miRTarBase - #MIRT053484


—
pre-miRNA Information
pre-miRNA hsa-mir-570   
Genomic Coordinates chr3: 195699401 - 195699497
Synonyms MIRN570, hsa-mir-570, MIR570
Description Homo sapiens miR-570 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-570-3p
Sequence 60| CGAAAACAGCAAUUACCUUUGC |81
Evidence Experimental
Experiments SAGE
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 3 + 195699464 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs562192952 1 dbSNP
rs772001684 2 dbSNP
rs1429248332 7 dbSNP
rs372336246 8 dbSNP
rs1435829348 10 dbSNP
rs1372443221 12 dbSNP
rs1484195269 17 dbSNP
rs1446121044 19 dbSNP
rs761215764 20 dbSNP
rs764570717 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B92RKB miR-570 Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol CD274   
Synonyms B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1
Description CD274 molecule
Transcript NM_014143   
Expression
Putative miRNA Targets on CD274
3'UTR of CD274
(miRNA target sites are highlighted)		 
>CD274|NM_014143|3'UTR
   1 TCCAGCATTGGAACTTCTGATCTTCAAGCAGGGATTCTCAACCTGTGGTTTAGGGGTTCATCGGGGCTGAGCGTGACAAG
  81 AGGAAGGAATGGGCCCGTGGGATGCAGGCAATGTGGGACTTAAAAGGCCCAAGCACTGAAAATGGAACCTGGCGAAAGCA
 161 GAGGAGGAGAATGAAGAAAGATGGAGTCAAACAGGGAGCCTGGAGGGAGACCTTGATACTTTCAAATGCCTGAGGGGCTC
 241 ATCGACGCCTGTGACAGGGAGAAAGGATACTTCTGAACAAGGAGCCTCCAAGCAAATCATCCATTGCTCATCCTAGGAAG
 321 ACGGGTTGAGAATCCCTAATTTGAGGGTCAGTTCCTGCAGAAGTGCCCTTTGCCTCCACTCAATGCCTCAATTTGTTTTC
 401 TGCATGACTGAGAGTCTCAGTGTTGGAACGGGACAGTATTTATGTATGAGTTTTTCCTATTTATTTTGAGTCTGTGAGGT
 481 CTTCTTGTCATGTGAGTGTGGTTGTGAATGATTTCTTTTGAAGATATATTGTAGTAGATGTTACAATTTTGTCGCCAAAC
 561 TAAACTTGCTGCTTAATGATTTGCTCACATCTAGTAAAACATGGAGTATTTGTAAGGTGCTTGGTCTCCTCTATAACTAC
 641 AAGTATACATTGGAAGCATAAAGATCAAACCGTTGGTTGCATAGGATGTCACCTTTATTTAACCCATTAATACTCTGGTT
 721 GACCTAATCTTATTCTCAGACCTCAAGTGTCTGTGCAGTATCTGTTCCATTTAAATATCAGCTTTACAATTATGTGGTAG
 801 CCTACACACATAATCTCATTTCATCGCTGTAACCACCCTGTTGTGATAACCACTATTATTTTACCCATCGTACAGCTGAG
 881 GAAGCAAACAGATTAAGTAACTTGCCCAAACCAGTAAATAGCAGACCTCAGACTGCCACCCACTGTCCTTTTATAATACA
 961 ATTTACAGCTATATTTTACTTTAAGCAATTCTTTTATTCAAAAACCATTTATTAAGTGCCCTTGCAATATCAATCGCTGT
1041 GCCAGGCATTGAATCTACAGATGTGAGCAAGACAAAGTACCTGTCCTCAAGGAGCTCATAGTATAATGAGGAGATTAACA
1121 AGAAAATGTATTATTACAATTTAGTCCAGTGTCATAGCATAAGGATGATGCGAGGGGAAAACCCGAGCAGTGTTGCCAAG
1201 AGGAGGAAATAGGCCAATGTGGTCTGGGACGGTTGGATATACTTAAACATCTTAATAATCAGAGTAATTTTCATTTACAA
1281 AGAGAGGTCGGTACTTAAAATAACCCTGAAAAATAACACTGGAATTCCTTTTCTAGCATTATATTTATTCCTGATTTGCC
1361 TTTGCCATATAATCTAATGCTTGTTTATATAGTGTCTGGTATTGTTTAACAGTTCTGTCTTTTCTATTTAAATGCCACTA
1441 AATTTTAAATTCATACCTTTCCATGATTCAAAATTCAAAAGATCCCATGGGAGATGGTTGGAAAATCTCCACTTCATCCT
1521 CCAAGCCATTCAAGTTTCCTTTCCAGAAGCAACTGCTACTGCCTTTCATTCATATGTTCTTCTAAAGATAGTCTACATTT
1601 GGAAATGTATGTTAAAAGCACGTATTTTTAAAATTTTTTTCCTAAATAGTAACACATTGTATGTCTGCTGTGTACTTTGC
1681 TATTTTTATTTATTTTAGTGTTTCTTATATAGCAGATGGAATGAATTTGAAGTTCCCAGGGCTGAGGATCCATGCCTTCT
1761 TTGTTTCTAAGTTATCTTTCCCATAGCTTTTCATTATCTTTCATATGATCCAGTATATGTTAAATATGTCCTACATATAC
1841 ATTTAGACAACCACCATTTGTTAAGTATTTGCTCTAGGACAGAGTTTGGATTTGTTTATGTTTGCTCAAAAGGAGACCCA
1921 TGGGCTCTCCAGGGTGCACTGAGTCAATCTAGTCCTAAAAAGCAATCTTATTATTAACTCTGTATGACAGAATCATGTCT
2001 GGAACTTTTGTTTTCTGCTTTCTGTCAAGTATAAACTTCACTTTGATGCTGTACTTGCAAAATCACATTTTCTTTCTGGA
2081 AATTCCGGCAGTGTACCTTGACTGCTAGCTACCCTGTGCCAGAAAAGCCTCATTCGTTGTGCTTGAACCCTTGAATGCCA
2161 CCAGCTGTCATCACTACACAGCCCTCCTAAGAGGCTTCCTGGAGGTTTCGAGATTCAGATGCCCTGGGAGATCCCAGAGT
2241 TTCCTTTCCCTCTTGGCCATATTCTGGTGTCAATGACAAGGAGTACCTTGGCTTTGCCACATGTCAAGGCTGAAGAAACA
2321 GTGTCTCCAACAGAGCTCCTTGTGTTATCTGTTTGTACATGTGCATTTGTACAGTAATTGGTGTGACAGTGTTCTTTGTG
2401 TGAATTACAGGCAAGAATTGTGGCTGAGCAAGGCACATAGTCTACTCAGTCTATTCCTAAGTCCTAACTCCTCCTTGTGG
2481 TGTTGGATTTGTAAGGCACTTTATCCCTTTTGTCTCATGTTTCATCGTAAATGGCATAGGCAGAGATGATACCTAATTCT
2561 GCATTTGATTGTCACTTTTTGTACCTGCATTAATTTAATAAAATATTCTTATTTATTTTGTTACTTGGTACACCAGCATG
2641 TCCATTTTCTTGTTTATTTTGTGTTTAATAAAATGTTCAGTTTAACATCCCAGTGGAGAAAGTTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgUUUCCAUUAACG---ACAAAAGc 5'
            :|: ||::|||:   || |||| 
Target 5' gtGAGTGTGGTTGTGAATGATTTCt 3'
 492 - 516 128.00 -7.20
2 
miRNA  3' cgUUUCCAUUAACGACAAAAGc 5'
            |:|| |  ||| |||| || 
Target 5' acAGAGCTCCTTG-TGTTATCt 3'
 2330 - 2350 127.00 -6.60
3 
miRNA  3' cgUUUC---CAUUAACG---ACAAAAGc 5'
            |:||   | | |||:   ||||| | 
Target 5' acAGAGTTTGGATTTGTTTATGTTTGCt 3'
 1879 - 1906 120.00 -7.46
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31571240 5 COSMIC
COSN30462587 23 COSMIC
COSN30125257 29 COSMIC
COSN30492971 37 COSMIC
COSN30476975 38 COSMIC
COSN31597619 66 COSMIC
COSN22638311 73 COSMIC
COSN30132849 80 COSMIC
COSN21499091 88 COSMIC
COSN14993171 94 COSMIC
COSN30533042 97 COSMIC
COSN30618900 98 COSMIC
COSN30487250 139 COSMIC
COSN30123890 155 COSMIC
COSN28639906 184 COSMIC
COSN31554083 250 COSMIC
COSN31600725 266 COSMIC
COSN16522725 1037 COSMIC
COSN31639731 1502 COSMIC
COSN31963021 1785 COSMIC
COSN2324376 2037 COSMIC
COSN32116751 2101 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753268632 2 dbSNP
rs1470624510 3 dbSNP
rs1372720187 5 dbSNP
rs1013874454 6 dbSNP
rs1359819369 7 dbSNP
rs376113864 9 dbSNP
rs778322845 10 dbSNP
rs1471031377 12 dbSNP
rs1337901152 14 dbSNP
rs746654780 22 dbSNP
rs1397610311 25 dbSNP
rs766808550 26 dbSNP
rs1394610895 28 dbSNP
rs1051119114 29 dbSNP
rs1336764495 33 dbSNP
rs1227393361 34 dbSNP
rs757029166 40 dbSNP
rs959530917 42 dbSNP
rs990973990 43 dbSNP
rs1223594510 44 dbSNP
rs183332896 48 dbSNP
rs745310222 49 dbSNP
rs918158640 54 dbSNP
rs545954644 57 dbSNP
rs533751835 60 dbSNP
rs1217609539 63 dbSNP
rs148242519 64 dbSNP
rs1234366319 67 dbSNP
rs376683967 69 dbSNP
rs369067104 74 dbSNP
rs1245920116 76 dbSNP
rs1237820071 79 dbSNP
rs377574019 80 dbSNP
rs550004054 83 dbSNP
rs1252305605 88 dbSNP
rs2297136 94 dbSNP
rs1159853990 95 dbSNP
rs1003581089 97 dbSNP
rs529189013 98 dbSNP
rs959102664 100 dbSNP
rs990608223 108 dbSNP
rs900275355 112 dbSNP
rs765751290 113 dbSNP
rs995996946 116 dbSNP
rs1474136558 118 dbSNP
rs547640143 128 dbSNP
rs1211456039 131 dbSNP
rs972937408 145 dbSNP
rs1486624198 146 dbSNP
rs199655889 148 dbSNP
rs565966694 149 dbSNP
rs934261006 154 dbSNP
rs890355239 155 dbSNP
rs1280990101 157 dbSNP
rs1051499556 159 dbSNP
rs1355272813 162 dbSNP
rs1294320295 166 dbSNP
rs911263617 167 dbSNP
rs1317642869 171 dbSNP
rs1021340702 177 dbSNP
rs942772746 181 dbSNP
rs1054499837 187 dbSNP
rs1434367623 193 dbSNP
rs966728864 199 dbSNP
rs1001314041 206 dbSNP
rs1459647425 216 dbSNP
rs868859721 218 dbSNP
rs549937238 220 dbSNP
rs1374188148 222 dbSNP
rs1476109954 228 dbSNP
rs959479467 229 dbSNP
rs1191832919 236 dbSNP
rs1011133239 239 dbSNP
rs1211396287 241 dbSNP
rs375319468 244 dbSNP
rs866049770 245 dbSNP
rs569820304 247 dbSNP
rs902394487 248 dbSNP
rs1003497036 255 dbSNP
rs1316588860 256 dbSNP
rs1431543028 259 dbSNP
rs983711716 266 dbSNP
rs1321694682 272 dbSNP
rs537110438 276 dbSNP
rs908157891 284 dbSNP
rs1272460044 286 dbSNP
rs1034681337 287 dbSNP
rs1395501359 288 dbSNP
rs141270479 294 dbSNP
rs1011988787 302 dbSNP
rs1183311782 314 dbSNP
rs1164330183 323 dbSNP
rs753140219 324 dbSNP
rs1167308212 334 dbSNP
rs756815395 342 dbSNP
rs962468816 346 dbSNP
rs931737273 348 dbSNP
rs1467698038 354 dbSNP
rs1253310464 359 dbSNP
rs1306171877 364 dbSNP
rs1272882633 366 dbSNP
rs574151452 373 dbSNP
rs766911237 378 dbSNP
rs750128140 380 dbSNP
rs535035606 382 dbSNP
rs890304330 384 dbSNP
rs1371986747 388 dbSNP
rs1328233678 389 dbSNP
rs755749848 390 dbSNP
rs1463329344 393 dbSNP
rs4143815 396 dbSNP
rs911211198 401 dbSNP
rs572112954 405 dbSNP
rs1410401712 408 dbSNP
rs1041634762 419 dbSNP
rs942677374 421 dbSNP
rs753697474 430 dbSNP
rs116745298 431 dbSNP
rs914620254 432 dbSNP
rs1032319869 444 dbSNP
rs1286675417 445 dbSNP
rs1357665992 446 dbSNP
rs946160297 447 dbSNP
rs564023546 448 dbSNP
rs902382662 451 dbSNP
rs1012291763 452 dbSNP
rs939247208 457 dbSNP
rs1210227387 458 dbSNP
rs1025047950 461 dbSNP
rs754753538 464 dbSNP
rs1292492741 469 dbSNP
rs1354037014 471 dbSNP
rs1056422938 479 dbSNP
rs779059109 492 dbSNP
rs1278665104 493 dbSNP
rs1442737569 497 dbSNP
rs868048588 501 dbSNP
rs576213375 502 dbSNP
rs377388108 503 dbSNP
rs1202482724 505 dbSNP
rs1375478826 512 dbSNP
rs543507323 514 dbSNP
rs771467926 524 dbSNP
rs777685490 528 dbSNP
rs1330879859 530 dbSNP
rs1001549225 545 dbSNP
rs187283638 546 dbSNP
rs1255991560 547 dbSNP
rs1336272816 554 dbSNP
rs747072883 555 dbSNP
rs921600696 559 dbSNP
rs529061712 569 dbSNP
rs547407034 572 dbSNP
rs1316548684 578 dbSNP
rs191895043 579 dbSNP
rs964266696 580 dbSNP
rs1285287165 585 dbSNP
rs771083860 588 dbSNP
rs533015171 590 dbSNP
rs1224106631 602 dbSNP
rs370574346 603 dbSNP
rs146262113 605 dbSNP
rs569683062 607 dbSNP
rs945885152 611 dbSNP
rs1409440394 612 dbSNP
rs977556635 617 dbSNP
rs1306312546 623 dbSNP
rs1282192679 625 dbSNP
rs760314519 626 dbSNP
rs182814456 634 dbSNP
rs1415582614 635 dbSNP
rs556676761 636 dbSNP
rs1338426757 639 dbSNP
rs1416084043 641 dbSNP
rs1187701716 645 dbSNP
rs567799925 649 dbSNP
rs935940541 651 dbSNP
rs1260307674 657 dbSNP
rs1229351619 659 dbSNP
rs1184839366 660 dbSNP
rs1270695473 671 dbSNP
rs1485610998 672 dbSNP
rs188235000 673 dbSNP
rs138135676 674 dbSNP
rs1332990575 677 dbSNP
rs1270975651 689 dbSNP
rs770143095 692 dbSNP
rs1038031206 696 dbSNP
rs1335379051 698 dbSNP
rs776021510 702 dbSNP
rs1379997770 705 dbSNP
rs576576820 707 dbSNP
rs1288968126 708 dbSNP
rs994312106 712 dbSNP
rs1005021854 715 dbSNP
rs1164650352 718 dbSNP
rs1462344474 725 dbSNP
rs1420619004 726 dbSNP
rs1169008028 737 dbSNP
rs1428476520 748 dbSNP
rs578250681 754 dbSNP
rs141907112 755 dbSNP
rs1008313117 761 dbSNP
rs1467307816 765 dbSNP
rs973660052 766 dbSNP
rs763415855 771 dbSNP
rs1029283375 776 dbSNP
rs1468780320 781 dbSNP
rs41280723 786 dbSNP
rs192793526 788 dbSNP
rs1225085283 790 dbSNP
rs990401843 793 dbSNP
rs1295587296 798 dbSNP
rs1022025658 806 dbSNP
rs967433470 810 dbSNP
rs945802545 826 dbSNP
rs565795807 827 dbSNP
rs977837189 835 dbSNP
rs925784261 838 dbSNP
rs1461870482 844 dbSNP
rs184360875 847 dbSNP
rs1374146309 856 dbSNP
rs928712878 863 dbSNP
rs1452711882 868 dbSNP
rs960400081 869 dbSNP
rs776586431 870 dbSNP
rs186914186 871 dbSNP
rs1055634341 874 dbSNP
rs1269126052 882 dbSNP
rs1480263547 895 dbSNP
rs765952534 897 dbSNP
rs894418553 898 dbSNP
rs1318769325 903 dbSNP
rs1038325969 904 dbSNP
rs1234509686 908 dbSNP
rs919853270 914 dbSNP
rs561827341 922 dbSNP
rs541213585 925 dbSNP
rs1397807023 933 dbSNP
rs1310428788 940 dbSNP
rs1433433874 941 dbSNP
rs1374874864 942 dbSNP
rs1174351272 943 dbSNP
rs1046844111 944 dbSNP
rs572241274 947 dbSNP
rs1347887671 948 dbSNP
rs1233011455 951 dbSNP
rs1047175251 954 dbSNP
rs1352460977 960 dbSNP
rs890847662 962 dbSNP
rs1418339042 966 dbSNP
rs367673615 974 dbSNP
rs1007967502 975 dbSNP
rs1262818988 980 dbSNP
rs1464747543 986 dbSNP
rs559244638 987 dbSNP
rs1197020724 992 dbSNP
rs533075809 1002 dbSNP
rs1255452320 1007 dbSNP
rs1278920605 1008 dbSNP
rs551235993 1019 dbSNP
rs879588589 1025 dbSNP
rs563372752 1026 dbSNP
rs995044635 1036 dbSNP
rs1011769981 1037 dbSNP
rs1336684382 1039 dbSNP
rs192397580 1040 dbSNP
rs1376098380 1050 dbSNP
rs1355386589 1054 dbSNP
rs1021847474 1058 dbSNP
rs754878431 1064 dbSNP
rs184996177 1065 dbSNP
rs778829951 1071 dbSNP
rs1036106210 1072 dbSNP
rs1416295898 1077 dbSNP
rs1029231124 1081 dbSNP
rs1158256303 1082 dbSNP
rs541020125 1087 dbSNP
rs1161122196 1108 dbSNP
rs991609903 1109 dbSNP
rs1256803732 1112 dbSNP
rs916397649 1120 dbSNP
rs1259092280 1121 dbSNP
rs1204134556 1123 dbSNP
rs969183623 1127 dbSNP
rs974332314 1131 dbSNP
rs1371711177 1137 dbSNP
rs1385710996 1147 dbSNP
rs919817968 1148 dbSNP
rs1334748304 1149 dbSNP
rs1294495277 1151 dbSNP
rs929892629 1152 dbSNP
rs1324724291 1159 dbSNP
rs1046719528 1161 dbSNP
rs1382935693 1163 dbSNP
rs1391115332 1165 dbSNP
rs1322293911 1166 dbSNP
rs912255975 1167 dbSNP
rs1417036580 1168 dbSNP
rs943773099 1172 dbSNP
rs1039456785 1173 dbSNP
rs1465062862 1174 dbSNP
rs1328839573 1176 dbSNP
rs1249566974 1178 dbSNP
rs957181713 1181 dbSNP
rs899604155 1185 dbSNP
rs1275587754 1186 dbSNP
rs1230481119 1191 dbSNP
rs1469335016 1198 dbSNP
rs1338036734 1204 dbSNP
rs112445644 1210 dbSNP
rs1043618866 1214 dbSNP
rs1265293122 1215 dbSNP
rs752723892 1217 dbSNP
rs758300692 1218 dbSNP
rs188880293 1231 dbSNP
rs765308977 1232 dbSNP
rs1012936879 1237 dbSNP
rs1023033786 1239 dbSNP
rs1471479393 1240 dbSNP
rs1438869307 1244 dbSNP
rs564189967 1253 dbSNP
rs113029061 1254 dbSNP
rs1457310340 1259 dbSNP
rs1391601582 1260 dbSNP
rs1291738532 1261 dbSNP
rs375689198 1263 dbSNP
rs1391472129 1272 dbSNP
rs1027267540 1276 dbSNP
rs1453447442 1277 dbSNP
rs1247600334 1283 dbSNP
rs951327527 1290 dbSNP
rs571833216 1291 dbSNP
rs912217271 1292 dbSNP
rs1272994915 1296 dbSNP
rs943676932 1305 dbSNP
rs975066203 1311 dbSNP
rs1205931086 1314 dbSNP
rs539361136 1320 dbSNP
rs947146090 1333 dbSNP
rs1301367347 1334 dbSNP
rs1233767675 1339 dbSNP
rs1372004868 1340 dbSNP
rs1043220447 1344 dbSNP
rs1221398458 1349 dbSNP
rs903386934 1351 dbSNP
rs1438413219 1353 dbSNP
rs781463850 1359 dbSNP
rs746064465 1360 dbSNP
rs1481655837 1366 dbSNP
rs1196516865 1367 dbSNP
rs1057511459 1368 dbSNP
rs967443755 1380 dbSNP
rs1371819567 1381 dbSNP
rs1171218371 1384 dbSNP
rs1433647041 1390 dbSNP
rs182006040 1392 dbSNP
rs770179979 1418 dbSNP
rs1193275005 1422 dbSNP
rs1468969591 1425 dbSNP
rs1471755885 1427 dbSNP
rs1183473088 1429 dbSNP
rs998554261 1430 dbSNP
rs1278200263 1436 dbSNP
rs1032708362 1438 dbSNP
rs1012884497 1441 dbSNP
rs1312980229 1453 dbSNP
rs1281049408 1454 dbSNP
rs796460414 1457 dbSNP
rs1418246597 1467 dbSNP
rs1410300320 1470 dbSNP
rs991258478 1472 dbSNP
rs1310539027 1473 dbSNP
rs1413699012 1475 dbSNP
rs915747279 1480 dbSNP
rs775860169 1485 dbSNP
rs201324948 1490 dbSNP
rs763324924 1494 dbSNP
rs769054238 1502 dbSNP
rs971254294 1503 dbSNP
rs1162523484 1505 dbSNP
rs1026801874 1506 dbSNP
rs951320107 1510 dbSNP
rs1374793183 1513 dbSNP
rs1187282170 1519 dbSNP
rs1483640949 1526 dbSNP
rs1239314548 1533 dbSNP
rs981758242 1537 dbSNP
rs1316574041 1548 dbSNP
rs1462040171 1553 dbSNP
rs908495035 1554 dbSNP
rs982648981 1555 dbSNP
rs114579116 1563 dbSNP
rs1227215782 1567 dbSNP
rs1379213534 1574 dbSNP
rs965267241 1580 dbSNP
rs975014112 1590 dbSNP
rs920961038 1593 dbSNP
rs920650527 1597 dbSNP
rs1321624213 1598 dbSNP
rs947151735 1603 dbSNP
rs185359196 1606 dbSNP
rs760168795 1611 dbSNP
rs1416188293 1615 dbSNP
rs372328773 1619 dbSNP
rs1057324862 1622 dbSNP
rs1380260977 1623 dbSNP
rs1209100003 1626 dbSNP
rs555215327 1627 dbSNP
rs573692330 1632 dbSNP
rs1314243502 1634 dbSNP
rs944929924 1634 dbSNP
rs1044415425 1636 dbSNP
rs1329944 1643 dbSNP
rs1363978572 1644 dbSNP
rs899187950 1646 dbSNP
rs1436866392 1648 dbSNP
rs1392671075 1649 dbSNP
rs1293326030 1653 dbSNP
rs1229190468 1657 dbSNP
rs903461539 1659 dbSNP
rs1428047301 1663 dbSNP
rs1390985636 1667 dbSNP
rs1190711475 1668 dbSNP
rs998896906 1673 dbSNP
rs1032656043 1674 dbSNP
rs1209089461 1676 dbSNP
rs994918916 1679 dbSNP
rs1026789132 1689 dbSNP
rs368481749 1693 dbSNP
rs1201783218 1697 dbSNP
rs1213217144 1700 dbSNP
rs1004412898 1706 dbSNP
rs1019413774 1707 dbSNP
rs1482805280 1708 dbSNP
rs1179964006 1709 dbSNP
rs965257255 1710 dbSNP
rs996756739 1717 dbSNP
rs139324756 1720 dbSNP
rs540737705 1727 dbSNP
rs1301016979 1736 dbSNP
rs1263739185 1737 dbSNP
rs1387770121 1738 dbSNP
rs753594251 1742 dbSNP
rs968816826 1751 dbSNP
rs1429709507 1754 dbSNP
rs978462928 1763 dbSNP
rs924318098 1764 dbSNP
rs1170569160 1771 dbSNP
rs775658856 1773 dbSNP
rs1433086048 1776 dbSNP
rs763153496 1779 dbSNP
rs41280725 1793 dbSNP
rs7864231 1808 dbSNP
rs917463563 1811 dbSNP
rs544937097 1814 dbSNP
rs1274649564 1815 dbSNP
rs1301497878 1818 dbSNP
rs1206767659 1828 dbSNP
rs1345282203 1839 dbSNP
rs910660811 1840 dbSNP
rs1234384767 1857 dbSNP
rs563233568 1858 dbSNP
rs1314268320 1867 dbSNP
rs1364561281 1868 dbSNP
rs752564466 1880 dbSNP
rs1409691152 1890 dbSNP
rs1351717070 1894 dbSNP
rs1309916565 1896 dbSNP
rs1297528365 1901 dbSNP
rs1401725503 1914 dbSNP
rs1173332363 1922 dbSNP
rs1340060014 1931 dbSNP
rs758156152 1939 dbSNP
rs903408445 1941 dbSNP
rs920870529 1954 dbSNP
rs763945987 1963 dbSNP
rs530856538 1964 dbSNP
rs189764996 1965 dbSNP
rs561085510 1967 dbSNP
rs1207725348 1968 dbSNP
rs892796654 1968 dbSNP
rs1243579426 1969 dbSNP
rs937547036 1969 dbSNP
rs751514769 1974 dbSNP
rs906981256 1979 dbSNP
rs181416067 1985 dbSNP
rs1246183804 1990 dbSNP
rs757343429 1991 dbSNP
rs546748860 1997 dbSNP
rs1339892541 2001 dbSNP
rs886489068 2003 dbSNP
rs1008970225 2009 dbSNP
rs1040851222 2012 dbSNP
rs1397934234 2017 dbSNP
rs148763762 2025 dbSNP
rs532735307 2029 dbSNP
rs1318284239 2040 dbSNP
rs996704446 2044 dbSNP
rs1028166230 2049 dbSNP
rs968668426 2054 dbSNP
rs551334791 2061 dbSNP
rs569565212 2086 dbSNP
rs1000236972 2087 dbSNP
rs1347260059 2088 dbSNP
rs910596373 2099 dbSNP
rs536495524 2106 dbSNP
rs1245863972 2108 dbSNP
rs976616089 2113 dbSNP
rs1465594887 2114 dbSNP
rs924811123 2119 dbSNP
rs1031372127 2129 dbSNP
rs781213353 2130 dbSNP
rs144841978 2136 dbSNP
rs562671937 2137 dbSNP
rs1324891827 2140 dbSNP
rs1297197444 2150 dbSNP
rs1436131407 2156 dbSNP
rs917409546 2157 dbSNP
rs1322318569 2158 dbSNP
rs1403472216 2165 dbSNP
rs1389995459 2168 dbSNP
rs1163307887 2175 dbSNP
rs1473516869 2182 dbSNP
rs1363722220 2185 dbSNP
rs1387816547 2192 dbSNP
rs1443170970 2197 dbSNP
rs970186364 2207 dbSNP
rs756348217 2210 dbSNP
rs567126229 2211 dbSNP
rs1291289587 2212 dbSNP
rs749617704 2215 dbSNP
rs1340094124 2244 dbSNP
rs202058485 2246 dbSNP
rs2297135 2247 dbSNP
rs1367627117 2269 dbSNP
rs1286610602 2280 dbSNP
rs1434089961 2284 dbSNP
rs1330415728 2289 dbSNP
rs1329595404 2292 dbSNP
rs1207937541 2302 dbSNP
rs1266141505 2303 dbSNP
rs1044054717 2312 dbSNP
rs1167417326 2317 dbSNP
rs1429992970 2317 dbSNP
rs1391698571 2318 dbSNP
rs907908854 2321 dbSNP
rs944772083 2328 dbSNP
rs774779026 2333 dbSNP
rs1469796900 2334 dbSNP
rs1040463162 2337 dbSNP
rs1477931029 2351 dbSNP
rs1247692829 2352 dbSNP
rs1201584216 2356 dbSNP
rs900606811 2360 dbSNP
rs184946616 2361 dbSNP
rs1245574122 2362 dbSNP
rs906925159 2364 dbSNP
rs10217310 2381 dbSNP
rs1344554613 2386 dbSNP
rs1049590700 2399 dbSNP
rs1178508649 2404 dbSNP
rs904432677 2409 dbSNP
rs1218894970 2412 dbSNP
rs1408351614 2420 dbSNP
rs1438435604 2424 dbSNP
rs866485009 2439 dbSNP
rs1348626136 2441 dbSNP
rs1473116341 2445 dbSNP
rs1031737770 2451 dbSNP
rs1409958713 2452 dbSNP
rs1387057498 2455 dbSNP
rs544802517 2455 dbSNP
rs1463441552 2457 dbSNP
rs1037241028 2461 dbSNP
rs1174685312 2464 dbSNP
rs1471894982 2467 dbSNP
rs891489824 2469 dbSNP
rs1235828427 2473 dbSNP
rs896981904 2479 dbSNP
rs751592921 2490 dbSNP
rs147946526 2495 dbSNP
rs188250020 2496 dbSNP
rs375119640 2501 dbSNP
rs1225175356 2502 dbSNP
rs1326970208 2517 dbSNP
rs1434484872 2525 dbSNP
rs980231790 2528 dbSNP
rs542521540 2532 dbSNP
rs770606452 2533 dbSNP
rs181739678 2537 dbSNP
rs1374820142 2542 dbSNP
rs531381033 2543 dbSNP
rs966489317 2544 dbSNP
rs1227520223 2549 dbSNP
rs1336545747 2554 dbSNP
rs976184805 2557 dbSNP
rs924729708 2560 dbSNP
rs1160490787 2570 dbSNP
rs1473865269 2571 dbSNP
rs983741321 2574 dbSNP
rs796447992 2582 dbSNP
rs990307887 2593 dbSNP
rs186306440 2595 dbSNP
rs548397926 2600 dbSNP
rs1210301068 2601 dbSNP
rs776313826 2606 dbSNP
rs1463348441 2621 dbSNP
rs948992864 2624 dbSNP
rs1318663693 2630 dbSNP
rs540762981 2633 dbSNP
rs1309951198 2635 dbSNP
rs4742098 2636 dbSNP
rs1316665857 2638 dbSNP
rs976071554 2642 dbSNP
rs1388289718 2650 dbSNP
rs1321648659 2654 dbSNP
rs527428339 2660 dbSNP
rs921988170 2660 dbSNP
rs932104771 2666 dbSNP
rs1050025121 2668 dbSNP
rs1348702605 2670 dbSNP
rs1482548331 2682 dbSNP
rs1406068512 2690 dbSNP
rs532800511 2693 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SGC7901
Disease gastric adenocarcinoma
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... a novel regulatory mechanism for CD274 overexpression in gastric cancer mediated by miR-570 and somatic mutation in CD274 3'UTR and provide a new insight to gastric carcinogenesis ...

- Wang W; Sun J; Li F; Li R; Gu Y; Liu C; et al., 2012, Human mutation.

Article - Wang W; Sun J; Li F; Li R; Gu Y; Liu C; et al.
- Human mutation, 2012
Inhibitory costimulatory molecule CD274 expresses in various cancers and contributes to cancer immune evasion by inhibiting T cell activation and proliferation, yet the regulatory mechanisms for CD274 overexpression in cancers are poorly understood. In this study, we discovered a novel mechanism of CD274 expression regulated by miR-570. A guanine-to-cytosine mutation at the 3'-UTR of CD274 mRNA led to CD274 overexpression by disrupting the miR-570 binding. The mutations were widely observed in cancers by sequencing of 276 gastrointestinal cancers (esophageal, gastric, colorectal, hepatocellular, and pancreatic cancers). This mutation was significantly associated with CD274 overexpression in gastric cancer (P = 1.44x10(-10)) and with the pathological features including differentiation grade, depth of tumor invasion, lymph node metastasis, and tumor-node-metastases (TNM) stage. These findings suggest a novel regulatory mechanism for CD274 overexpression in gastric cancer mediated by miR-570 and a somatic mutation in CD274 3'-UTR, and provide a new insight to gastric carcinogenesis.
LinkOut: [PMID: 22190470]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions SGC7901
Disease gastric cancer
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... SNP might be responsible for aberrrant B7-H1 protein expression in gastric cancer by distrrupting the interaction between miR-570 and B7-H1 mRNA ...

- Wang W; Li F; Mao Y; Zhou H; Sun J; Li R; et al., 2013, Human genetics.

Article - Wang W; Li F; Mao Y; Zhou H; Sun J; Li R; et al.
- Human genetics, 2013
Single nucleotide polymorphisms (SNPs) in putative microRNA (miRNA) target sites (miRSNPs) could affect the binding of miRNA with the target and contribute to the susceptibility of human cancers. However, the role of miRSNPs in gastric cancer susceptibility remains largely unknown. Since the over-expression of B7-H1 protein has been reported to be closely related to disease progression of gastric cancer, we investigated the possible role of miRSNPs at the 3'-untranslated region (3'-UTR) of B7-H1 in the risk of developing gastric cancer. In this association study on 205 gastric adenocarcinoma patients and 393 non-cancer controls, we found that the genotype distribution of a common C>G polymorphism (rs4143815) was significantly different between the cases and controls (P = 1.32 x 10(-8)). Compared with CC homozygotes, GG homozygotes and G allele carriers showed 3.73-fold (P = 2.98 x 10(-8)) and 1.85-fold (P = 0.002) increased risk of gastric adenocarcinoma, respectively. Stratified analyses indicated that variant genotypes had a strong association with the clinic-pathological features of gastric cancer including differentiation grade, depth of tumor infiltration, and tumor node metastasis (TNM) stage (P < 0.001). Luciferase reporter assay indicated that this SNP might be responsible for aberrant B7-H1 protein expression in gastric cancer by disrupting the interaction between miR-570 and B7-H1 mRNA. These results are consistent with our hypothesis and indicate that genetic polymorphisms influencing B7-H1 expression modify cancer susceptibility.
LinkOut: [PMID: 23430453]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.741 1.7e-5 -0.746 1.4e-5 24 Click to see details
GSE28260 Renal cortex and medulla 0.827 2.4e-4 0.780 8.3e-4 13 Click to see details
GSE21687 Ependynoma primary tumors -0.285 1.1e-2 -0.281 1.2e-2 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.923 1.3e-2 -0.700 9.4e-2 5 Click to see details
GSE32688 Pancreatic cancer -0.284 5.8e-2 -0.290 5.4e-2 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.267 9.8e-2 0.327 5.5e-2 25 Click to see details
GSE27834 Pluripotent stem cells -0.31 1.2e-1 -0.288 1.4e-1 16 Click to see details
GSE21849 B cell lymphoma -0.222 1.2e-1 -0.197 1.5e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.224 1.5e-1 -0.245 1.2e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.112 1.5e-1 0.144 8.8e-2 90 Click to see details
GSE38226 Liver fibrosis 0.217 1.7e-1 0.146 2.6e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.131 2.7e-1 -0.046 4.1e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.085 3.6e-1 0.060 4.0e-1 20 Click to see details
GSE17306 Multiple myeloma -0.014 4.6e-1 0.465 3.8e-4 49 Click to see details
GSE17306 Multiple myeloma -0.014 4.6e-1 0.465 3.8e-4 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CESC -0.999 0.01 -1.000 0.5 3 Click to see details
BRCA -0.339 0.04 -0.263 0.09 28 Click to see details
BLCA -0.635 0.05 -0.286 0.25 8 Click to see details
STAD 0.38 0.05 0.367 0.06 19 Click to see details
KICH 0.346 0.06 0.291 0.09 22 Click to see details
THCA 0.197 0.11 0.180 0.13 40 Click to see details
ESCA -0.506 0.12 -0.714 0.04 7 Click to see details
CHOL -0.459 0.15 -0.393 0.19 7 Click to see details
KIRP -0.196 0.17 -0.135 0.26 26 Click to see details
LIHC -0.144 0.17 -0.074 0.31 46 Click to see details
HNSC 0.158 0.22 0.116 0.29 26 Click to see details
PAAD 0.506 0.25 0.400 0.3 4 Click to see details
UCEC 0.149 0.29 0.118 0.33 16 Click to see details
PRAD -0.148 0.3 -0.050 0.43 15 Click to see details
LUSC -0.097 0.32 0.038 0.43 25 Click to see details
KIRC -0.058 0.38 -0.046 0.4 32 Click to see details
KIRC -0.058 0.38 -0.046 0.4 32 Click to see details
KIRC -0.058 0.38 -0.046 0.4 32 Click to see details
166 hsa-miR-570-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053484 CD274 CD274 molecule 2 2
MIRT056153 OTUD1 OTU deubiquitinase 1 2 2
MIRT057406 TNKS2 tankyrase 2 2 2
MIRT065096 SLC38A1 solute carrier family 38 member 1 2 2
MIRT073901 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 8
MIRT074322 TNRC6A trinucleotide repeat containing 6A 2 8
MIRT077514 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT082532 CALM3 calmodulin 3 2 2
MIRT084575 BCL2L11 BCL2 like 11 2 4
MIRT092028 ABHD5 abhydrolase domain containing 5 2 6
MIRT099121 MYLIP myosin regulatory light chain interacting protein 2 8
MIRT102992 RBM33 RNA binding motif protein 33 2 8
MIRT105434 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT109568 KLHL15 kelch like family member 15 2 2
MIRT145281 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT150161 MIDN midnolin 2 2
MIRT167432 TRIP13 thyroid hormone receptor interactor 13 2 2
MIRT168486 HSPA1B heat shock protein family A (Hsp70) member 1B 2 4
MIRT172128 KLF10 Kruppel like factor 10 4 2
MIRT215596 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT259928 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT274852 ATXN7L3B ataxin 7 like 3B 2 4
MIRT290491 C18ORF25 chromosome 18 open reading frame 25 2 2
MIRT290941 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 4
MIRT322703 BAG4 BCL2 associated athanogene 4 2 2
MIRT358568 CANX calnexin 2 2
MIRT381250 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT442077 NDRG1 N-myc downstream regulated 1 2 2
MIRT442943 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT444267 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT444365 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT444863 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT444871 ISPD isoprenoid synthase domain containing 2 2
MIRT445077 CXXC4 CXXC finger protein 4 2 2
MIRT445717 NAP1L6 nucleosome assembly protein 1 like 6 2 2
MIRT445945 SCML4 Scm polycomb group protein like 4 2 2
MIRT446054 NR5A2 nuclear receptor subfamily 5 group A member 2 2 2
MIRT446704 FUT10 fucosyltransferase 10 2 2
MIRT446726 SPAG11A sperm associated antigen 11A 2 2
MIRT447147 HHIP hedgehog interacting protein 2 2
MIRT447566 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT448698 KLRC4 killer cell lectin like receptor C4 2 2
MIRT448778 GNA13 G protein subunit alpha 13 2 2
MIRT449290 GMNC geminin coiled-coil domain containing 2 2
MIRT449673 SOX3 SRY-box 3 2 2
MIRT450020 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT450089 OR2A4 olfactory receptor family 2 subfamily A member 4 2 2
MIRT450209 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT450271 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450402 TMEM47 transmembrane protein 47 2 2
MIRT450419 BCL2L14 BCL2 like 14 2 2
MIRT450598 EXOC2 exocyst complex component 2 2 2
MIRT450821 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT453007 CCDC115 coiled-coil domain containing 115 2 17
MIRT453857 ZNF12 zinc finger protein 12 2 2
MIRT454706 HMGN1 high mobility group nucleosome binding domain 1 2 4
MIRT458699 LEPREL1 prolyl 3-hydroxylase 2 1 1
MIRT465144 TSC22D2 TSC22 domain family member 2 2 2
MIRT468216 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469657 RAC1 Rac family small GTPase 1 2 2
MIRT470155 PSME3 proteasome activator subunit 3 2 2
MIRT470287 PRDX5 peroxiredoxin 5 2 2
MIRT470296 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT472433 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT472459 NASP nuclear autoantigenic sperm protein 2 2
MIRT475265 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 2
MIRT476735 FOXN2 forkhead box N2 2 2
MIRT476757 FOXK1 forkhead box K1 2 2
MIRT477549 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT478797 CRTAP cartilage associated protein 2 4
MIRT479661 CD164 CD164 molecule 2 4
MIRT479893 CCDC117 coiled-coil domain containing 117 2 4
MIRT480325 C5orf51 chromosome 5 open reading frame 51 2 2
MIRT481229 ATXN7L3 ataxin 7 like 3 2 2
MIRT484088 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT487507 GRK5 G protein-coupled receptor kinase 5 2 2
MIRT488356 PAX2 paired box 2 2 2
MIRT496746 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT496832 ZNF460 zinc finger protein 460 2 2
MIRT500913 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT502256 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT504078 C9orf40 chromosome 9 open reading frame 40 2 6
MIRT504890 MRPL51 mitochondrial ribosomal protein L51 2 4
MIRT509834 TACR3 tachykinin receptor 3 2 4
MIRT511989 E2F8 E2F transcription factor 8 2 4
MIRT524543 CDC5L cell division cycle 5 like 2 4
MIRT526673 ZNF791 zinc finger protein 791 2 2
MIRT527410 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT528393 PGK1 phosphoglycerate kinase 1 2 2
MIRT529318 PDE5A phosphodiesterase 5A 2 2
MIRT529844 SMTN smoothelin 2 2
MIRT531461 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT535096 PODXL podocalyxin like 2 2
MIRT535294 PHF6 PHD finger protein 6 2 2
MIRT537542 ETS1 ETS proto-oncogene 1, transcription factor 2 2
MIRT540200 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT543416 C5orf42 chromosome 5 open reading frame 42 2 2
MIRT543873 SLC16A9 solute carrier family 16 member 9 2 2
MIRT544393 SMC5 structural maintenance of chromosomes 5 2 2
MIRT544919 MBLAC2 metallo-beta-lactamase domain containing 2 2 2
MIRT546579 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT548834 CHD1 chromodomain helicase DNA binding protein 1 2 4
MIRT550787 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT553434 TPM3 tropomyosin 3 2 2
MIRT557467 GRB10 growth factor receptor bound protein 10 2 4
MIRT558065 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT558258 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT559205 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT561072 SRRM4 serine/arginine repetitive matrix 4 2 2
MIRT561805 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT563875 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT565835 SCML2 Scm polycomb group protein like 2 2 2
MIRT568049 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT572820 MYO1C myosin IC 2 2
MIRT575423 Epg5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 2 4
MIRT576435 Ccdc115 coiled-coil domain containing 115 2 10
MIRT576533 Txlna taxilin alpha 2 2
MIRT611715 EPG5 ectopic P-granules autophagy protein 5 homolog 2 5
MIRT612574 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 2 2
MIRT613945 IFIT3 interferon induced protein with tetratricopeptide repeats 3 2 2
MIRT614279 WSCD2 WSC domain containing 2 2 2
MIRT615194 CLUAP1 clusterin associated protein 1 2 2
MIRT627995 MTA3 metastasis associated 1 family member 3 2 2
MIRT637069 DENND2C DENN domain containing 2C 2 2
MIRT639912 SLIT1 slit guidance ligand 1 2 2
MIRT642026 MYADM myeloid associated differentiation marker 2 2
MIRT642844 SLC5A8 solute carrier family 5 member 8 2 2
MIRT643706 ZNF736 zinc finger protein 736 2 2
MIRT643835 RBMY1J RNA binding motif protein, Y-linked, family 1, member J 2 2
MIRT644775 RBMY1B RNA binding motif protein, Y-linked, family 1, member B 2 2
MIRT644778 RBMY1A1 RNA binding motif protein, Y-linked, family 1, member A1 2 2
MIRT644781 RBMY1D RNA binding motif protein, Y-linked, family 1, member D 2 2
MIRT644784 RBMY1E RNA binding motif protein, Y-linked, family 1, member E 2 2
MIRT647495 ZNF639 zinc finger protein 639 2 2
MIRT648248 RBMY1F RNA binding motif protein, Y-linked, family 1, member F 2 2
MIRT648633 LEMD2 LEM domain containing 2 2 2
MIRT654626 PTGFR prostaglandin F receptor 2 2
MIRT656345 MED28 mediator complex subunit 28 2 2
MIRT657354 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT659635 CDKN2AIP CDKN2A interacting protein 2 2
MIRT659651 CDH4 cadherin 4 2 2
MIRT660959 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT664139 ATP6V1G3 ATPase H+ transporting V1 subunit G3 2 2
MIRT666038 STRBP spermatid perinuclear RNA binding protein 2 2
MIRT666200 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 2 2
MIRT681712 GDF6 growth differentiation factor 6 2 2
MIRT683276 ZNF99 zinc finger protein 99 2 2
MIRT690312 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT691642 SLC43A3 solute carrier family 43 member 3 2 2
MIRT692270 GPR157 G protein-coupled receptor 157 2 2
MIRT692840 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT697820 UBQLN1 ubiquilin 1 2 2
MIRT698248 TMEM2 transmembrane protein 2 2 2
MIRT702755 IGF1R insulin like growth factor 1 receptor 2 2
MIRT702918 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703411 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704857 CD46 CD46 molecule 2 2
MIRT711066 BTD biotinidase 2 2
MIRT717794 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT719676 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720300 DDHD1 DDHD domain containing 1 2 2
MIRT723496 WDR33 WD repeat domain 33 2 2
MIRT723934 SVOP SV2 related protein 2 2
MIRT735586 FUT8 fucosyltransferase 8 2 0
MIRT735935 EYA3 EYA transcriptional coactivator and phosphatase 3 3 0
MIRT756075 HDAC1 histone deacetylase 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-570 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-570 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Quantitative real-time PCR gastric cancer AGS cell lines 21960261 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-570-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-570-3p Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-570-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-570-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-570-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-570-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-570-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-570-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-570-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-570-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-570-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-570-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-570-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-570-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission