miRTarBase - #MIRT053459


—
pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-5p
Sequence 14| AACUGUUUGCAGAGGAAACUGA |35
Evidence Experimental
Experiments Cloned
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CASD1   
Synonyms C7orf12, NBLA04196, SOAT
Description CAS1 domain containing 1
Transcript NM_022900   
Expression
Putative miRNA Targets on CASD1
3'UTR of CASD1
(miRNA target sites are highlighted)		 
>CASD1|NM_022900|3'UTR
   1 GTTCCAAAAATTCTAAAAAACCTAAACTCTTCAGGCTACCTTTGTGTGTCTCTAGAAGAGAAAAGCATCTATCTGGAGAT
  81 ATAAATGTGTATGTAAATATAAACGTTTGTGGCAAGAGGACAGTTCTGTGACATCTGTTGAACATATGTGGTTGTATATA
 161 TTGGAAATGTACATATCCAATATGAAATACTAAAACAAACAAACAAACAAAAAACCAGAATGCATTGTATAGGATTGCAT
 241 GTGAAGTCTTTTCTACTGAATCTATATTTCCATTTGTAAGTGATTTTAAGTTAACATATGAAGGCAGGGAAATGATTACC
 321 TTTCCAGTAAAAAGTATAGATAATTTAATTAACTTAGTGACACCACCAAGTGTTTTGATATAACTAAATTTGTGGTAATA
 401 AGACTGTCTGCACCTGTATTCATTGTGGAACTTCCTCTTTCATTGGAAACTTTCTTACTCAAGAATGACGGCAGTATTGT
 481 TTTCTTATATGTGCAATGAAGTGGAATGATAAACAGTATGCCTTTAATTTATATGTGTTCTTGTTCTGATGTTGTTTCCT
 561 GAAATGATTTTTCTTCCTAACTGTGGTTTTCGGGTATGCAAGCCTAAATCTTTGTACACTTTGTCTCACAGAATAGTTCT
 641 GAGGCTCCATGACAGGGTTTTGTCATTGTTGATGTTATTGTTGCTTCGTTTTATAAAAAAGCCAAAATTTTTTTTCCAAT
 721 CCAAACGTTCACCTGTTTCCTTTCCTCAAGCTATACCAGTGTAATACCAGTTACCCTGTGGATCCATTTAATATGTTATC
 801 CCCACTAATTAATTTTCGTATATTATTTCCAATATTTGGAAAGCTCTTTATAGCCATTTGGTATTTCCTATTACCCACCT
 881 CCTATTTTAAATATTTATCAGTCTAAACTTGTGCAGTGTAGTAAACATGCAAGTTGTTACGATTGAGCTGTATTACCATA
 961 AGTAGAATTTTAAGTAAACTGGTGAATTTGGGCAATAAATGTTTTTGCTTTTTGTTTGATTTTTTTTTACAAGCTAACTG
1041 TTAGAGGTATACATTTATTTATCTGTTGTACAGATTTGATTATGATTTTAATGTTTGAAAGATTGCACTTGTTTGCTTTT
1121 ACTATATGTGGGGTAAAATATATTTTCTGTTCACAGTATATGAAAATATGGAGTAATTTAAACAGTAAATAAACATTCTG
1201 TGGATGCTTATTTTTGTATTGGCAAAGTATCAATTAAACTATATGTGTTCTTTTTCAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucaaaggagAC-GUUUGUCAa 5'
                     || :||||||| 
Target 5' atgaagtggaaTGATAAACAGTa 3'
 496 - 518 143.00 -8.00
2 
miRNA  3' agucaaaggagACGUUUGUCAa 5'
                     | :||||||| 
Target 5' atatggagtaaTTTAAACAGTa 3'
 1166 - 1187 143.00 -7.20
3 
miRNA  3' agucAAAGGAGA---CGUUUGUCAa 5'
              || |||:|   |:||| ||| 
Target 5' atgaTTACCTTTCCAGTAAAAAGTa 3'
 312 - 336 130.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500986 21 COSMIC
COSN26807827 59 COSMIC
COSN29384662 88 COSMIC
COSN24395884 103 COSMIC
COSN24460877 157 COSMIC
COSN24887280 235 COSMIC
COSN6899501 358 COSMIC
COSN6899502 359 COSMIC
COSN17384722 694 COSMIC
COSN21821361 770 COSMIC
COSN30345229 782 COSMIC
COSN16903655 811 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs568608883 1 dbSNP
rs770042357 2 dbSNP
rs540026140 5 dbSNP
rs1322997072 6 dbSNP
rs1347524516 13 dbSNP
rs1331709281 16 dbSNP
rs1439265508 18 dbSNP
rs746570632 21 dbSNP
rs556826637 25 dbSNP
rs1203617996 29 dbSNP
rs774852126 33 dbSNP
rs1246263230 34 dbSNP
rs1277134404 34 dbSNP
rs759970502 35 dbSNP
rs925218763 36 dbSNP
rs201984099 40 dbSNP
rs990929475 41 dbSNP
rs371171339 47 dbSNP
rs373732621 49 dbSNP
rs1190997142 50 dbSNP
rs1190671710 53 dbSNP
rs1229047045 55 dbSNP
rs949079420 66 dbSNP
rs1363877665 68 dbSNP
rs927490340 70 dbSNP
rs1213927693 72 dbSNP
rs1350138228 78 dbSNP
rs1322387631 83 dbSNP
rs542124480 88 dbSNP
rs61611349 92 dbSNP
rs984545348 93 dbSNP
rs1388453957 105 dbSNP
rs887252651 106 dbSNP
rs1277361656 113 dbSNP
rs1246352497 114 dbSNP
rs1204689690 116 dbSNP
rs1489817821 117 dbSNP
rs907623266 125 dbSNP
rs940186296 127 dbSNP
rs940390390 129 dbSNP
rs1271956320 134 dbSNP
rs1341391944 145 dbSNP
rs193301138 149 dbSNP
rs1295257104 150 dbSNP
rs1220452552 158 dbSNP
rs975757982 159 dbSNP
rs898766611 162 dbSNP
rs148649873 166 dbSNP
rs1254056004 172 dbSNP
rs1050224636 173 dbSNP
rs530242457 174 dbSNP
rs773217408 176 dbSNP
rs536180382 181 dbSNP
rs1050737802 183 dbSNP
rs1178788414 186 dbSNP
rs1433857481 193 dbSNP
rs549868569 193 dbSNP
rs936480600 193 dbSNP
rs540665809 195 dbSNP
rs1021006565 208 dbSNP
rs1205645551 209 dbSNP
rs1482565200 211 dbSNP
rs1249555339 213 dbSNP
rs1212139428 215 dbSNP
rs966503089 216 dbSNP
rs879427593 221 dbSNP
rs1032254830 224 dbSNP
rs1217170540 230 dbSNP
rs762997068 239 dbSNP
rs1010713820 242 dbSNP
rs1288547039 250 dbSNP
rs1429623367 254 dbSNP
rs1024322408 256 dbSNP
rs867861366 257 dbSNP
rs907163916 263 dbSNP
rs563821669 265 dbSNP
rs1394966266 266 dbSNP
rs766147872 267 dbSNP
rs1268198730 272 dbSNP
rs917547123 282 dbSNP
rs1364041123 286 dbSNP
rs1174070072 289 dbSNP
rs1458848937 292 dbSNP
rs970402339 301 dbSNP
rs1412976746 303 dbSNP
rs983171809 308 dbSNP
rs1215068675 310 dbSNP
rs1181652479 319 dbSNP
rs1472173707 330 dbSNP
rs907655881 334 dbSNP
rs751339934 335 dbSNP
rs1183572405 338 dbSNP
rs1483525656 339 dbSNP
rs117114249 341 dbSNP
rs1236784443 341 dbSNP
rs1201265296 342 dbSNP
rs1330524000 343 dbSNP
rs1268385348 347 dbSNP
rs1292159544 349 dbSNP
rs1331981620 364 dbSNP
rs1038983426 370 dbSNP
rs1315548359 378 dbSNP
rs1234752733 381 dbSNP
rs1396923149 386 dbSNP
rs868747570 387 dbSNP
rs961790483 389 dbSNP
rs1437380868 395 dbSNP
rs1446050687 402 dbSNP
rs1389448316 404 dbSNP
rs932863582 406 dbSNP
rs976210005 426 dbSNP
rs922971618 432 dbSNP
rs1361899325 441 dbSNP
rs1166685035 442 dbSNP
rs1424136246 456 dbSNP
rs1255392042 457 dbSNP
rs1050013779 460 dbSNP
rs891096888 470 dbSNP
rs865825824 471 dbSNP
rs925175254 472 dbSNP
rs1207767842 477 dbSNP
rs1187792763 480 dbSNP
rs184276683 487 dbSNP
rs1415806022 494 dbSNP
rs374614673 497 dbSNP
rs1476196799 498 dbSNP
rs1366078955 504 dbSNP
rs563301803 505 dbSNP
rs1319948999 514 dbSNP
rs902644579 515 dbSNP
rs1165737722 518 dbSNP
rs1000695253 525 dbSNP
rs1393190811 532 dbSNP
rs1032555260 533 dbSNP
rs754844206 534 dbSNP
rs529092770 535 dbSNP
rs892275470 553 dbSNP
rs116619843 562 dbSNP
rs1012557105 569 dbSNP
rs1024911871 576 dbSNP
rs970371327 580 dbSNP
rs1458232690 587 dbSNP
rs3763465 592 dbSNP
rs527678540 593 dbSNP
rs142115202 597 dbSNP
rs192182816 599 dbSNP
rs1187422201 621 dbSNP
rs963493701 634 dbSNP
rs767056513 654 dbSNP
rs183811536 658 dbSNP
rs1312129813 659 dbSNP
rs556710049 661 dbSNP
rs932847836 670 dbSNP
rs570110786 677 dbSNP
rs1416152500 682 dbSNP
rs150733636 687 dbSNP
rs752406460 688 dbSNP
rs1349553757 689 dbSNP
rs1225342001 694 dbSNP
rs1221691179 695 dbSNP
rs78711026 702 dbSNP
rs1386421995 703 dbSNP
rs1364785560 705 dbSNP
rs1317851442 706 dbSNP
rs1431358783 707 dbSNP
rs1210801259 708 dbSNP
rs1371091967 709 dbSNP
rs755617690 727 dbSNP
rs1474172159 740 dbSNP
rs1015061613 751 dbSNP
rs572731395 768 dbSNP
rs879092451 773 dbSNP
rs962490018 783 dbSNP
rs1432215634 787 dbSNP
rs762780699 791 dbSNP
rs975860737 794 dbSNP
rs777274357 799 dbSNP
rs36040032 800 dbSNP
rs1483550513 810 dbSNP
rs540601660 818 dbSNP
rs3763464 819 dbSNP
rs1133697 821 dbSNP
rs1232558661 823 dbSNP
rs924915177 833 dbSNP
rs1290374499 846 dbSNP
rs1160473301 850 dbSNP
rs539883276 857 dbSNP
rs988022513 864 dbSNP
rs1328172418 868 dbSNP
rs565825762 871 dbSNP
rs949238365 873 dbSNP
rs1468800080 879 dbSNP
rs1024882339 880 dbSNP
rs1160852286 891 dbSNP
rs1473156525 892 dbSNP
rs1251543894 894 dbSNP
rs1180339816 906 dbSNP
rs563398280 909 dbSNP
rs928699517 917 dbSNP
rs1199946954 920 dbSNP
rs1313005575 926 dbSNP
rs1004544419 927 dbSNP
rs769119007 931 dbSNP
rs1270311530 933 dbSNP
rs1014565049 934 dbSNP
rs1439605493 940 dbSNP
rs1133698 941 dbSNP
rs1278711653 942 dbSNP
rs1373594835 943 dbSNP
rs973538699 944 dbSNP
rs1028770401 953 dbSNP
rs1334665219 953 dbSNP
rs1451300558 954 dbSNP
rs1278597167 959 dbSNP
rs143978662 961 dbSNP
rs1161011482 975 dbSNP
rs1457416557 979 dbSNP
rs1350749592 980 dbSNP
rs954335704 989 dbSNP
rs15671 995 dbSNP
rs1133700 999 dbSNP
rs1006438190 1020 dbSNP
rs1187443168 1020 dbSNP
rs565284977 1020 dbSNP
rs1249938848 1031 dbSNP
rs529044711 1034 dbSNP
rs1209647579 1035 dbSNP
rs944257967 1036 dbSNP
rs1036536318 1037 dbSNP
rs551724609 1038 dbSNP
rs1358135176 1043 dbSNP
rs1284769269 1045 dbSNP
rs998079066 1048 dbSNP
rs978315181 1066 dbSNP
rs1030103008 1069 dbSNP
rs1321948551 1073 dbSNP
rs1435139848 1077 dbSNP
rs923912225 1085 dbSNP
rs1436085240 1092 dbSNP
rs1315717596 1102 dbSNP
rs1407494352 1106 dbSNP
rs953265078 1109 dbSNP
rs189869925 1116 dbSNP
rs1163549579 1124 dbSNP
rs1443298597 1125 dbSNP
rs1007286553 1126 dbSNP
rs1189335151 1132 dbSNP
rs1184267620 1135 dbSNP
rs1240596956 1146 dbSNP
rs1224036957 1154 dbSNP
rs773447177 1161 dbSNP
rs1032018856 1162 dbSNP
rs574263307 1165 dbSNP
rs541600699 1170 dbSNP
rs1357223623 1173 dbSNP
rs1414624013 1174 dbSNP
rs1299643514 1180 dbSNP
rs1228513646 1186 dbSNP
rs1192816276 1187 dbSNP
rs1393012263 1196 dbSNP
rs1268118270 1204 dbSNP
rs1438124177 1211 dbSNP
rs1332084826 1213 dbSNP
rs947868216 1217 dbSNP
rs1436526306 1226 dbSNP
rs1173046664 1232 dbSNP
rs1046297200 1234 dbSNP
rs1409519916 1240 dbSNP
rs906372661 1241 dbSNP
rs774397268 1242 dbSNP
rs1004765275 1245 dbSNP
rs1478467266 1246 dbSNP
rs1014868308 1248 dbSNP
rs898812238 1251 dbSNP
rs994534947 1259 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions SKOV3
Location of target site 3'UTR
Original Description (Extracted from the article) ... "MiRNA expression in four PTX-resistant cell lines (SKpac-8 ...

- Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al., 2013, British journal of cancer.

Article - Huh JH; Kim TH; Kim K; Song JA; Jung YJ; et al.
- British journal of cancer, 2013
BACKGROUND: MicroRNAs are noncoding regulatory RNAs strongly implicated in carcinogenesis, cell survival, and chemosensitivity. Here, microRNAs associated with chemoresistance in ovarian carcinoma, the most lethal of gynaecological malignancies, were identified and their functional effects in chemoresistant ovarian cancer cells were assessed. METHODS: MicroRNA expression in paclitaxel (PTX)-resistant SKpac sublines was compared with that of the PTX-sensitive, parental SKOV3 ovarian cancer cell line using microarray and qRT-PCR. The function of differentially expressed microRNAs in chemoresistant ovarian cancer was further evaluated by apoptosis, cell proliferation, and migration assays. RESULTS: Upregulation of miR-106a and downregulation of miR-591 were associated with PTX resistance in ovarian cancer cells and human tumour samples. Transfection with anti-miR-106a or pre-miR-591 resensitized PTX-resistant SKpac cells to PTX by enhancing apoptosis (23 and 42% increase), and inhibited their cell migration (43 and 56% decrease) and proliferation (64 and 65% decrease). Furthermore, ZEB1 was identified as a novel target gene of miR-591, and BCL10 and caspase-7 were target genes of miR-106a, as identified by immunoblotting and luciferase assay. CONCLUSION: MiR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.
LinkOut: [PMID: 23807165]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21849 B cell lymphoma -0.542 1.2e-3 -0.542 1.2e-3 29 Click to see details
GSE28544 Breast cancer 0.546 2.9e-3 0.777 4.0e-6 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.454 1.3e-2 0.443 1.5e-2 24 Click to see details
GSE21687 Ependynoma primary tumors -0.249 2.4e-2 -0.130 1.5e-1 64 Click to see details
GSE38226 Liver fibrosis -0.427 2.7e-2 0.038 4.4e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.306 4.4e-2 0.328 3.3e-2 32 Click to see details
GSE21032 Prostate cancer -0.182 5.0e-2 -0.184 4.8e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells 0.315 7.2e-2 0.278 1.0e-1 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.319 8.5e-2 -0.352 6.4e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.272 9.4e-2 -0.018 4.7e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.373 1.2e-1 -0.077 4.1e-1 12 Click to see details
GSE17498 Multiple myeloma -0.16 1.6e-1 -0.105 2.6e-1 40 Click to see details
GSE19536 Breast cancer -0.089 1.9e-1 -0.216 1.5e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.163 2.2e-1 0.022 4.6e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.08 2.3e-1 0.107 1.6e-1 90 Click to see details
GSE17306 Multiple myeloma -0.071 3.1e-1 -0.037 4.0e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.128 3.2e-1 0.082 3.8e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.111 3.2e-1 -0.191 2.1e-1 20 Click to see details
GSE28260 Renal cortex and medulla 0.062 4.2e-1 0.209 2.5e-1 13 Click to see details
GSE19783 ER- ER- breast cancer -0.008 4.7e-1 -0.186 5.0e-2 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.424 0 -0.434 0 84 Click to see details
HNSC -0.455 0 -0.413 0 42 Click to see details
KIRC 0.294 0.01 0.311 0 68 Click to see details
LUSC -0.38 0.01 -0.447 0 38 Click to see details
STAD -0.408 0.01 -0.481 0 32 Click to see details
UCEC -0.393 0.05 -0.151 0.27 19 Click to see details
THCA 0.198 0.07 0.233 0.04 59 Click to see details
BLCA -0.347 0.08 -0.513 0.01 18 Click to see details
KIRP -0.236 0.1 -0.284 0.06 32 Click to see details
KICH -0.263 0.1 -0.209 0.16 25 Click to see details
CESC 0.908 0.14 1.000 0.5 3 Click to see details
COAD -0.337 0.21 -0.024 0.48 8 Click to see details
PAAD -0.561 0.22 -0.600 0.2 4 Click to see details
ESCA -0.259 0.22 -0.118 0.36 11 Click to see details
LUAD -0.239 0.23 -0.448 0.07 12 Click to see details
LIHC -0.094 0.26 -0.102 0.24 49 Click to see details
CHOL -0.049 0.45 -0.083 0.42 9 Click to see details
PRAD -0.01 0.47 -0.101 0.24 50 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
PCPG -1 0.5 -1.000 0.5 3 Click to see details
70 hsa-miR-452-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053449 BAG4 BCL2 associated athanogene 4 1 1
MIRT053450 ITGA9 integrin subunit alpha 9 1 1
MIRT053451 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT053452 CDK6 cyclin dependent kinase 6 1 1
MIRT053453 TBK1 TANK binding kinase 1 1 1
MIRT053454 RHOU ras homolog family member U 1 1
MIRT053455 NOTCH2NL notch 2 N-terminal like 1 1
MIRT053456 TNF tumor necrosis factor 1 1
MIRT053457 IL3 interleukin 3 1 1
MIRT053458 TNFAIP8 TNF alpha induced protein 8 1 1
MIRT053459 CASD1 CAS1 domain containing 1 1 1
MIRT053460 SMAD4 SMAD family member 4 1 1
MIRT053522 DPYSL2 dihydropyrimidinase like 2 2 1
MIRT053523 KRAS KRAS proto-oncogene, GTPase 2 1
MIRT053787 MMP2 matrix metallopeptidase 2 2 1
MIRT053788 TM7SF4 dendrocyte expressed seven transmembrane protein 2 1
MIRT054841 THRB thyroid hormone receptor beta 3 1
MIRT076091 ADORA2B adenosine A2b receptor 2 2
MIRT133747 SKI SKI proto-oncogene 2 2
MIRT437780 BMI1 BMI1 proto-oncogene, polycomb ring finger 1 1
MIRT437781 LEF1 lymphoid enhancer binding factor 1 1 1
MIRT437782 TCF4 transcription factor 4 1 1
MIRT438015 CDKN1B cyclin dependent kinase inhibitor 1B 5 3
MIRT486626 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT493350 LAMC1 laminin subunit gamma 1 2 8
MIRT495000 TSSC1 EARP complex and GARP complex interacting protein 1 2 2
MIRT497724 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT498197 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT500265 ZNF788 zinc finger family member 788 2 6
MIRT500608 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT507531 DSTN destrin, actin depolymerizing factor 2 2
MIRT513420 RTP4 receptor transporter protein 4 2 2
MIRT515388 RPL7 ribosomal protein L7 2 2
MIRT516404 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT531390 TXNDC16 thioredoxin domain containing 16 2 2
MIRT533161 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT533983 TADA2A transcriptional adaptor 2A 2 2
MIRT544365 EGLN1 egl-9 family hypoxia inducible factor 1 2 2
MIRT545406 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT551367 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT556491 LIPA lipase A, lysosomal acid type 2 2
MIRT559336 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT561668 REST RE1 silencing transcription factor 2 2
MIRT565353 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565366 TMCC1 transmembrane and coiled-coil domain family 1 2 2
MIRT571405 MED4 mediator complex subunit 4 2 2
MIRT574476 RPS16 ribosomal protein S16 2 2
MIRT609702 GFRA1 GDNF family receptor alpha 1 2 2
MIRT611081 ZNF621 zinc finger protein 621 2 2
MIRT613238 CCDC39 coiled-coil domain containing 39 2 2
MIRT614618 MVK mevalonate kinase 2 2
MIRT615351 SMU1 DNA replication regulator and spliceosomal factor 2 4
MIRT620013 CCDC137 coiled-coil domain containing 137 2 2
MIRT623722 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT637022 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT637353 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT638050 SHPK sedoheptulokinase 2 2
MIRT657131 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 2 2
MIRT657453 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT666586 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT701745 MTDH metadherin 2 2
MIRT702145 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT709155 ZNF799 zinc finger protein 799 2 2
MIRT711051 IRS1 insulin receptor substrate 1 2 2
MIRT716104 HARS histidyl-tRNA synthetase 2 2
MIRT717265 BMPR2 bone morphogenetic protein receptor type 2 2 2
MIRT721687 MRPL19 mitochondrial ribosomal protein L19 2 2
MIRT722340 BEND6 BEN domain containing 6 2 2
MIRT732741 VEGFA vascular endothelial growth factor A 3 0
MIRT734714 EZR ezrin 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-452-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-452-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-452-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-452-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-452-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-452-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-452-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-452-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-452-5p (4z)-n-[(2-chlorobenzylidene)amino]-4-(dimethylaminohydrazono)-5-methyl-pyrazole-3-carboxamide 135545659 NSC131257 sensitive
hsa-miR-452-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-452-5p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-452-5p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-452-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-452-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-452-5p (E)-2-(3,4-dihydroxybenzoyl)-3-(1H-indol-3-yl)prop-2-enenitrile 5329275 NSC650934 sensitive
hsa-miR-452-5p (Z)-[5-(4-carboxy-N-methylanilino)-2,4-dinitrophenoxy]imino-(dimethylamino)-oxidoazanium 11154356 NSC731703 resistant
hsa-miR-452-5p [(1r,2r,3ar,4s,5s,6e,9s,10r,11s,13r,13as)-2,4,13-triacetyloxy-1-benzoyloxy-3a,10-dihydroxy-2,5,8,8-tetramethyl-12-methylidene-11-(2-methylpropoxy)-3,4,5,9,10,11,13,13a-octahydro-1h-cyclopenta[12]annul 5469445 NSC688235 sensitive
hsa-miR-452-5p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-452-5p [(1R,2S,10S,13S,14R)-7-(4-fluorophenyl)-10,14-dimethyl-6,7,9-triazapentacyclo[11.8.0.02,10.04,8.014,19]henicosa-4(8),5,19-trien-17-yl] acetate 392371 NSC692655 sensitive
hsa-miR-452-5p [(1S,16E,24E,26E,28Z)-1-hydroxy-12-[1-(4-hydroxy-3-methoxycyclohexyl)propan-2-yl]-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-2,3,10,14,20-pentaoxo-11,36-dioxa-4-azatricyclo[30.3.1.04,9]hexatriaconta-16,24,26,28-tetraen-18-yl] 3-(diethylamino)propanoate; 5386305 NSC606699 sensitive
hsa-miR-452-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-452-5p [(3s,8r,9s,10r,13s,14s,16e,17e)-16-[(3,4-dimethoxyphenyl)methylidene]-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 9572442 NSC716258 sensitive
hsa-miR-452-5p [2-(12,14-dioxo-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1,4,6,8,10,15,17,19,21-nonaen-3-yl)-3-hydroxy-6-(hydroxymethyl)-5-methoxyoxan-4-yl] 2,6-diaminohexanoate;hydrochloride 24203046 NSC726578 resistant
hsa-miR-452-5p 1'-hydroxy-2'-(naphthalene-1-carbonyl)-1'-naphthalen-1-ylspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione NSC682763 sensitive
hsa-miR-452-5p 1-(1-naphthylmethylene)-4-(1-naphthyl)semicarbazide 5859414 NSC680931 sensitive
hsa-miR-452-5p 11-(4-nitrophenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608965 NSC697748 resistant
hsa-miR-452-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-452-5p 1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) NSC659162 sensitive
hsa-miR-452-5p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 resistant
hsa-miR-452-5p 2-(1-hydroxyethyl)thieno[3,2-f][1]benzothiole-4,8-dione 391375 NSC690432 resistant
hsa-miR-452-5p 2-(2-amino-6-phenylpyrimidin-4-yl)-4-methylphenol 386504 NSC678879 sensitive
hsa-miR-452-5p 2-[(e)-[6-(3,6-dimethoxy-2-nitrophenyl)-2-propylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572654 NSC723548 sensitive
hsa-miR-452-5p 2-[[(1s,5s,8z,12s,20s)-13-phenoxycarbonyl-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyn-5-yl]oxy]acetic acid 54604782 NSC677586 resistant
hsa-miR-452-5p 2-[[(3s,8s,9s,10r,11s,13s,14s,16s,17r)-3,11-dihydroxy-17-[(2s,3s)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1h-cyclopenta[a]phenanthren-16-yl]oxy]-6-methy 392623 NSC693185 sensitive
hsa-miR-452-5p 2-[4-[5-(3,4-dimethoxyphenyl)imidazol-1-yl]phenyl]-5,7-dimethoxy-1,3-benzothiazole 60147635 NSC751902 sensitive
hsa-miR-452-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-452-5p 2,3-dehydrosarcovagine d 54612860 NSC748913 sensitive
hsa-miR-452-5p 2,3-dimethoxyindolo[2,1-a]isoquinolin-7-ium-12-one 498408 NSC627787 resistant
hsa-miR-452-5p 2,3,5-triphenyl-1,3-selenazol-3-ium-4-olate 363056 NSC627605 resistant
hsa-miR-452-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-452-5p 2,7-bis(methoxycarbonylmethyl)-10-methylphenothiazine 384444 NSC674225 sensitive
hsa-miR-452-5p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 sensitive
hsa-miR-452-5p 3-(3,5-dichlorophenyl)-2-(2-pyridinyl)acrylonitrile 5467799 NSC659323 sensitive
hsa-miR-452-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-452-5p 3-(4-methoxyphenyl)-5,5,5-triphenyl-4,5-dihydro-1,2,5lambda(5)-oxazaphosphole NSC304610 sensitive
hsa-miR-452-5p 3-(benzenesulfonyl)-7-benzyl-2-methoxy-5,6-dihydropyrazolo[3,4-h]quinoline 54613023 NSC750762 sensitive
hsa-miR-452-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-452-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-452-5p 3-bromo-4-(2-(4-methoxyphenyl)ethynyl)furan-2(5h)-one 24204187 NSC730944 sensitive
hsa-miR-452-5p 3,5-dichloro-N-[4-[3-(3-chloro-4-methoxyphenyl)-4-pyridin-4-ylpyrazol-1-yl]phenyl]benzamide 142712058 NSC755465 sensitive
hsa-miR-452-5p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-452-5p 4-(4-carbazol-9-ylbutanoylamino)-n-[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 406397 NSC724462 sensitive
hsa-miR-452-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-452-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(4-fluorophenyl)benzamide 1194957 NSC732830 sensitive
hsa-miR-452-5p 4-[(2z)-2-(5-oxooxolan-2-ylidene)ethoxy]chromen-2-one 24205379 NSC735331 resistant
hsa-miR-452-5p 4-[(4z)-5-oxo-4-[(4-phenoxyphenyl)methylidene]-2-phenylimidazol-1-yl]-n-(1,3-thiazol-2-yl)benzenesulfonamide 5472414 NSC718649 sensitive
hsa-miR-452-5p 4-[2-(5,6-dihydrobenzo[a]carbazol-11-yl)ethyl]morpholine 390894 NSC689069 sensitive
hsa-miR-452-5p 4-[4-(3-methoxyphenyl)piperazin-1-yl]-5H-pyrrolo[3,2-d]pyrimidine 155815900 NSC754824 sensitive
hsa-miR-452-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-452-5p 4-benzyl-1-(2-chlorophenyl)-[1,2,4]triazolo[4,3-a]quinoxaline 46945878 NSC761676 sensitive
hsa-miR-452-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-452-5p 4,4-diphenyl-2-(3,4,5-trimethoxyphenyl)-1,3-diazinane;hydrochloride 379863 NSC665001 sensitive
hsa-miR-452-5p 4,5-bis(4-methoxyphenyl)-1h-imidazol-2(5h)-one 231112 NSC26692 sensitive
hsa-miR-452-5p 4,5,15,16-tetraphenyl-10-(2,4,6-triphenylpyridin-1-ium-1-yl)-3,6,14,17-tetraoxa-23-azatricyclo[17.3.1.18,12]tetracosa-1(23),8(24),9,11,19,21-hexaen-24-olate 16129807 NSC674178 sensitive
hsa-miR-452-5p 5-(4-chlorophenyl)-n-(3,4,5-trimethoxyphenyl)-1h-pyrazol-4-amine 45028878 NSC744683 sensitive
hsa-miR-452-5p 5-[(E)-2-(5-ethyl-1-methylpyridin-1-ium-2-yl)ethenyl]quinolin-8-ol;iodide 135534376 NSC79543 sensitive
hsa-miR-452-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-[2-(4-fluorophenyl)ethyl]-2-methoxybenzamide 403660 NSC718728 sensitive
hsa-miR-452-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-hexyl-2-methoxybenzamide 403659 NSC718727 sensitive
hsa-miR-452-5p 5-[3-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374830 NSC762542 sensitive
hsa-miR-452-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 sensitive
hsa-miR-452-5p 5,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 372651 NSC648148 sensitive
hsa-miR-452-5p 6-hydroxy-3,3,11,12-tetramethyl-pyrano[2,3-c]acridin-7-one 5465763 NSC660813 sensitive
hsa-miR-452-5p 8-(2,3-dimethoxyphenyl)-7-methyl-n-phenyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-amine 381363 NSC667903 sensitive
hsa-miR-452-5p 8-chloro-3-(naphthalen-1-ylamino)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazine-7-carbonitrile 406667 NSC724907 resistant
hsa-miR-452-5p 8-hydroxymanzamine a 5468481 NSC670852 sensitive
hsa-miR-452-5p Abiraterone 132971 NSC749226 approved sensitive
hsa-miR-452-5p Aminopyrimidine-f 406276 NSC724328 sensitive
hsa-miR-452-5p Ammonium trichlorotellurate NSC618654 sensitive
hsa-miR-452-5p Austocystin d 5470400 NSC700893 resistant
hsa-miR-452-5p Azure b bromide 13797451 NSC16166 resistant
hsa-miR-452-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-452-5p C8, carbonyl prodigiosine 135540857 NSC742417 sensitive
hsa-miR-452-5p Dimethyl 2,2'-(pyridine-2,6-diyldicarbonyl)bis(1-methylhydrazinecarbodithioate) 375401 NSC655072 sensitive
hsa-miR-452-5p Dromostanolone propionate 224004 NSC12198 sensitive
hsa-miR-452-5p Ethyl 2-[(2e)-2-[(4-chlorophenyl)methylidene]hydrazinyl]-5-phenyl-1h-pyrrole-3-carboxylate 45027953 NSC740252 sensitive
hsa-miR-452-5p Gsk718429a 44587530 NSC756188 sensitive
hsa-miR-452-5p Hexyl (e)-3-[(2s,4z)-2-(hydroxymethyl)-4-(4-methyl-3-propan-2-ylpentylidene)-5-oxooxolan-2-yl]prop-2-enoate 5471817 NSC714070 sensitive
hsa-miR-452-5p Hopeaphenol 495605 NSC661748 resistant
hsa-miR-452-5p Hydrazine sulfate 24842 NSC150014 sensitive
hsa-miR-452-5p Iejimalide a. 5473233 NSC724579 sensitive
hsa-miR-452-5p Indoline, 5-chloro-1,3,3-trimethyl-2-methylene- (8ci) 81308 NSC158263 sensitive
hsa-miR-452-5p Isatin dr 24204246 NSC731093 sensitive
hsa-miR-452-5p Itraconazole 55283 NSC754771 approved sensitive
hsa-miR-452-5p J-400634 385621 NSC676944 sensitive
hsa-miR-452-5p Kipca 4055 NSC4170 approved resistant
hsa-miR-452-5p L-lys-l-p-no2phe-l-ala-l-p-no2phenh2 386384 NSC678355 sensitive
hsa-miR-452-5p Ls-133613 365597 NSC633398 sensitive
hsa-miR-452-5p Ls-41225 57787 NSC664951 sensitive
hsa-miR-452-5p Ls-58067 379524 NSC664181 sensitive
hsa-miR-452-5p Ls-59969 380292 NSC665773 sensitive
hsa-miR-452-5p Mauve 407617 NSC7801 sensitive
hsa-miR-452-5p Methyl (2R,11bS)-2-[[(3R)-3-ethyl-1,4-dioxaspiro[4.5]decan-3-yl]methyl]-3-sulfanylidene-2,5,6,11-tetrahydro-1H-indolizino[8,7-b]indole-11b-carboxylate 386808 NSC679516 sensitive
hsa-miR-452-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-452-5p N-(4-((4-anilino-1-benzyl-4-piperidinyl)ethynyl)-1-benzyl-4-piperidinyl)-n-phenylamine 379997 NSC665299 sensitive
hsa-miR-452-5p N-[(3S,10S,13S,17S)-17-[1-(dimethylamino)ethyl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl]formamide 54612852 NSC748904 sensitive
hsa-miR-452-5p N-[(e)-[2-chloro-4-(dimethylamino)phenyl]methylideneamino]naphthalene-1-carboxamide 9568495 NSC115980 sensitive
hsa-miR-452-5p N-[(e)-[6-(2,5-dimethylanilino)-1-(4-hydroxyphenyl)-2-methyl-1,6-dioxohexan-3-ylidene]amino]-2-hydroxynaphthalene-1-carboxamide 9555801 NSC630357 resistant
hsa-miR-452-5p N-[2-(3,4-dihydroxyphenyl)ethyl]-3-phenylpropanamide 383148 NSC671189 sensitive
hsa-miR-452-5p N-[2-(4-acetylpiperazin-1-yl)ethyl]-3-(3-chloro-5-hydroxyphenyl)-4-pyridin-4-ylpyrazole-1-carboxamide 53483672 NSC753193 sensitive
hsa-miR-452-5p N-[4-chloro-2-(2-chlorobenzoyl)phenyl]-2-(4-pyridin-2-ylpiperazin-1-yl)acetamide 24206025 NSC737733 sensitive
hsa-miR-452-5p N-[6'-(diethylamino)-3-oxospiro[2-benzofuran-1,9'-xanthene]-2'-yl]-N-phenylacetamide 389678 NSC686130 sensitive
hsa-miR-452-5p N,n-bis(2-chloroethyl)-4-(6-chloropurin-9-yl)aniline 254234 NSC78298 resistant
hsa-miR-452-5p NSC605607 NSC605607 sensitive
hsa-miR-452-5p Pc 287 239486 NSC44580 sensitive
hsa-miR-452-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-452-5p Platinum, (1,2-cyclohexanediamine-n,n')(propanedioato(2-)-o,o')-, (sp-4-2-(1r-trans))- (9ci) NSC266047 sensitive
hsa-miR-452-5p Propyl gallate 4947 NSC2626 resistant
hsa-miR-452-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-452-5p Psoralen quinone 68083 NSC401268 resistant
hsa-miR-452-5p Spiro[s-indacene-2(5h),2'-[2h]inden]-5-one, 1,1',3,3',6,7-hexahydro- 382726 NSC670404 sensitive
hsa-miR-452-5p Stk673166 NSC717468 sensitive
hsa-miR-452-5p Vancide 26 79411 NSC5337 sensitive
hsa-miR-452-5p Ver a 5351232 NSC126728 sensitive
hsa-miR-452-5p Z198955462 135528004 NSC744178 sensitive
hsa-miR-452-5p Z28714792 2671841 NSC746248 sensitive
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-452-5p 10-Hydroxycamptothecin 97226 NSC107124 resistant High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (HuCCT1, HuH28)
hsa-miR-452-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (C13*, A2780, OV2008)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved sensitive High Gastric Cancer cell line (BGC823, HGC-27, NCI-N87)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Small Cell Lung Cancer cell line (H446)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-452-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive High Colorectal Cancer cell line (LS174T)
hsa-miR-452-5p Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-452-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-452-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-452-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-452-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT116)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-452-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-452-5p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-452-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-452-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-452-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-452-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-452-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-452-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-452-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-452-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission