miRTarBase - #MIRT053457


—
pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-5p
Sequence 14| AACUGUUUGCAGAGGAAACUGA |35
Evidence Experimental
Experiments Cloned
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IL3   
Synonyms IL-3, MCGF, MULTI-CSF
Description interleukin 3
Transcript NM_000588   
Expression
Putative miRNA Targets on IL3
3'UTR of IL3
(miRNA target sites are highlighted)		 
>IL3|NM_000588|3'UTR
   1 GTCCAACGTCCAGCTCGTTCTCTGGGCCTTCTCACCACAGAGCCTCGGGACATCAAAAACAGCAGAACTTCTGAAACCTC
  81 TGGGTCATCTCTCACACATTCCAGGACCAGAAGCATTTCACCTTTTCCTGCGGCATCAGATGAATTGTTAATTATCTAAT
 161 TTCTGAAATGTGCAGCTCCCATTTGGCCTTGTGCGGTTGTGTTCTCATTTTTATCCCATTGAGACTATTTATTTATGTAT
 241 GTATGTATTTATTTATTTATTGCCTGGAGTGTGAACTGTATTTATTTTAGCAGAGGAGCCATGTCCTGCTGCTTCTGCAA
 321 AAAACTCAGAGTGGGGTGGGGAGCATGTTCATTTGTACCTCGAGTTTTAAACTGGTTCCTAGGGATGTGTGAGAATAAAC
 401 TAGACTCTGAAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucaaaGGAGAC-----G--UUUGUCaa 5'
                 |||| |     |  ||||||  
Target 5' cacagagCCTCGGGACATCAAAAACAGca 3'
 36 - 64 121.00 -12.30
2 
miRNA  3' agucAAAGGA---GACGUUUGUCAa 5'
              || |||    ||::||| || 
Target 5' tttaTTGCCTGGAGTGTGAACTGTa 3'
 256 - 280 110.00 -5.60
3 
miRNA  3' aguCAAAGGAGACG---UUUG----UCAa 5'
             | | |:|||||   ||||    ||| 
Target 5' cctGCTGCTTCTGCAAAAAACTCAGAGTg 3'
 305 - 333 107.00 -12.62
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20075168 9 COSMIC
COSN24382665 26 COSMIC
COSN26980370 29 COSMIC
COSN30531829 40 COSMIC
COSN30510801 47 COSMIC
COSN26980369 48 COSMIC
COSN30501817 67 COSMIC
COSN30108672 92 COSMIC
COSN18718472 114 COSMIC
COSN7874930 234 COSMIC
COSN4843499 247 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764322813 2 dbSNP
rs188641601 8 dbSNP
rs757644204 9 dbSNP
rs781340670 11 dbSNP
rs1366187306 13 dbSNP
rs750530337 14 dbSNP
rs1402559485 15 dbSNP
rs756465269 17 dbSNP
rs781400290 18 dbSNP
rs1442612891 19 dbSNP
rs749137368 23 dbSNP
rs371323430 27 dbSNP
rs1264165552 28 dbSNP
rs1229546490 36 dbSNP
rs778524489 38 dbSNP
rs748131024 41 dbSNP
rs1042181 42 dbSNP
rs192906186 47 dbSNP
rs1056199737 48 dbSNP
rs1470101896 65 dbSNP
rs916499432 68 dbSNP
rs1324216237 77 dbSNP
rs1282615724 79 dbSNP
rs947938341 89 dbSNP
rs1044026593 92 dbSNP
rs755580794 102 dbSNP
rs903556375 105 dbSNP
rs55633940 111 dbSNP
rs1429603850 127 dbSNP
rs565107713 132 dbSNP
rs769987306 133 dbSNP
rs184543902 142 dbSNP
rs1008403306 152 dbSNP
rs1174991385 161 dbSNP
rs1478999755 174 dbSNP
rs1449898394 182 dbSNP
rs1023014726 188 dbSNP
rs1239232121 189 dbSNP
rs1474566688 189 dbSNP
rs550935537 195 dbSNP
rs2069792 196 dbSNP
rs753433303 197 dbSNP
rs1441397941 217 dbSNP
rs1201752027 219 dbSNP
rs1319662054 225 dbSNP
rs1273490602 226 dbSNP
rs1277642267 226 dbSNP
rs1375334325 228 dbSNP
rs1452723578 234 dbSNP
rs78429101 234 dbSNP
rs1381478544 241 dbSNP
rs1335248760 243 dbSNP
rs1027632938 244 dbSNP
rs1408620885 246 dbSNP
rs768687505 246 dbSNP
rs778675288 246 dbSNP
rs546342395 250 dbSNP
rs951444742 265 dbSNP
rs974688985 268 dbSNP
rs983161366 285 dbSNP
rs928739935 291 dbSNP
rs566545602 292 dbSNP
rs960073014 297 dbSNP
rs991959658 303 dbSNP
rs1459055558 307 dbSNP
rs141624920 315 dbSNP
rs1203524459 319 dbSNP
rs1305623857 320 dbSNP
rs1291565346 327 dbSNP
rs1246277545 336 dbSNP
rs947876859 337 dbSNP
rs1180355280 339 dbSNP
rs189376033 341 dbSNP
rs909957268 347 dbSNP
rs940122360 351 dbSNP
rs1374660085 361 dbSNP
rs80157442 362 dbSNP
rs1470738516 363 dbSNP
rs537304657 375 dbSNP
rs1424264804 379 dbSNP
rs1052061381 383 dbSNP
rs890888371 385 dbSNP
rs557232346 390 dbSNP
rs943803963 392 dbSNP
rs1402313890 394 dbSNP
rs150538654 402 dbSNP
rs745876432 408 dbSNP
rs536667351 410 dbSNP
rs999799356 410 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions SKOV3
Location of target site 3'UTR
Original Description (Extracted from the article) ... "MiRNA expression in four PTX-resistant cell lines (SKpac-8 ...

- Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al., 2013, British journal of cancer.

Article - Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al.
- British journal of cancer, 2013
BACKGROUND: MicroRNAs are noncoding regulatory RNAs strongly implicated in carcinogenesis, cell survival, and chemosensitivity. Here, microRNAs associated with chemoresistance in ovarian carcinoma, the most lethal of gynaecological malignancies, were identified and their functional effects in chemoresistant ovarian cancer cells were assessed. METHODS: MicroRNA expression in paclitaxel (PTX)-resistant SKpac sublines was compared with that of the PTX-sensitive, parental SKOV3 ovarian cancer cell line using microarray and qRT-PCR. The function of differentially expressed microRNAs in chemoresistant ovarian cancer was further evaluated by apoptosis, cell proliferation, and migration assays. RESULTS: Upregulation of miR-106a and downregulation of miR-591 were associated with PTX resistance in ovarian cancer cells and human tumour samples. Transfection with anti-miR-106a or pre-miR-591 resensitized PTX-resistant SKpac cells to PTX by enhancing apoptosis (23 and 42% increase), and inhibited their cell migration (43 and 56% decrease) and proliferation (64 and 65% decrease). Furthermore, ZEB1 was identified as a novel target gene of miR-591, and BCL10 and caspase-7 were target genes of miR-106a, as identified by immunoblotting and luciferase assay. CONCLUSION: MiR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.
LinkOut: [PMID: 23807165]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.832 2.1e-4 0.764 1.2e-3 13 Click to see details
GSE32688 Pancreatic cancer 0.373 1.8e-2 0.294 5.1e-2 32 Click to see details
GSE19783 ER- ER- breast cancer -0.216 2.8e-2 -0.149 9.5e-2 79 Click to see details
GSE38226 Liver fibrosis 0.387 4.2e-2 -0.155 2.5e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.455 6.9e-2 -0.483 5.6e-2 12 Click to see details
GSE21849 B cell lymphoma 0.264 8.3e-2 0.536 1.4e-3 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.249 1.4e-1 -0.227 1.7e-1 20 Click to see details
GSE19536 Breast cancer -0.102 1.6e-1 -0.107 1.4e-1 100 Click to see details
GSE17498 Multiple myeloma 0.135 2.0e-1 0.221 8.5e-2 40 Click to see details
GSE21032 Prostate cancer -0.088 2.1e-1 -0.094 2.0e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.084 2.5e-1 0.010 4.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.137 2.6e-1 -0.319 6.0e-2 25 Click to see details
GSE14794 Lymphoblastoid cells -0.061 2.8e-1 -0.111 1.5e-1 90 Click to see details
GSE28544 Breast cancer 0.102 3.2e-1 0.038 4.3e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.097 3.2e-1 0.068 3.7e-1 25 Click to see details
GSE17306 Multiple myeloma -0.064 3.3e-1 -0.147 1.6e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.064 3.8e-1 0.068 3.8e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.047 4.2e-1 0.048 4.2e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.026 4.6e-1 0.006 4.9e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.222 0.06 0.351 0.01 50 Click to see details
THCA 0.191 0.07 0.483 0 59 Click to see details
ESCA 0.372 0.13 0.480 0.07 11 Click to see details
LIHC -0.152 0.15 0.232 0.05 49 Click to see details
BRCA -0.076 0.25 0.419 0 84 Click to see details
LUSC 0.067 0.34 0.205 0.11 38 Click to see details
STAD -0.07 0.35 0.327 0.03 32 Click to see details
KIRC 0.029 0.41 0.417 0 68 Click to see details
HNSC -0.009 0.48 0.337 0.01 42 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
BLCA 0.013 0.48 0.329 0.09 18 Click to see details
70 hsa-miR-452-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053449 BAG4 BCL2 associated athanogene 4 1 1
MIRT053450 ITGA9 integrin subunit alpha 9 1 1
MIRT053451 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT053452 CDK6 cyclin dependent kinase 6 1 1
MIRT053453 TBK1 TANK binding kinase 1 1 1
MIRT053454 RHOU ras homolog family member U 1 1
MIRT053455 NOTCH2NL notch 2 N-terminal like 1 1
MIRT053456 TNF tumor necrosis factor 1 1
MIRT053457 IL3 interleukin 3 1 1
MIRT053458 TNFAIP8 TNF alpha induced protein 8 1 1
MIRT053459 CASD1 CAS1 domain containing 1 1 1
MIRT053460 SMAD4 SMAD family member 4 1 1
MIRT053522 DPYSL2 dihydropyrimidinase like 2 2 1
MIRT053523 KRAS KRAS proto-oncogene, GTPase 2 1
MIRT053787 MMP2 matrix metallopeptidase 2 2 1
MIRT053788 TM7SF4 dendrocyte expressed seven transmembrane protein 2 1
MIRT054841 THRB thyroid hormone receptor beta 3 1
MIRT076091 ADORA2B adenosine A2b receptor 2 2
MIRT133747 SKI SKI proto-oncogene 2 2
MIRT437780 BMI1 BMI1 proto-oncogene, polycomb ring finger 1 1
MIRT437781 LEF1 lymphoid enhancer binding factor 1 1 1
MIRT437782 TCF4 transcription factor 4 1 1
MIRT438015 CDKN1B cyclin dependent kinase inhibitor 1B 5 3
MIRT486626 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT493350 LAMC1 laminin subunit gamma 1 2 8
MIRT495000 TSSC1 EARP complex and GARP complex interacting protein 1 2 2
MIRT497724 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT498197 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT500265 ZNF788 zinc finger family member 788 2 6
MIRT500608 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT507531 DSTN destrin, actin depolymerizing factor 2 2
MIRT513420 RTP4 receptor transporter protein 4 2 2
MIRT515388 RPL7 ribosomal protein L7 2 2
MIRT516404 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT531390 TXNDC16 thioredoxin domain containing 16 2 2
MIRT533161 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT533983 TADA2A transcriptional adaptor 2A 2 2
MIRT544365 EGLN1 egl-9 family hypoxia inducible factor 1 2 2
MIRT545406 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT551367 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT556491 LIPA lipase A, lysosomal acid type 2 2
MIRT559336 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT561668 REST RE1 silencing transcription factor 2 2
MIRT565353 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565366 TMCC1 transmembrane and coiled-coil domain family 1 2 2
MIRT571405 MED4 mediator complex subunit 4 2 2
MIRT574476 RPS16 ribosomal protein S16 2 2
MIRT609702 GFRA1 GDNF family receptor alpha 1 2 2
MIRT611081 ZNF621 zinc finger protein 621 2 2
MIRT613238 CCDC39 coiled-coil domain containing 39 2 2
MIRT614618 MVK mevalonate kinase 2 2
MIRT615351 SMU1 DNA replication regulator and spliceosomal factor 2 4
MIRT620013 CCDC137 coiled-coil domain containing 137 2 2
MIRT623722 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT637022 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT637353 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT638050 SHPK sedoheptulokinase 2 2
MIRT657131 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 2 2
MIRT657453 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT666586 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT701745 MTDH metadherin 2 2
MIRT702145 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT709155 ZNF799 zinc finger protein 799 2 2
MIRT711051 IRS1 insulin receptor substrate 1 2 2
MIRT716104 HARS histidyl-tRNA synthetase 2 2
MIRT717265 BMPR2 bone morphogenetic protein receptor type 2 2 2
MIRT721687 MRPL19 mitochondrial ribosomal protein L19 2 2
MIRT722340 BEND6 BEN domain containing 6 2 2
MIRT732741 VEGFA vascular endothelial growth factor A 3 0
MIRT734714 EZR ezrin 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-452-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-452-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-452-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-452-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-452-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-452-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-452-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-452-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-452-5p (4z)-n-[(2-chlorobenzylidene)amino]-4-(dimethylaminohydrazono)-5-methyl-pyrazole-3-carboxamide 135545659 NSC131257 sensitive
hsa-miR-452-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-452-5p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-452-5p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-452-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-452-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-452-5p (E)-2-(3,4-dihydroxybenzoyl)-3-(1H-indol-3-yl)prop-2-enenitrile 5329275 NSC650934 sensitive
hsa-miR-452-5p (Z)-[5-(4-carboxy-N-methylanilino)-2,4-dinitrophenoxy]imino-(dimethylamino)-oxidoazanium 11154356 NSC731703 resistant
hsa-miR-452-5p [(1r,2r,3ar,4s,5s,6e,9s,10r,11s,13r,13as)-2,4,13-triacetyloxy-1-benzoyloxy-3a,10-dihydroxy-2,5,8,8-tetramethyl-12-methylidene-11-(2-methylpropoxy)-3,4,5,9,10,11,13,13a-octahydro-1h-cyclopenta[12]annul 5469445 NSC688235 sensitive
hsa-miR-452-5p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-452-5p [(1R,2S,10S,13S,14R)-7-(4-fluorophenyl)-10,14-dimethyl-6,7,9-triazapentacyclo[11.8.0.02,10.04,8.014,19]henicosa-4(8),5,19-trien-17-yl] acetate 392371 NSC692655 sensitive
hsa-miR-452-5p [(1S,16E,24E,26E,28Z)-1-hydroxy-12-[1-(4-hydroxy-3-methoxycyclohexyl)propan-2-yl]-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-2,3,10,14,20-pentaoxo-11,36-dioxa-4-azatricyclo[30.3.1.04,9]hexatriaconta-16,24,26,28-tetraen-18-yl] 3-(diethylamino)propanoate; 5386305 NSC606699 sensitive
hsa-miR-452-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-452-5p [(3s,8r,9s,10r,13s,14s,16e,17e)-16-[(3,4-dimethoxyphenyl)methylidene]-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 9572442 NSC716258 sensitive
hsa-miR-452-5p [2-(12,14-dioxo-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1,4,6,8,10,15,17,19,21-nonaen-3-yl)-3-hydroxy-6-(hydroxymethyl)-5-methoxyoxan-4-yl] 2,6-diaminohexanoate;hydrochloride 24203046 NSC726578 resistant
hsa-miR-452-5p 1'-hydroxy-2'-(naphthalene-1-carbonyl)-1'-naphthalen-1-ylspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione NSC682763 sensitive
hsa-miR-452-5p 1-(1-naphthylmethylene)-4-(1-naphthyl)semicarbazide 5859414 NSC680931 sensitive
hsa-miR-452-5p 11-(4-nitrophenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608965 NSC697748 resistant
hsa-miR-452-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-452-5p 1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) NSC659162 sensitive
hsa-miR-452-5p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 resistant
hsa-miR-452-5p 2-(1-hydroxyethyl)thieno[3,2-f][1]benzothiole-4,8-dione 391375 NSC690432 resistant
hsa-miR-452-5p 2-(2-amino-6-phenylpyrimidin-4-yl)-4-methylphenol 386504 NSC678879 sensitive
hsa-miR-452-5p 2-[(e)-[6-(3,6-dimethoxy-2-nitrophenyl)-2-propylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572654 NSC723548 sensitive
hsa-miR-452-5p 2-[[(1s,5s,8z,12s,20s)-13-phenoxycarbonyl-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyn-5-yl]oxy]acetic acid 54604782 NSC677586 resistant
hsa-miR-452-5p 2-[[(3s,8s,9s,10r,11s,13s,14s,16s,17r)-3,11-dihydroxy-17-[(2s,3s)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1h-cyclopenta[a]phenanthren-16-yl]oxy]-6-methy 392623 NSC693185 sensitive
hsa-miR-452-5p 2-[4-[5-(3,4-dimethoxyphenyl)imidazol-1-yl]phenyl]-5,7-dimethoxy-1,3-benzothiazole 60147635 NSC751902 sensitive
hsa-miR-452-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-452-5p 2,3-dehydrosarcovagine d 54612860 NSC748913 sensitive
hsa-miR-452-5p 2,3-dimethoxyindolo[2,1-a]isoquinolin-7-ium-12-one 498408 NSC627787 resistant
hsa-miR-452-5p 2,3,5-triphenyl-1,3-selenazol-3-ium-4-olate 363056 NSC627605 resistant
hsa-miR-452-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-452-5p 2,7-bis(methoxycarbonylmethyl)-10-methylphenothiazine 384444 NSC674225 sensitive
hsa-miR-452-5p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 sensitive
hsa-miR-452-5p 3-(3,5-dichlorophenyl)-2-(2-pyridinyl)acrylonitrile 5467799 NSC659323 sensitive
hsa-miR-452-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-452-5p 3-(4-methoxyphenyl)-5,5,5-triphenyl-4,5-dihydro-1,2,5lambda(5)-oxazaphosphole NSC304610 sensitive
hsa-miR-452-5p 3-(benzenesulfonyl)-7-benzyl-2-methoxy-5,6-dihydropyrazolo[3,4-h]quinoline 54613023 NSC750762 sensitive
hsa-miR-452-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-452-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-452-5p 3-bromo-4-(2-(4-methoxyphenyl)ethynyl)furan-2(5h)-one 24204187 NSC730944 sensitive
hsa-miR-452-5p 3,5-dichloro-N-[4-[3-(3-chloro-4-methoxyphenyl)-4-pyridin-4-ylpyrazol-1-yl]phenyl]benzamide 142712058 NSC755465 sensitive
hsa-miR-452-5p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-452-5p 4-(4-carbazol-9-ylbutanoylamino)-n-[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 406397 NSC724462 sensitive
hsa-miR-452-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-452-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-452-5p 4-[(2z)-2-(5-oxooxolan-2-ylidene)ethoxy]chromen-2-one 24205379 NSC735331 resistant
hsa-miR-452-5p 4-[(4z)-5-oxo-4-[(4-phenoxyphenyl)methylidene]-2-phenylimidazol-1-yl]-n-(1,3-thiazol-2-yl)benzenesulfonamide 5472414 NSC718649 sensitive
hsa-miR-452-5p 4-[2-(5,6-dihydrobenzo[a]carbazol-11-yl)ethyl]morpholine 390894 NSC689069 sensitive
hsa-miR-452-5p 4-[4-(3-methoxyphenyl)piperazin-1-yl]-5H-pyrrolo[3,2-d]pyrimidine 155815900 NSC754824 sensitive
hsa-miR-452-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-452-5p 4-benzyl-1-(2-chlorophenyl)-[1,2,4]triazolo[4,3-a]quinoxaline 46945878 NSC761676 sensitive
hsa-miR-452-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-452-5p 4,4-diphenyl-2-(3,4,5-trimethoxyphenyl)-1,3-diazinane;hydrochloride 379863 NSC665001 sensitive
hsa-miR-452-5p 4,5-bis(4-methoxyphenyl)-1h-imidazol-2(5h)-one 231112 NSC26692 sensitive
hsa-miR-452-5p 4,5,15,16-tetraphenyl-10-(2,4,6-triphenylpyridin-1-ium-1-yl)-3,6,14,17-tetraoxa-23-azatricyclo[17.3.1.18,12]tetracosa-1(23),8(24),9,11,19,21-hexaen-24-olate 16129807 NSC674178 sensitive
hsa-miR-452-5p 5-(4-chlorophenyl)-n-(3,4,5-trimethoxyphenyl)-1h-pyrazol-4-amine 45028878 NSC744683 sensitive
hsa-miR-452-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-452-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-[2-(4-fluorophenyl)ethyl]-2-methoxybenzamide 403660 NSC718728 sensitive
hsa-miR-452-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-hexyl-2-methoxybenzamide 403659 NSC718727 sensitive
hsa-miR-452-5p 5-[3-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374830 NSC762542 sensitive
hsa-miR-452-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 sensitive
hsa-miR-452-5p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 sensitive
hsa-miR-452-5p 6-hydroxy-3,3,11,12-tetramethyl-pyrano[2,3-c]acridin-7-one 5465763 NSC660813 sensitive
hsa-miR-452-5p 8-(2,3-dimethoxyphenyl)-7-methyl-n-phenyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-amine 381363 NSC667903 sensitive
hsa-miR-452-5p 8-chloro-3-(naphthalen-1-ylamino)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazine-7-carbonitrile 406667 NSC724907 resistant
hsa-miR-452-5p 8-hydroxymanzamine a 5468481 NSC670852 sensitive
hsa-miR-452-5p Abiraterone 132971 NSC749226 approved sensitive
hsa-miR-452-5p Aminopyrimidine-f 406276 NSC724328 sensitive
hsa-miR-452-5p Ammonium trichlorotellurate NSC618654 sensitive
hsa-miR-452-5p Austocystin d 5470400 NSC700893 resistant
hsa-miR-452-5p Azure b bromide 13797451 NSC16166 resistant
hsa-miR-452-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-452-5p C8, carbonyl prodigiosine 135540857 NSC742417 sensitive
hsa-miR-452-5p Dimethyl 2,2'-(pyridine-2,6-diyldicarbonyl)bis(1-methylhydrazinecarbodithioate) 375401 NSC655072 sensitive
hsa-miR-452-5p Dromostanolone propionate 224004 NSC12198 sensitive
hsa-miR-452-5p Ethyl 2-[(2e)-2-[(4-chlorophenyl)methylidene]hydrazinyl]-5-phenyl-1h-pyrrole-3-carboxylate 45027953 NSC740252 sensitive
hsa-miR-452-5p Gsk718429a 44587530 NSC756188 sensitive
hsa-miR-452-5p Hexyl (e)-3-[(2s,4z)-2-(hydroxymethyl)-4-(4-methyl-3-propan-2-ylpentylidene)-5-oxooxolan-2-yl]prop-2-enoate 5471817 NSC714070 sensitive
hsa-miR-452-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-452-5p Hydrazine sulfate 24842 NSC150014 sensitive
hsa-miR-452-5p Iejimalide a. 5473233 NSC724579 sensitive
hsa-miR-452-5p Indoline, 5-chloro-1,3,3-trimethyl-2-methylene- (8ci) 81308 NSC158263 sensitive
hsa-miR-452-5p Isatin dr 24204246 NSC731093 sensitive
hsa-miR-452-5p Itraconazole 55283 NSC754771 approved sensitive
hsa-miR-452-5p J-400634 385621 NSC676944 sensitive
hsa-miR-452-5p Kipca 4055 NSC4170 approved resistant
hsa-miR-452-5p L-lys-l-p-no2phe-l-ala-l-p-no2phenh2 386384 NSC678355 sensitive
hsa-miR-452-5p Ls-133613 365597 NSC633398 sensitive
hsa-miR-452-5p Ls-41225 57787 NSC664951 sensitive
hsa-miR-452-5p Ls-58067 379524 NSC664181 sensitive
hsa-miR-452-5p Ls-59969 380292 NSC665773 sensitive
hsa-miR-452-5p Mauve 407617 NSC7801 sensitive
hsa-miR-452-5p Methyl (2R,11bS)-2-[[(3R)-3-ethyl-1,4-dioxaspiro[4.5]decan-3-yl]methyl]-3-sulfanylidene-2,5,6,11-tetrahydro-1H-indolizino[8,7-b]indole-11b-carboxylate 386808 NSC679516 sensitive
hsa-miR-452-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-452-5p N-(4-((4-anilino-1-benzyl-4-piperidinyl)ethynyl)-1-benzyl-4-piperidinyl)-n-phenylamine 379997 NSC665299 sensitive
hsa-miR-452-5p N-[(3S,10S,13S,17S)-17-[1-(dimethylamino)ethyl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl]formamide 54612852 NSC748904 sensitive
hsa-miR-452-5p N-[(e)-[2-chloro-4-(dimethylamino)phenyl]methylideneamino]naphthalene-1-carboxamide 9568495 NSC115980 sensitive
hsa-miR-452-5p N-[(e)-[6-(2,5-dimethylanilino)-1-(4-hydroxyphenyl)-2-methyl-1,6-dioxohexan-3-ylidene]amino]-2-hydroxynaphthalene-1-carboxamide 9555801 NSC630357 resistant
hsa-miR-452-5p N-[2-(3,4-dihydroxyphenyl)ethyl]-3-phenylpropanamide 383148 NSC671189 sensitive
hsa-miR-452-5p N-[2-(4-acetylpiperazin-1-yl)ethyl]-3-(3-chloro-5-hydroxyphenyl)-4-pyridin-4-ylpyrazole-1-carboxamide 53483672 NSC753193 sensitive
hsa-miR-452-5p N-[4-chloro-2-(2-chlorobenzoyl)phenyl]-2-(4-pyridin-2-ylpiperazin-1-yl)acetamide 24206025 NSC737733 sensitive
hsa-miR-452-5p N-[6'-(diethylamino)-3-oxospiro[2-benzofuran-1,9'-xanthene]-2'-yl]-N-phenylacetamide 389678 NSC686130 sensitive
hsa-miR-452-5p N,n-bis(2-chloroethyl)-4-(6-chloropurin-9-yl)aniline 254234 NSC78298 resistant
hsa-miR-452-5p NSC605607 NSC605607 sensitive
hsa-miR-452-5p Pc 287 239486 NSC44580 sensitive
hsa-miR-452-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-452-5p Platinum, (1,2-cyclohexanediamine-n,n')(propanedioato(2-)-o,o')-, (sp-4-2-(1r-trans))- (9ci) NSC266047 sensitive
hsa-miR-452-5p Propyl gallate 4947 NSC2626 resistant
hsa-miR-452-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-452-5p Psoralen quinone 68083 NSC401268 resistant
hsa-miR-452-5p Spiro[s-indacene-2(5h),2'-[2h]inden]-5-one, 1,1',3,3',6,7-hexahydro- 382726 NSC670404 sensitive
hsa-miR-452-5p Stk673166 NSC717468 sensitive
hsa-miR-452-5p Vancide 26 79411 NSC5337 sensitive
hsa-miR-452-5p Ver a 5351232 NSC126728 sensitive
hsa-miR-452-5p Z198955462 135528004 NSC744178 sensitive
hsa-miR-452-5p Z28714792 2671841 NSC746248 sensitive
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-452-5p 10-Hydroxycamptothecin 97226 NSC107124 resistant High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-452-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (C13*, A2780, OV2008)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved sensitive High Gastric Cancer cell line (BGC823, HGC-27, NCI-N87)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Small Cell Lung Cancer cell line (H446)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-452-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive High Colorectal Cancer cell line (LS174T)
hsa-miR-452-5p Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-452-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-452-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-452-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT116)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-452-5p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-452-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-452-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-452-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-452-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission