53-3'-UTR, the percentage of cells in the G1 phase was significantly lower by 4% when compared to miRNA-NC. To identify miRNAs that are regulated by the p53 protein, qRT-PCR was performed after pcDNA3.1-p53 transfection. miR-34a, miR-184, miR-181a and miR-148 were upregulated significantly. However, there was no distinct difference in the expression of miR-10a, miR-182 and miR-34c. Our results showed that miR-150 targets the 3'-UTR of p53, and p53 protein promotes the expression of miRNAs which affect cell cycle progression. These findings suggest that miR-150, p53 protein and relevant miRNAs are members of a regulatory network in NSCLC tumorigenesis.
LinkOut: [PMID: 23670238]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | A549 , Calu-1 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | microRNA.org , TargetScanS , miRSearch 2.0 | ||||||
Original Description (Extracted from the article) |
...
miR-150 speci茂卢聛cally targeted P53 in the NSCLC cell line A549.//miR-150 promoted cell proliferation of NSCLC cells by inhibiting P53.
... - Zhang N; Wei X; Xu L, 2013, FEBS letters. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Zhang N; Wei X; Xu L - FEBS letters, 2013
Lung cancer is one of the most common causes for cancer-related death. Previous studies suggested that uncontrolled cell proliferation induced by activation of pro-cancer genes or inhibition of cancer suppressor genes plays an important role in the pathogenesis of lung cancer. Here, we demonstrate that miR-150 is aberrantly upregulated in lung cancer tissue and negatively correlates with the expression of the proapoptotic gene p53 but not EGR2. We show that miR-150 specifically targets the 3'-UTR of p53 and regulates its expression. Inhibition of miR-150 effectively delays cell proliferation and promotes apoptosis, accompanied by increased p53 protein expression. Our data reveals the mechanisms underlying miR-150 regulated lung cancer pathogenesis, which might be beneficial for lung cancer therapy.
LinkOut: [PMID: 23747308]
|
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
503 hsa-miR-150-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT000935 | MYB | MYB proto-oncogene, transcription factor | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 13 | |||
MIRT003222 | EGR2 | early growth response 2 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 2 | |||
MIRT004272 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
2 | 1 | ||||||
MIRT004357 | P2RX7 | purinergic receptor P2X 7 | ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
6 | 4 | ||
MIRT005739 | IGF2 | insulin like growth factor 2 | ![]() |
1 | 1 | |||||||
MIRT006115 | MUC4 | mucin 4, cell surface associated | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006604 | Myb | myeloblastosis oncogene | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT006668 | CXCR4 | C-X-C motif chemokine receptor 4 | ![]() |
1 | 1 | |||||||
MIRT006984 | ZEB1 | zinc finger E-box binding homeobox 1 | ![]() |
![]() |
6 | 3 | ||||||
MIRT007016 | NOTCH3 | notch 3 | ![]() |
1 | 1 | |||||||
MIRT007053 | FLT3 | fms related tyrosine kinase 3 | ![]() |
1 | 1 | |||||||
MIRT007087 | EP300 | E1A binding protein p300 | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT021208 | cmyb | v-myb avian myeloblastosis viral oncogene homolog | ![]() |
1 | 1 | |||||||
MIRT021209 | PTPRR | protein tyrosine phosphatase, receptor type R | ![]() |
1 | 1 | |||||||
MIRT021210 | MS4A3 | membrane spanning 4-domains A3 | ![]() |
1 | 1 | |||||||
MIRT021211 | CCNE1 | cyclin E1 | ![]() |
1 | 1 | |||||||
MIRT021212 | AGA | aspartylglucosaminidase | ![]() |
1 | 1 | |||||||
MIRT045387 | ATP13A3 | ATPase 13A3 | ![]() |
1 | 1 | |||||||
MIRT052652 | TP53 | tumor protein p53 | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT054633 | BIRC5 | baculoviral IAP repeat containing 5 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT054852 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 3 | |||
MIRT054868 | CBL | Cbl proto-oncogene | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT133589 | ADIPOR2 | adiponectin receptor 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT136366 | ATP2B1 | ATPase plasma membrane Ca2+ transporting 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT222062 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 6 | ||||||
MIRT222128 | FOXK1 | forkhead box K1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT232510 | MBD6 | methyl-CpG binding domain protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293382 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT388973 | CNPPD1 | cyclin Pas1/PHO80 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT392627 | HILPDA | hypoxia inducible lipid droplet associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT437627 | SYNPO2 | synaptopodin 2 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437628 | PDIA6 | protein disulfide isomerase family A member 6 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437629 | EREG | epiregulin | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT437630 | TOM1 | target of myb1 membrane trafficking protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT437631 | CNST | consortin, connexin sorting protein | ![]() |
![]() |
2 | 1 | ||||||
MIRT437632 | TRPS1 | transcriptional repressor GATA binding 1 | ![]() |
![]() |
2 | 1 | ||||||
MIRT437633 | CAST | calpastatin | ![]() |
![]() |
2 | 1 | ||||||
MIRT437634 | AIFM2 | apoptosis inducing factor, mitochondria associated 2 | ![]() |
![]() |
![]() |
![]() |
4 | 3 | ||||
MIRT437635 | C16orf63 | FGFR1OP N-terminal like | ![]() |
![]() |
2 | 1 | ||||||
MIRT437823 | COL4A4 | collagen type IV alpha 4 chain | ![]() |
1 | 1 | |||||||
MIRT437824 | SP1 | Sp1 transcription factor | ![]() |
![]() |
![]() |
3 | 2 | |||||
MIRT437917 | CISH | cytokine inducible SH2 containing protein | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT438120 | CCR6 | C-C motif chemokine receptor 6 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT447959 | WDR77 | WD repeat domain 77 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461324 | MRPS27 | mitochondrial ribosomal protein S27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493802 | GAN | gigaxonin | ![]() |
![]() |
2 | 6 | ||||||
MIRT495023 | C2CD4B | C2 calcium dependent domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT495046 | AGTPBP1 | ATP/GTP binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496570 | DGCR6L | DiGeorge syndrome critical region gene 6 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT497483 | XPR1 | xenotropic and polytropic retrovirus receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497936 | ABCB7 | ATP binding cassette subfamily B member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503982 | C4orf29 | abhydrolase domain containing 18 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504020 | ACSL6 | acyl-CoA synthetase long chain family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504765 | TEP1 | telomerase associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504841 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505556 | SMUG1 | single-strand-selective monofunctional uracil-DNA glycosylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506090 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509109 | BMP8B | bone morphogenetic protein 8b | ![]() |
![]() |
2 | 6 | ||||||
MIRT513390 | TUBB4A | tubulin beta 4A class IVa | ![]() |
![]() |
2 | 2 | ||||||
MIRT514115 | SERF2 | small EDRK-rich factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514299 | FXYD5 | FXYD domain containing ion transport regulator 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514959 | SIGLEC11 | sialic acid binding Ig like lectin 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515171 | AHI1 | Abelson helper integration site 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515373 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT515723 | SEPT14 | septin 14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516023 | A1CF | APOBEC1 complementation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT516252 | BCAS4 | breast carcinoma amplified sequence 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516535 | MIXL1 | Mix paired-like homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT516803 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516989 | COX19 | COX19, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT517038 | FGD6 | FYVE, RhoGEF and PH domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517097 | CCDC30 | coiled-coil domain containing 30 | ![]() |
![]() |
2 | 4 | ||||||
MIRT517794 | EFCAB11 | EF-hand calcium binding domain 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518871 | NKD1 | naked cuticle homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519497 | MAPK13 | mitogen-activated protein kinase 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520436 | TTLL12 | tubulin tyrosine ligase like 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520989 | SOCS5 | suppressor of cytokine signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521526 | QSOX1 | quiescin sulfhydryl oxidase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521645 | PROSC | pyridoxal phosphate binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT522851 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522973 | INTU | inturned planar cell polarity protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT523061 | HYPK | huntingtin interacting protein K | ![]() |
![]() |
2 | 2 | ||||||
MIRT523581 | GGA2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524273 | CYCS | cytochrome c, somatic | ![]() |
![]() |
2 | 4 | ||||||
MIRT524435 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524603 | CACYBP | calcyclin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT524962 | AGO3 | argonaute 3, RISC catalytic component | ![]() |
![]() |
2 | 4 | ||||||
MIRT525288 | C18orf32 | chromosome 18 open reading frame 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526171 | ANKRD65 | ankyrin repeat domain 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526618 | NME6 | NME/NM23 nucleoside diphosphate kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527226 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT528701 | TRAF3IP2 | TRAF3 interacting protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT529981 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530022 | KIAA1875 | WD repeat domain 97 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530238 | PLXDC1 | plexin domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530573 | ABHD15 | abhydrolase domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530807 | GPR182 | G protein-coupled receptor 182 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531755 | TXK | TXK tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT532028 | FHDC1 | FH2 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534310 | SKIDA1 | SKI/DACH domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535305 | PHF12 | PHD finger protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537947 | DSN1 | DSN1 homolog, MIS12 kinetochore complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT540257 | FAM89A | family with sequence similarity 89 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT540369 | MASTL | microtubule associated serine/threonine kinase like | ![]() |
![]() |
2 | 2 | ||||||
MIRT540648 | ZNF514 | zinc finger protein 514 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540669 | MIS18A | MIS18 kinetochore protein A | ![]() |
![]() |
2 | 4 | ||||||
MIRT542033 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542124 | DIS3L | DIS3 like exosome 3'-5' exoribonuclease | ![]() |
![]() |
2 | 2 | ||||||
MIRT542350 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544456 | KRBOX4 | KRAB box domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547164 | PDZD8 | PDZ domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548162 | FRAT2 | FRAT2, WNT signaling pathway regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT551677 | BBS5 | Bardet-Biedl syndrome 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551694 | ASB16 | ankyrin repeat and SOCS box containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555324 | PPP2CB | protein phosphatase 2 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT555448 | POLR3A | RNA polymerase III subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT557269 | HMGB1 | high mobility group box 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557564 | GOSR1 | golgi SNAP receptor complex member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563033 | CEP72 | centrosomal protein 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572904 | RUNDC3B | RUN domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT575896 | Dis3 | DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease | ![]() |
![]() |
2 | 3 | ||||||
MIRT607666 | BTN3A2 | butyrophilin subfamily 3 member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608731 | MYH9 | myosin heavy chain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608837 | PTCHD1 | patched domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609296 | MMAB | methylmalonic aciduria (cobalamin deficiency) cblB type | ![]() |
![]() |
2 | 2 | ||||||
MIRT610291 | DIS3 | DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease | ![]() |
![]() |
2 | 3 | ||||||
MIRT610301 | KLHL21 | kelch like family member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610640 | PIGM | phosphatidylinositol glycan anchor biosynthesis class M | ![]() |
![]() |
2 | 2 | ||||||
MIRT611035 | RRP1B | ribosomal RNA processing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT612595 | RANGAP1 | Ran GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613614 | FAM185A | family with sequence similarity 185 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT614242 | WDR53 | WD repeat domain 53 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615157 | SPIB | Spi-B transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT615549 | TNFSF15 | TNF superfamily member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617736 | ATCAY | ATCAY, caytaxin | ![]() |
![]() |
2 | 4 | ||||||
MIRT618237 | PGBD4 | piggyBac transposable element derived 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618289 | ZNF682 | zinc finger protein 682 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618692 | CAMK1D | calcium/calmodulin dependent protein kinase ID | ![]() |
![]() |
2 | 2 | ||||||
MIRT619031 | SLC35G1 | solute carrier family 35 member G1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619053 | TTC4 | tetratricopeptide repeat domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619079 | DNAAF3 | dynein axonemal assembly factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619258 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619659 | CORO2A | coronin 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT619759 | MYO1F | myosin IF | ![]() |
![]() |
2 | 4 | ||||||
MIRT620183 | TRIM72 | tripartite motif containing 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620889 | ANO7 | anoctamin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620905 | MUT | methylmalonyl-CoA mutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT621044 | PPP2R3A | protein phosphatase 2 regulatory subunit B''alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT621088 | WDR12 | WD repeat domain 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621237 | SIGLEC9 | sialic acid binding Ig like lectin 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT621448 | TCN2 | transcobalamin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621707 | TRIP11 | thyroid hormone receptor interactor 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621721 | TRAPPC10 | trafficking protein particle complex 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622504 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT623203 | MTSS1L | MTSS1L, I-BAR domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT623514 | KCNK3 | potassium two pore domain channel subfamily K member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623799 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 4 | ||||||
MIRT624223 | CXorf21 | chromosome X open reading frame 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625681 | SYAP1 | synapse associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625818 | POFUT1 | protein O-fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626154 | NFYA | nuclear transcription factor Y subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT626174 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626202 | PNRC1 | proline rich nuclear receptor coactivator 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626803 | TTPAL | alpha tocopherol transfer protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT626912 | HIST1H2BG | histone cluster 1 H2B family member g | ![]() |
![]() |
2 | 2 | ||||||
MIRT627968 | NIPAL1 | NIPA like domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629503 | AS3MT | arsenite methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT629823 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT630112 | PNPLA3 | patatin like phospholipase domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630643 | ELK1 | ELK1, ETS transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT631462 | FBXO47 | F-box protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631508 | FFAR4 | free fatty acid receptor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631740 | NKX2-1 | NK2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632154 | CWC25 | CWC25 spliceosome associated protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT632501 | RAB13 | RAB13, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT632582 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT633103 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633206 | WFDC6 | WAP four-disulfide core domain 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633814 | WDR92 | WD repeat domain 92 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634081 | APOH | apolipoprotein H | ![]() |
![]() |
2 | 2 | ||||||
MIRT634291 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT634636 | HIP1 | huntingtin interacting protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634883 | SENP8 | SUMO/sentrin peptidase family member, NEDD8 specific | ![]() |
![]() |
2 | 2 | ||||||
MIRT634936 | GTF2H2C | GTF2H2 family member C | ![]() |
![]() |
2 | 2 | ||||||
MIRT635444 | SLC25A44 | solute carrier family 25 member 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635751 | PIK3C2A | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT636475 | KLHL7 | kelch like family member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636869 | ARSE | arylsulfatase E (chondrodysplasia punctata 1) | ![]() |
![]() |
2 | 2 | ||||||
MIRT637182 | TMEM50A | transmembrane protein 50A | ![]() |
![]() |
2 | 2 | ||||||
MIRT638017 | TTC31 | tetratricopeptide repeat domain 31 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638109 | YPEL1 | yippee like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638739 | FAXC | failed axon connections homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT638924 | CALCOCO2 | calcium binding and coiled-coil domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639858 | TBC1D16 | TBC1 domain family member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640453 | IP6K2 | inositol hexakisphosphate kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT640896 | AMD1 | adenosylmethionine decarboxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641015 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641259 | C8orf46 | chromosome 8 open reading frame 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641762 | ZNF207 | zinc finger protein 207 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641819 | ULK2 | unc-51 like autophagy activating kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641969 | PWWP2A | PWWP domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT642223 | RABAC1 | Rab acceptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642330 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642473 | C16orf58 | chromosome 16 open reading frame 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642610 | APOPT1 | apoptogenic 1, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT643113 | SMIM7 | small integral membrane protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643598 | SPAG16 | sperm associated antigen 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643643 | EZH2 | enhancer of zeste 2 polycomb repressive complex 2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT643902 | TCEB2 | elongin B | ![]() |
![]() |
2 | 2 | ||||||
MIRT644048 | WWC2 | WW and C2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644189 | LAT2 | linker for activation of T-cells family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644530 | TMEM134 | transmembrane protein 134 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644842 | SEC14L4 | SEC14 like lipid binding 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645545 | RBL1 | RB transcriptional corepressor like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646835 | TLDC1 | TBC/LysM-associated domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647519 | PPIE | peptidylprolyl isomerase E | ![]() |
![]() |
2 | 2 | ||||||
MIRT647786 | ASB8 | ankyrin repeat and SOCS box containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648208 | TRIM35 | tripartite motif containing 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648267 | ZNF582 | zinc finger protein 582 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648368 | CYB5A | cytochrome b5 type A | ![]() |
![]() |
2 | 2 | ||||||
MIRT648452 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648672 | ZNF626 | zinc finger protein 626 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648832 | C8orf37 | chromosome 8 open reading frame 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648921 | ZNF551 | zinc finger protein 551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649211 | KIAA1715 | lunapark, ER junction formation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT649728 | LTBP2 | latent transforming growth factor beta binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649821 | PSMC1 | proteasome 26S subunit, ATPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650419 | FKBP9 | FK506 binding protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650938 | CTNS | cystinosin, lysosomal cystine transporter | ![]() |
![]() |
2 | 2 | ||||||
MIRT651025 | ZNF699 | zinc finger protein 699 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651604 | WDFY2 | WD repeat and FYVE domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652017 | TTYH3 | tweety family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652285 | TNS4 | tensin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652335 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT652352 | TMOD2 | tropomodulin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT652359 | TMEM92 | transmembrane protein 92 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652404 | TMEM33 | transmembrane protein 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652917 | SYNJ2BP | synaptojanin 2 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT653393 | SLFN13 | schlafen family member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653609 | SLC33A1 | solute carrier family 33 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653858 | SHE | Src homology 2 domain containing E | ![]() |
![]() |
2 | 2 | ||||||
MIRT654009 | SCO1 | SCO1, cytochrome c oxidase assembly protein |