miRTarBase - #MIRT054211


—
pre-miRNA Information
pre-miRNA hsa-mir-147a   
Genomic Coordinates chr9: 120244979 - 120245050
Description Homo sapiens miR-147a stem-loop
Comment Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue (supplementary information) and represented here. The expression of miR-147 has not been verified in human.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-147a
Sequence 47| GUGUGUGGAAAUGCUUCUGC |66
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1288578238 2 dbSNP
rs768706293 4 dbSNP
rs747256852 5 dbSNP
rs776160818 8 dbSNP
rs780204135 13 dbSNP
rs1320197794 16 dbSNP
rs767246164 17 dbSNP
Putative Targets

Gene Information
Gene Symbol MCM3   
Synonyms HCC5, P1-MCM3, P1.h, RLFB
Description minichromosome maintenance complex component 3
Transcript NM_002388   
Expression
Putative miRNA Targets on MCM3
3'UTR of MCM3
(miRNA target sites are highlighted)		 
>MCM3|NM_002388|3'UTR
   1 GGAGGCCTCGTCTCTGAACTTGGGTTGTGCCGAGAGAGTTTGTTCTGTGTTTCCCACCCTCTCCCTGACCCAAGTCTTTG
  81 CCTCTACTCCCTTAACAGTGTTGAATTCAACTGAAGGCGAGGAATGTTGGTGATGAAGCTGAGTTCAGGACTCGGTGGAC
 161 CCTTTGGGAATGGGTCATGAAAGCTGCCATGGGGTGAGGAAAGAGGAGACAGTGGGAGAGGACAATGACTATTGCATCTT
 241 CATTGCAAAAGCACTGGCTCATCCGCCCTACTTCCCATCCCACACAAACCCAATTGTAAATAACATATGACTTCTGAGTA
 321 CTTTTGGGGGCACAACTGTTTTCTGTTTGCTGTTTTTTTGTTTTGTTTTTTTTCTCCAGAGCACTTTGGTCTAGACTAGG
 401 CTTTGGGTGGTTCCAATTGGTGGAGAGAAGCTCTGAGGCACGTCATGCAGGTCAAGAAAGCTTTCTTTGCAGTAGCACCA
 481 GTTAAGGTGAATATGTATTGTATCACAAAACAAACCCAATATCCAGATGAATATCCGAGATGTTGAATAAACTTAGCCAT
 561 TTCGTACACATGGTAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgucuucGUAAAGGUGUGUg 5'
                 || | ||||||| 
Target 5' tacttccCA-TCCCACACAa 3'
 269 - 287 144.00 -10.60
2 
miRNA  3' cgucUUCGUAAAG-GUGUGUg 5'
              |: |||||| :||||| 
Target 5' acttAGCCATTTCGTACACAt 3'
 551 - 571 120.00 -13.30
3 
miRNA  3' cgUCUUCGUAA-A-GGUGUGUg 5'
            | | |:||| | :|||| | 
Target 5' gaATATGTATTGTATCACAAAa 3'
 489 - 510 106.00 -5.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30166090 32 COSMIC
COSN28867443 45 COSMIC
COSN30467956 54 COSMIC
COSN1334404 73 COSMIC
COSN26983969 82 COSMIC
COSN30162393 84 COSMIC
COSN30514365 118 COSMIC
COSN9797030 162 COSMIC
COSN31959996 464 COSMIC
COSN21185314 504 COSMIC
COSN2166201 551 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751328965 2 dbSNP
rs766055664 4 dbSNP
rs11550934 5 dbSNP
rs537207438 9 dbSNP
rs200538750 10 dbSNP
rs1351995473 11 dbSNP
rs765042812 11 dbSNP
rs373619065 12 dbSNP
rs772594151 14 dbSNP
rs202189515 19 dbSNP
rs759933577 21 dbSNP
rs774972855 24 dbSNP
rs369394839 31 dbSNP
rs1440115180 39 dbSNP
rs777906188 45 dbSNP
rs759416453 47 dbSNP
rs770015696 47 dbSNP
rs748174709 51 dbSNP
rs951294926 51 dbSNP
rs1425406968 58 dbSNP
rs1434751947 63 dbSNP
rs532598109 64 dbSNP
rs1321302037 69 dbSNP
rs1430350593 70 dbSNP
rs1025974385 72 dbSNP
rs1363821444 81 dbSNP
rs1343975301 87 dbSNP
rs1158971556 93 dbSNP
rs539131285 99 dbSNP
rs1369985872 110 dbSNP
rs1427673762 118 dbSNP
rs898146237 123 dbSNP
rs1049697166 129 dbSNP
rs1006563883 130 dbSNP
rs1231301253 132 dbSNP
rs1290181693 133 dbSNP
rs1489666935 139 dbSNP
rs1453420694 141 dbSNP
rs932061358 142 dbSNP
rs922023486 153 dbSNP
rs749650846 154 dbSNP
rs1184348229 155 dbSNP
rs1241485056 161 dbSNP
rs944687330 162 dbSNP
rs1449803088 171 dbSNP
rs17246640 177 dbSNP
rs1383276632 180 dbSNP
rs34942251 183 dbSNP
rs550245367 185 dbSNP
rs988694851 194 dbSNP
rs957520693 208 dbSNP
rs1313794020 212 dbSNP
rs1428902044 217 dbSNP
rs1288471572 230 dbSNP
rs1366428651 231 dbSNP
rs1437698111 233 dbSNP
rs925788158 235 dbSNP
rs770280946 236 dbSNP
rs969943869 239 dbSNP
rs546932296 243 dbSNP
rs17246647 251 dbSNP
rs924258455 257 dbSNP
rs530063598 264 dbSNP
rs1023987750 265 dbSNP
rs1359923878 267 dbSNP
rs1465217756 272 dbSNP
rs1013996301 274 dbSNP
rs1190251788 283 dbSNP
rs567914270 293 dbSNP
rs1449381624 294 dbSNP
rs1361332870 301 dbSNP
rs1172170746 304 dbSNP
rs1182316384 305 dbSNP
rs1434435749 306 dbSNP
rs1390436999 309 dbSNP
rs1398994556 311 dbSNP
rs752578459 314 dbSNP
rs1389640787 326 dbSNP
rs1459219259 329 dbSNP
rs530060707 330 dbSNP
rs17246654 332 dbSNP
rs939377535 335 dbSNP
rs185438475 338 dbSNP
rs1449431424 349 dbSNP
rs2307319 349 dbSNP
rs1380759976 357 dbSNP
rs1221548202 360 dbSNP
rs377562501 360 dbSNP
rs2307321 364 dbSNP
rs1484195641 366 dbSNP
rs796360948 366 dbSNP
rs1255240611 373 dbSNP
rs17240273 374 dbSNP
rs545238636 374 dbSNP
rs981330718 374 dbSNP
rs1210132479 376 dbSNP
rs1209920701 393 dbSNP
rs1483238794 400 dbSNP
rs528137013 403 dbSNP
rs996731212 410 dbSNP
rs754987042 416 dbSNP
rs559189578 417 dbSNP
rs193038730 425 dbSNP
rs1412717826 429 dbSNP
rs1228898447 430 dbSNP
rs1803760 438 dbSNP
rs573569841 441 dbSNP
rs149130277 442 dbSNP
rs1174489386 465 dbSNP
rs1357932664 469 dbSNP
rs891763618 488 dbSNP
rs1415368716 493 dbSNP
rs890914570 495 dbSNP
rs1353251014 499 dbSNP
rs1053129628 501 dbSNP
rs1029825701 504 dbSNP
rs1311550263 506 dbSNP
rs747139456 508 dbSNP
rs145254762 518 dbSNP
rs1371534532 521 dbSNP
rs925851958 529 dbSNP
rs1309529395 534 dbSNP
rs543718234 536 dbSNP
rs1353491444 537 dbSNP
rs1344101048 541 dbSNP
rs1164875824 554 dbSNP
rs189560122 557 dbSNP
rs948556033 558 dbSNP
rs1280734681 559 dbSNP
rs1424995416 563 dbSNP
rs1204286732 564 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions A549
Location of target site 3'UTR
Tools used in this research MicroCosm , TargetScan
Original Description (Extracted from the article) ... "Interestingly ...

- Bertero T; Grosso S; Robbe-Sermesant K; et al., 2012, PloS one.

Article - Bertero T; Grosso S; Robbe-Sermesant K; et al.
- PloS one, 2012
Specificity of interaction between a microRNA (miRNA) and its targets crucially depends on the seed region located in its 5'-end. It is often implicitly considered that two miRNAs sharing the same biological activity should display similarity beyond the strict six nucleotide region that forms the seed, in order to form specific complexes with the same mRNA targets. We have found that expression of hsa-miR-147b and hsa-miR-210, though triggered by different stimuli (i.e. lipopolysaccharides and hypoxia, respectively), induce very similar cellular effects in term of proliferation, migration and apoptosis. Hsa-miR-147b only shares a "minimal" 6-nucleotides seed sequence with hsa-miR-210, but is identical with hsa-miR-147a over 20 nucleotides, except for one base located in the seed region. Phenotypic changes induced after heterologous expression of miR-147a strikingly differ from those induced by miR-147b or miR-210. In particular, miR-147a behaves as a potent inhibitor of cell proliferation and migration. These data fit well with the gene expression profiles observed for miR-147b and miR-210, which are very similar, and the gene expression profile of miR-147a, which is distinct from the two others. Bioinformatics analysis of all human miRNA sequences indicates multiple cases of miRNAs from distinct families exhibiting the same kind of similarity that would need to be further characterized in terms of putative functional redundancy. Besides, it implies that functional impact of some miRNAs can be masked by robust expression of miRNAs belonging to distinct families.
LinkOut: [PMID: 23028679]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
125 hsa-miR-147a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003810 VEGFA vascular endothelial growth factor A 2 1
MIRT005781 ACVR1C activin A receptor type 1C 1 1
MIRT054211 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054212 NDUFA4 NDUFA4, mitochondrial complex associated 4 1
MIRT054213 PSMA3 proteasome subunit alpha 3 4 1
MIRT071781 RNF11 ring finger protein 11 2 2
MIRT077109 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT079945 RNF138 ring finger protein 138 2 2
MIRT104233 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT123790 CDK6 cyclin dependent kinase 6 2 2
MIRT215380 CREBRF CREB3 regulatory factor 2 2
MIRT252677 ZNF529 zinc finger protein 529 2 2
MIRT284530 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT395624 TRIOBP TRIO and F-actin binding protein 2 2
MIRT437576 CYP2S1 cytochrome P450 family 2 subfamily S member 1 2 1
MIRT452106 IFITM1 interferon induced transmembrane protein 1 2 2
MIRT457802 KLHL25 kelch like family member 25 2 2
MIRT464136 VPS28 VPS28, ESCRT-I subunit 2 2
MIRT470218 PRRC2B proline rich coiled-coil 2B 2 2
MIRT478219 DDX52 DExD-box helicase 52 2 2
MIRT478986 COLGALT1 collagen beta(1-O)galactosyltransferase 1 2 2
MIRT479778 CCND1 cyclin D1 2 2
MIRT484477 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484979 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485017 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485035 TMEM189 transmembrane protein 189 2 8
MIRT485222 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT490144 TERF2IP TERF2 interacting protein 2 6
MIRT490352 DPYSL5 dihydropyrimidinase like 5 2 4
MIRT507385 EN2 engrailed homeobox 2 2 4
MIRT509796 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT511813 HDGF heparin binding growth factor 2 2
MIRT513876 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT522966 IPO5 importin 5 2 2
MIRT523883 EPHA5 EPH receptor A5 2 4
MIRT529236 PORCN porcupine O-acyltransferase 2 2
MIRT535336 PFN1 profilin 1 2 2
MIRT537694 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT538493 CLOCK clock circadian regulator 2 2
MIRT539138 ARHGAP35 Rho GTPase activating protein 35 2 2
MIRT541379 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT545017 PLP1 proteolipid protein 1 2 2
MIRT547733 KIF23 kinesin family member 23 2 4
MIRT549394 AKIRIN1 akirin 1 2 2
MIRT550371 MYLK3 myosin light chain kinase 3 2 2
MIRT551909 IGLON5 IgLON family member 5 2 2
MIRT552989 VAMP4 vesicle associated membrane protein 4 2 4
MIRT558237 EDA2R ectodysplasin A2 receptor 2 2
MIRT558919 CBX1 chromobox 1 2 2
MIRT559197 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT559510 ARID3B AT-rich interaction domain 3B 2 4
MIRT559610 AMER1 APC membrane recruitment protein 1 2 2
MIRT559768 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 4
MIRT565855 NHS NHS actin remodeling regulator 2 2
MIRT569043 ZNF655 zinc finger protein 655 2 2
MIRT569153 SIGMAR1 sigma non-opioid intracellular receptor 1 2 2
MIRT569165 DMD dystrophin 2 2
MIRT569203 CASZ1 castor zinc finger 1 2 2
MIRT569263 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT569418 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT569430 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT569841 RGS5 regulator of G protein signaling 5 2 2
MIRT570231 NCAN neurocan 2 2
MIRT570518 SHH sonic hedgehog 2 2
MIRT575643 Mitf microphthalmia-associated transcription factor 2 3
MIRT576374 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 2 2
MIRT576387 Fhl2 four and a half LIM domains 2 2 3
MIRT576412 Pla2g16 phospholipase A2, group XVI 2 2
MIRT606871 CHST11 carbohydrate sulfotransferase 11 2 4
MIRT606922 CDK15 cyclin dependent kinase 15 2 2
MIRT607024 ZEB1 zinc finger E-box binding homeobox 1 2 2
MIRT607080 MITF melanogenesis associated transcription factor 2 3
MIRT607613 TMEM130 transmembrane protein 130 2 4
MIRT607621 VSNL1 visinin like 1 2 2
MIRT607768 HS6ST3 heparan sulfate 6-O-sulfotransferase 3 2 6
MIRT607880 SATB1 SATB homeobox 1 2 2
MIRT607940 SSX2 SSX family member 2 2 4
MIRT608011 CARNS1 carnosine synthase 1 2 4
MIRT608026 UBLCP1 ubiquitin like domain containing CTD phosphatase 1 2 2
MIRT608060 SSX2B SSX family member 2B 2 4
MIRT608123 TSC22D2 TSC22 domain family member 2 2 2
MIRT608130 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT608210 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT608554 SBK1 SH3 domain binding kinase 1 2 6
MIRT608584 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 2 4
MIRT608784 JAKMIP2 janus kinase and microtubule interacting protein 2 2 4
MIRT608790 CDH12 cadherin 12 2 2
MIRT608875 CNTF ciliary neurotrophic factor 2 6
MIRT608893 ZNF860 zinc finger protein 860 2 2
MIRT608911 NCDN neurochondrin 2 6
MIRT618020 ELFN1 extracellular leucine rich repeat and fibronectin type III domain containing 1 2 2
MIRT625225 RPSAP58 ribosomal protein SA pseudogene 58 2 4
MIRT627332 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT628095 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 2
MIRT628698 ZNF548 zinc finger protein 548 2 2
MIRT629279 UNC13A unc-13 homolog A 2 2
MIRT630656 POU2F1 POU class 2 homeobox 1 2 2
MIRT634981 TNFAIP8 TNF alpha induced protein 8 2 2
MIRT641500 STC2 stanniocalcin 2 2 2
MIRT643507 ZNF28 zinc finger protein 28 2 2
MIRT646369 SLC22A6 solute carrier family 22 member 6 2 2
MIRT653985 SEMA6A semaphorin 6A 2 2
MIRT660037 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT663223 PPY pancreatic polypeptide 2 2
MIRT683701 GFRA1 GDNF family receptor alpha 1 2 2
MIRT683921 SLC43A3 solute carrier family 43 member 3 2 2
MIRT684100 LHFP LHFPL tetraspan subfamily member 6 2 2
MIRT684223 FGF14 fibroblast growth factor 14 2 2
MIRT687466 NHSL2 NHS like 2 2 2
MIRT687694 LEPREL1 prolyl 3-hydroxylase 2 1 1
MIRT688254 FHL2 four and a half LIM domains 2 2 3
MIRT688850 CAMKK2 calcium/calmodulin dependent protein kinase kinase 2 2 2
MIRT693794 RHOG ras homolog family member G 2 2
MIRT701828 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT706391 PPID peptidylprolyl isomerase D 2 2
MIRT707197 SDK2 sidekick cell adhesion molecule 2 2 2
MIRT707387 SLC35F6 solute carrier family 35 member F6 2 2
MIRT707508 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT709807 AR androgen receptor 2 2
MIRT710360 CREB5 cAMP responsive element binding protein 5 2 2
MIRT715490 MAZ MYC associated zinc finger protein 2 2
MIRT719247 MS4A1 membrane spanning 4-domains A1 2 2
MIRT733067 CCL5 C-C motif chemokine ligand 5 3 0
MIRT736000 BRMS1 breast cancer metastasis suppressor 1 3 0
MIRT736216 CAPN2 calpain 2 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-147a Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-147a Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-147a Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-147a Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-147a Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-147a Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116, SW480)
hsa-mir-147a Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-147a Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-147a Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-147a Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-147a Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-147a Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-147a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-147a Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission