miRTarBase - #MIRT054852


—
pre-miRNA Information
pre-miRNA hsa-mir-150   
Genomic Coordinates chr19: 49500785 - 49500868
Description Homo sapiens miR-150 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-150-5p
Sequence 16| UCUCCCAACCCUUGUACCAGUG |37
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs955899705 11 dbSNP
rs1303487637 14 dbSNP
rs1407035158 15 dbSNP
rs1405626581 17 dbSNP
rs1339016814 21 dbSNP
rs1368638183 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B3QK6E miR-150 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Heart tissue MiRNA microarray
B3QK6E miR-150 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Peripheral blood mononuclear cell Quantitative reverse transcription PCR
BKR8B7 miR-150-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression . Plasma Microarray
Gene Information
Gene Symbol SRCIN1   
Synonyms P140, SNIP
Description SRC kinase signaling inhibitor 1
Transcript NM_025248   
Expression
Putative miRNA Targets on SRCIN1
3'UTR of SRCIN1
(miRNA target sites are highlighted)		 
>SRCIN1|NM_025248|3'UTR
   1 AAGCCCCTCACCCCGCTGCCCCGCCTGTCCCCCTCCCTCACTCCTGCCATTTCTCCCCTCTCTTCCTTCATCTCCACCCC
  81 ACCCCACCCTACTCTCCAGACGCCCTGAGGGGTGTGCCCTGAAGAGGAGGGTGCGGCCCTCCTCAGCGACCCCTACCCAT
 161 CATCTGTTGGTGTTTTTGGTTTTGTTTTTTTTTTTTTTTTTAACAATTAACTTTTAATTATCTTTTTTTAAACAGTAAAA
 241 CTAAAAACCAAACACACCACCTTCCTTGATCCCAGCTGGCCTCTCGCTGGCCGCACCTGTCACATCTCTCCTTCTTCTCT
 321 TTCACCACTCTTTCCCCCAGTCCATCCTGAAGCTCCTGCACCCCCTTCCCGCCTTCCCCTCACTTCCCAAGAATACTCCA
 401 AACAAACTCTGAACCACGGAGACTTGGAGCAGTGGGAGACCCCTCTCCCGTTTCTCGATACCTTCCTGGAGGAACGCGGG
 481 GACATCGGACCAACCCATACATCAAGCCAGAGAGCGGGGCTTAGGGAGACTGGCCTTGGAGATGCCCCACTCCCTGTCTA
 561 AGCTCCGACAAGACTGTGACTTCCTCTGTGGCTGCTCTGCCTCCTCCCACTCACACCCAAGTGGGCCTGGAGTAGAGACG
 641 GACAGGCTGGAGACGAGGCCGGAGTTTGAGAGGCCTCAGGGTGGGTGTGAGGCCATGGAGTCTGTATCCCTGGGGAGGCG
 721 CTGGCCTCCTGGGCCTTGCCGTCCAGTGGGGAGTGGAGGGCAGAGGCCCTTTGGTCTGCTGGCTGTGGAGGGTGGGTTGC
 801 ACGGACAGCCGGATATCGGGGACACTGCCTTGGGAGAGGGCGGCCCGGACGGGTATTTGGTACTTTTAGTTTCCTGATTT
 881 AGCACTTTAAATGGCATTAACTTATTGAATGGGGATGGGGTGGGCAAGAGTGAGGGGCCTAGAAAACCAGGTTTTGTGGC
 961 TTGCAGTTGGGGGAAGGGTCTGGTTTGAGGGAAATGGGAGGGTCGAGAGGGGCTTGACGGGGAGCACTGAAGACACCTGG
1041 GACCCGCAGGTGGGGTGACTTGAACTTCAGTCATCCTCTTGGCAATTTGAGGGTTTTCCCAGGAAAGGATGAGACGTAGT
1121 TTTTCAATGGGGCTCTGGTGACCCTGGTGAGATGTCTGAAGGTCCCTGAGGCCTGACCATCCAGCCAGCGCCCCTGGCCT
1201 GTGGACGCCCTGCCTGCCCTGCAGAGGCGGTTGGCAGTGCCGCCTGGCTTTTGGCCGGGTCCTGGGGAGGCAGAGAGAGG
1281 CCAATTTTGGTTCTCACTCCTGGCCCCCCAGAGGGCACAGTGAGGAGCCGGTAGGGAGAGGATAGGAGAAGAGGAGGAGG
1361 AGGAGCGGGGTCCCCGGCCGCAGGATTCCCACTTGGAGCACAAAGTGAAGTAAGCACAGGGGAGGGGGACTAGAATCAGT
1441 CCCCCATAGCAAGCACAGAAAGGAGGAGCTGCGCAGAAGGCAGAGCCCCCCAGACCCTGGGGCCTGGCTGGGGAAGGTCC
1521 GCACCTGGGGAGAGCTGGGAGCTGTTGAAGGTTTGGGGGGAGGGGAAACGGGTTGTGTTTCTTCATTTCTTTTTTTGTTT
1601 TTGCCTTTGTTGGTTCATCCTTGTTTTCTAGCTTTGGATCATTTTTGTACCAAGGCGAGCAAGCCTTTTTGAAAAATAAC
1681 AAAAGAGGAAAAAAAAAATCCCTCCTGGAAAAAAAAAAAAACCCTGGAAAATAGAAAAAAAAAAAAGGACCTCATAAATG
1761 ATGCAATTACTTTTAATTGCAGGCAACTCTTTACATTTAAGTGAAGTGTCTTAACATTTTATATTGTTTTAAAAATATAT
1841 TTACATATTATATATATAATATACGTAATATAAATATATATAAATATTTAAAAAAGAAAAAAAAAAGAAAACCACGGCAC
1921 TCTCCCTGGCCACTGTTTTGGCGGGGGAGGGGGGCTGGGGGGCGGGCACGTCGGCCTGGCTTCTGTGGTCCCAGTGAAAT
2001 GGTCTGGTTTGATTTGGCTGTACAGAGACCCCCTGACTTGGGAGGGGAGGGGGGAGTGGTGCCCCCTCCTCCCTCCACTC
2081 CATTACTCTCTGCTTGCTACTTCGCTTGCCCCCAGCTCCCACCCTCAGCCCTGTGACTGGAATGTGTGCCCCACCGTCAT
2161 TGTCCTGAGTTGAATGTCCCTTTGTGGGGGAGGTGGGGGGGGCAGTGTCCATCCACGAAGGGGCAGAAGGAGGGAGCCAC
2241 GTGCCCCGCCCCACCCGCTCGGGTGAAGCCCAGTGGGATTTGCATCTTTCTTTCTCTTTGGTTCCTGCACATTTATGGGC
2321 TGGGAGGCATCCGTGTGGAATTGCGTGCAGCCTGTGTGTGTGCTGGCACAAGCCCATGCACTGTGTGTGCAGACGCATGG
2401 GGCCTGCACCCACAGGCATGGCCGAGCACATGTGTGGGGGAAGGCGTGGGCACATAGGTGCATGTAACCTGTTTGGGCAT
2481 TGGCACGTGCCTACCTGCATGTTAGCGTGAGAGGAGCTTTGTGTGTGAGAACATGTGTAATGTGTGTGCAGACATGCCGA
2561 GAGCCAGAGACTTGTGTGTGGGCCACGTACATGTGGATAGAGACGCATACATGGAGGTGCATGTAATCTGTGTCTCCGAG
2641 TGTGTGTGTGCAGGTATGTGTGCTGGTGCAGACCCAAGTGTGTGGGTGTGCCTCTGTGTGCGTGTGTTCCATCATCCCTG
2721 CACCACTGGCTCCAGATCCCTTCCTGAGCCCCCGTCCCCGCTGGCCCTCTCACAGCCTGCAGCACATCAGTGCCCCCAGC
2801 TGCATGCGCCTCGCTGCTCTGTCCATCAGTGTGTGCTTGACCAAGAGAAAACTAAGACGTCTCGGGGGACCCCTGTACCT
2881 GGTCCTCTCAGCCCCCGCCCACTGTGCTGTGTTACTCGCATGGGGGATTTCCTGCCCCTTCCACAATATGCTGTTTCCCC
2961 AGGAGCCTCAGGCCTGAGGCTCTGAGTGGGGTCCCCAGGGGGCCCCCCGGGGTGAGCCCCGGCTCCACACCCTGCCCCAT
3041 CCACCCTGTAGGGCCCATGTTGGTGTAGCAGTGATGGCTTCTGTGGATATTCTGTGACCTCTGTCGGTGTAACTTGACAA
3121 TTTCTAAATGGAAAAGGGTTGCTGTGTTTTCTCTGTCTCTCTTTTTTAATGTCCTTTTTTCTTCTCCCCCGCTCCCTGCT
3201 CTCTTTCCTTTTCAGTTTTTCTAGCCAAGTGTTTGGGGCTTTAATAAAACTTGTTTCTTTTTCCTCTCCTGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGACCAUGU-UCCCAACCCUCu 5'
            | || |||  |  ||||||| 
Target 5' atCGGGGACACTGCCTTGGGAGa 3'
 815 - 837 152.00 -15.40
2 
miRNA  3' guGACCAUGUUCCCAACCCUCu 5'
            ||| |: |||| |||||:| 
Target 5' agCTGTTG-AAGGTTTGGGGGg 3'
 1540 - 1560 151.00 -18.90
3 
miRNA  3' guGACCAUGUUCC-------C--AACCCUCu 5'
            || |||||: |       |  ||||||| 
Target 5' ggCT-GTACAGAGACCCCCTGACTTGGGAGg 3'
 2016 - 2045 145.00 -15.60
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs532827232 6 dbSNP
rs1239758947 7 dbSNP
rs767726066 10 dbSNP
rs961250412 14 dbSNP
rs370292461 15 dbSNP
rs1369627649 21 dbSNP
rs111650340 22 dbSNP
rs763225349 23 dbSNP
rs1386068809 24 dbSNP
rs1237888484 26 dbSNP
rs775771060 29 dbSNP
rs1015500391 30 dbSNP
rs1386074092 33 dbSNP
rs1381722228 34 dbSNP
rs560770382 35 dbSNP
rs200028328 37 dbSNP
rs1395006160 40 dbSNP
rs746396634 41 dbSNP
rs897626814 49 dbSNP
rs1341488572 58 dbSNP
rs1446457410 60 dbSNP
rs1326183614 61 dbSNP
rs1439499696 65 dbSNP
rs1307364315 66 dbSNP
rs1005655669 70 dbSNP
rs1347676390 74 dbSNP
rs1342926509 76 dbSNP
rs1322106025 77 dbSNP
rs1202143582 81 dbSNP
rs967284799 84 dbSNP
rs1457168917 86 dbSNP
rs1176486516 89 dbSNP
rs1420881856 90 dbSNP
rs1440000755 91 dbSNP
rs1197715008 92 dbSNP
rs1375477976 96 dbSNP
rs1021587775 101 dbSNP
rs1407419493 102 dbSNP
rs1011402381 111 dbSNP
rs894288788 112 dbSNP
rs888119258 113 dbSNP
rs35779101 114 dbSNP
rs1245097507 126 dbSNP
rs527322328 130 dbSNP
rs1003002881 135 dbSNP
rs1300807200 138 dbSNP
rs906953528 142 dbSNP
rs1314839230 145 dbSNP
rs1275378887 147 dbSNP
rs73982819 148 dbSNP
rs73982818 149 dbSNP
rs1040538329 150 dbSNP
rs34205353 150 dbSNP
rs1434423470 155 dbSNP
rs1349854968 172 dbSNP
rs1291750296 178 dbSNP
rs1444231525 179 dbSNP
rs1233158540 180 dbSNP
rs1169134578 183 dbSNP
rs1477813557 183 dbSNP
rs55845463 184 dbSNP
rs944953147 184 dbSNP
rs9901664 184 dbSNP
rs1388769971 185 dbSNP
rs374878561 185 dbSNP
rs71842892 185 dbSNP
rs1284081380 186 dbSNP
rs1491049718 186 dbSNP
rs1339924218 187 dbSNP
rs1216778472 188 dbSNP
rs1179808033 189 dbSNP
rs1279982759 189 dbSNP
rs530217237 189 dbSNP
rs1487004244 190 dbSNP
rs567994827 190 dbSNP
rs1257871986 191 dbSNP
rs946745269 191 dbSNP
rs1280741857 192 dbSNP
rs1303964788 192 dbSNP
rs1459695859 192 dbSNP
rs1362503358 193 dbSNP
rs1189425238 194 dbSNP
rs1395376635 194 dbSNP
rs558932451 195 dbSNP
rs1323262348 198 dbSNP
rs1170016651 202 dbSNP
rs1181783128 202 dbSNP
rs1245117339 202 dbSNP
rs549091639 202 dbSNP
rs79154508 202 dbSNP
rs1442344607 203 dbSNP
rs887472944 204 dbSNP
rs1425896972 207 dbSNP
rs1164485576 212 dbSNP
rs1379868347 213 dbSNP
rs1307978972 216 dbSNP
rs1417955351 216 dbSNP
rs796158632 218 dbSNP
rs545612905 221 dbSNP
rs1045110634 222 dbSNP
rs1160464148 230 dbSNP
rs1345846511 238 dbSNP
rs1377721275 242 dbSNP
rs1300978239 249 dbSNP
rs1174464302 253 dbSNP
rs1055621562 264 dbSNP
rs940393583 265 dbSNP
rs887346266 266 dbSNP
rs1432870942 275 dbSNP
rs1308092205 276 dbSNP
rs1048648621 281 dbSNP
rs576689403 285 dbSNP
rs367783162 286 dbSNP
rs921405215 287 dbSNP
rs183115144 292 dbSNP
rs374111642 293 dbSNP
rs981941994 295 dbSNP
rs961178921 298 dbSNP
rs56153173 300 dbSNP
rs1184532642 303 dbSNP
rs55974793 304 dbSNP
rs563007325 306 dbSNP
rs952489922 307 dbSNP
rs56395428 312 dbSNP
rs1470126131 319 dbSNP
rs996615487 319 dbSNP
rs1310037925 320 dbSNP
rs1285925547 325 dbSNP
rs1397835769 330 dbSNP
rs1448600758 332 dbSNP
rs1279742493 333 dbSNP
rs1223801473 334 dbSNP
rs1366332845 346 dbSNP
rs1216923052 347 dbSNP
rs1372058888 348 dbSNP
rs1299838953 359 dbSNP
rs1326196964 361 dbSNP
rs965095974 362 dbSNP
rs776686305 363 dbSNP
rs771022416 364 dbSNP
rs990036281 365 dbSNP
rs1019361331 366 dbSNP
rs958656476 368 dbSNP
rs569275334 370 dbSNP
rs552758227 371 dbSNP
rs1427346338 377 dbSNP
rs1357736309 378 dbSNP
rs1313817673 398 dbSNP
rs1397897144 398 dbSNP
rs902677595 404 dbSNP
rs539244044 407 dbSNP
rs1348884285 408 dbSNP
rs1433685221 413 dbSNP
rs1294847675 418 dbSNP
rs1345567541 421 dbSNP
rs1034557406 438 dbSNP
rs1043041604 443 dbSNP
rs1002748321 449 dbSNP
rs906936660 450 dbSNP
rs567161352 457 dbSNP
rs1219627600 466 dbSNP
rs1271205260 467 dbSNP
rs879300216 475 dbSNP
rs1192896026 476 dbSNP
rs370912134 477 dbSNP
rs938002570 478 dbSNP
rs1168219318 480 dbSNP
rs887422747 483 dbSNP
rs547362448 487 dbSNP
rs1403308153 491 dbSNP
rs1166430147 495 dbSNP
rs1476116654 503 dbSNP
rs62075667 513 dbSNP
rs900087574 515 dbSNP
rs190846259 516 dbSNP
rs547890157 523 dbSNP
rs1433497944 527 dbSNP
rs1271195993 532 dbSNP
rs1356061883 539 dbSNP
rs1226863223 540 dbSNP
rs912625781 540 dbSNP
rs1294173484 542 dbSNP
rs1360285713 552 dbSNP
rs1215912086 553 dbSNP
rs531405183 555 dbSNP
rs1448736525 557 dbSNP
rs111854159 563 dbSNP
rs914542283 566 dbSNP
rs781776219 567 dbSNP
rs952633831 572 dbSNP
rs958869431 582 dbSNP
rs1418565982 591 dbSNP
rs927264411 592 dbSNP
rs1156375116 594 dbSNP
rs1327833602 600 dbSNP
rs981666687 601 dbSNP
rs562255414 612 dbSNP
rs975104942 615 dbSNP
rs971277606 617 dbSNP
rs545586556 620 dbSNP
rs1317444179 625 dbSNP
rs1019412631 626 dbSNP
rs1239694292 630 dbSNP
rs1004561387 639 dbSNP
rs951807705 640 dbSNP
rs1027239967 647 dbSNP
rs1377520985 649 dbSNP
rs995897907 654 dbSNP
rs1431806970 655 dbSNP
rs751826696 660 dbSNP
rs185993294 661 dbSNP
rs1438757681 662 dbSNP
rs1039985161 664 dbSNP
rs1365073335 666 dbSNP
rs1044451308 672 dbSNP
rs1418417336 675 dbSNP
rs1159679246 682 dbSNP
rs1164072451 685 dbSNP
rs559994360 689 dbSNP
rs1421833131 694 dbSNP
rs891272358 696 dbSNP
rs114322800 720 dbSNP
rs1186721811 731 dbSNP
rs574661182 732 dbSNP
rs938867437 733 dbSNP
rs946073981 734 dbSNP
rs914698455 737 dbSNP
rs1046470773 738 dbSNP
rs940067847 739 dbSNP
rs756802603 740 dbSNP
rs1214950146 741 dbSNP
rs554921588 758 dbSNP
rs560252508 763 dbSNP
rs937385076 767 dbSNP
rs1048195158 772 dbSNP
rs931126816 776 dbSNP
rs921214183 784 dbSNP
rs1437918955 785 dbSNP
rs1197466886 789 dbSNP
rs1375428823 795 dbSNP
rs537855101 797 dbSNP
rs975323622 802 dbSNP
rs943718727 803 dbSNP
rs1244747289 810 dbSNP
rs927182202 811 dbSNP
rs981356663 818 dbSNP
rs971734719 827 dbSNP
rs753492362 829 dbSNP
rs912193279 832 dbSNP
rs1229639294 841 dbSNP
rs1329394923 842 dbSNP
rs774394678 846 dbSNP
rs575768555 847 dbSNP
rs1317093533 850 dbSNP
rs983253171 851 dbSNP
rs1216509470 853 dbSNP
rs143283531 855 dbSNP
rs1027396035 860 dbSNP
rs149600710 868 dbSNP
rs964433133 870 dbSNP
rs989690150 883 dbSNP
rs1019046048 884 dbSNP
rs1292841109 885 dbSNP
rs182249580 887 dbSNP
rs1002378836 894 dbSNP
rs1168856808 896 dbSNP
rs1375126970 902 dbSNP
rs1170835067 915 dbSNP
rs891385995 915 dbSNP
rs1041905712 917 dbSNP
rs1462732039 935 dbSNP
rs1448657624 937 dbSNP
rs553685011 938 dbSNP
rs1387921691 951 dbSNP
rs1195183970 956 dbSNP
rs1010443047 969 dbSNP
rs879085114 973 dbSNP
rs924760199 974 dbSNP
rs116625090 978 dbSNP
rs977558237 979 dbSNP
rs1406797340 982 dbSNP
rs1024907325 991 dbSNP
rs1266108173 996 dbSNP
rs567884738 1002 dbSNP
rs1339678719 1004 dbSNP
rs1054567899 1005 dbSNP
rs937439411 1006 dbSNP
rs1487767276 1010 dbSNP
rs887226195 1012 dbSNP
rs927285791 1013 dbSNP
rs1243666794 1018 dbSNP
rs1263278180 1023 dbSNP
rs1360987794 1025 dbSNP
rs1222494858 1026 dbSNP
rs559549483 1027 dbSNP
rs1284674775 1028 dbSNP
rs1488281422 1034 dbSNP
rs548119455 1045 dbSNP
rs1264346295 1046 dbSNP
rs1429440428 1047 dbSNP
rs1187133648 1052 dbSNP
rs531252703 1053 dbSNP
rs1426633445 1054 dbSNP
rs1164369697 1059 dbSNP
rs1341972345 1062 dbSNP
rs1359965832 1070 dbSNP
rs899658956 1077 dbSNP
rs1290530903 1085 dbSNP
rs1039650135 1102 dbSNP
rs1236824263 1106 dbSNP
rs943913640 1116 dbSNP
rs568611416 1126 dbSNP
rs551883884 1127 dbSNP
rs977114871 1150 dbSNP
rs555298183 1152 dbSNP
rs945688077 1172 dbSNP
rs914369073 1179 dbSNP
rs1298734556 1186 dbSNP
rs1428861089 1189 dbSNP
rs990301382 1190 dbSNP
rs544829994 1191 dbSNP
rs1262963280 1196 dbSNP
rs559882354 1206 dbSNP
rs981005483 1207 dbSNP
rs1446733925 1210 dbSNP
rs970923611 1213 dbSNP
rs1025166403 1218 dbSNP
rs1161233127 1223 dbSNP
rs540077389 1226 dbSNP
rs1004239601 1229 dbSNP
rs887104582 1239 dbSNP
rs1027104876 1241 dbSNP
rs995962079 1242 dbSNP
rs899686664 1256 dbSNP
rs1039528837 1257 dbSNP
rs368596080 1280 dbSNP
rs527493845 1280 dbSNP
rs1183623908 1281 dbSNP
rs35045916 1289 dbSNP
rs891073040 1296 dbSNP
rs1456558382 1297 dbSNP
rs575862553 1300 dbSNP
rs1482917881 1302 dbSNP
rs1272995360 1303 dbSNP
rs1204588239 1304 dbSNP
rs1042024944 1308 dbSNP
rs1345929849 1309 dbSNP
rs1255634390 1310 dbSNP
rs945766935 1314 dbSNP
rs1408786676 1321 dbSNP
rs1432567275 1328 dbSNP
rs529954742 1329 dbSNP
rs556247381 1330 dbSNP
rs1288876098 1340 dbSNP
rs1054216735 1345 dbSNP
rs1352340191 1349 dbSNP
rs937061123 1349 dbSNP
rs1348576870 1359 dbSNP
rs1326133702 1366 dbSNP
rs869063461 1366 dbSNP
rs926804215 1366 dbSNP
rs970849455 1366 dbSNP
rs980933363 1366 dbSNP
rs1224446956 1367 dbSNP
rs1314439764 1375 dbSNP
rs775583094 1376 dbSNP
rs1400973733 1379 dbSNP
rs1490195389 1380 dbSNP
rs1265659561 1388 dbSNP
rs1197217317 1390 dbSNP
rs983430573 1391 dbSNP
rs951420514 1392 dbSNP
rs1169780162 1398 dbSNP
rs1417112881 1402 dbSNP
rs1027361688 1403 dbSNP
rs995618467 1410 dbSNP
rs964152664 1411 dbSNP
rs544584894 1412 dbSNP
rs1347869584 1419 dbSNP
rs1183510802 1421 dbSNP
rs1008104169 1424 dbSNP
rs1472523270 1427 dbSNP
rs1250288376 1428 dbSNP
rs1190434111 1430 dbSNP
rs1270027006 1432 dbSNP
rs144814237 1433 dbSNP
rs1041646105 1441 dbSNP
rs1273916230 1442 dbSNP
rs1198986987 1443 dbSNP
rs1358834212 1447 dbSNP
rs1220263458 1448 dbSNP
rs1352905616 1456 dbSNP
rs1294037071 1459 dbSNP
rs559071402 1466 dbSNP
rs1054498825 1469 dbSNP
rs936994713 1470 dbSNP
rs927068328 1473 dbSNP
rs545552121 1479 dbSNP
rs573388924 1484 dbSNP
rs1422223695 1487 dbSNP
rs190998309 1491 dbSNP
rs1365631645 1492 dbSNP
rs1295063720 1493 dbSNP
rs1318199179 1508 dbSNP
rs1325071376 1508 dbSNP
rs1448467391 1512 dbSNP
rs949588240 1520 dbSNP
rs536446830 1521 dbSNP
rs1382393951 1522 dbSNP
rs1244038945 1524 dbSNP
rs1383615349 1525 dbSNP
rs567942224 1527 dbSNP
rs557418985 1530 dbSNP
rs1360219952 1532 dbSNP
rs1204517277 1537 dbSNP
rs1282007446 1548 dbSNP
rs770988979 1549 dbSNP
rs983056287 1555 dbSNP
rs375895405 1556 dbSNP
rs1185014778 1557 dbSNP
rs568549163 1560 dbSNP
rs1469136207 1561 dbSNP
rs560338375 1561 dbSNP
rs1473312056 1563 dbSNP
rs1402948272 1564 dbSNP
rs1319461914 1566 dbSNP
rs964038645 1569 dbSNP
rs1018406093 1570 dbSNP
rs1450780011 1584 dbSNP
rs1338900258 1592 dbSNP
rs1383652797 1593 dbSNP
rs1238349673 1596 dbSNP
rs1368302680 1597 dbSNP
rs1277712519 1603 dbSNP
rs1008283955 1608 dbSNP
rs955197492 1609 dbSNP
rs551772191 1612 dbSNP
rs1262315545 1621 dbSNP
rs3990045 1623 dbSNP
rs1459779988 1641 dbSNP
rs1448912358 1652 dbSNP
rs1205196517 1657 dbSNP
rs1243309898 1664 dbSNP
rs1436725753 1665 dbSNP
rs1248882986 1671 dbSNP
rs1208117699 1677 dbSNP
rs1463642782 1680 dbSNP
rs1160514748 1685 dbSNP
rs1429067799 1685 dbSNP
rs539128839 1685 dbSNP
rs570513623 1687 dbSNP
rs1355354195 1688 dbSNP
rs1407027607 1690 dbSNP
rs1391039154 1694 dbSNP
rs1327004061 1699 dbSNP
rs551349351 1699 dbSNP
rs553518573 1699 dbSNP
rs533544028 1703 dbSNP
rs1229380614 1705 dbSNP
rs1365389274 1706 dbSNP
rs1225046590 1708 dbSNP
rs1020516201 1718 dbSNP
rs532051113 1719 dbSNP
rs1193695176 1720 dbSNP
rs893069861 1721 dbSNP
rs1183566126 1722 dbSNP
rs1268732941 1722 dbSNP
rs1487136479 1722 dbSNP
rs1479665439 1725 dbSNP
rs1179121853 1732 dbSNP
rs1396080264 1732 dbSNP
rs568057272 1734 dbSNP
rs1406410031 1735 dbSNP
rs1398751886 1740 dbSNP
rs1413740860 1741 dbSNP
rs1246793043 1747 dbSNP
rs1343633497 1747 dbSNP
rs1032908802 1749 dbSNP
rs1283743155 1786 dbSNP
rs1325609352 1809 dbSNP
rs1001193355 1816 dbSNP
rs1161751631 1825 dbSNP
rs905528296 1839 dbSNP
rs1221003399 1850 dbSNP
rs1045463347 1859 dbSNP
rs1451731447 1859 dbSNP
rs1202204335 1864 dbSNP
rs949765173 1865 dbSNP
rs1391002665 1871 dbSNP
rs1428235218 1879 dbSNP
rs1188244904 1889 dbSNP
rs896670313 1890 dbSNP
rs1255020239 1896 dbSNP
rs1163073055 1902 dbSNP
rs1208663999 1907 dbSNP
rs1294001106 1907 dbSNP
rs1363765637 1907 dbSNP
rs1222437614 1909 dbSNP
rs1047707844 1911 dbSNP
rs1380256315 1911 dbSNP
rs1297285006 1912 dbSNP
rs1365564027 1912 dbSNP
rs930141818 1913 dbSNP
rs1312348577 1915 dbSNP
rs566233028 1916 dbSNP
rs1225391416 1917 dbSNP
rs546734488 1922 dbSNP
rs974314936 1931 dbSNP
rs1485747437 1933 dbSNP
rs1203823110 1935 dbSNP
rs1264282368 1939 dbSNP
rs1197275267 1942 dbSNP
rs1342684134 1943 dbSNP
rs1296374254 1946 dbSNP
rs969195821 1948 dbSNP
rs1165415365 1949 dbSNP
rs1225784352 1953 dbSNP
rs1451543160 1954 dbSNP
rs1290476648 1956 dbSNP
rs942687039 1957 dbSNP
rs1451519995 1961 dbSNP
rs1334226213 1963 dbSNP
rs1384377293 1963 dbSNP
rs1372752615 1967 dbSNP
rs911189330 1969 dbSNP
rs9783843 1970 dbSNP
rs1349748790 1972 dbSNP
rs1262908400 1973 dbSNP
rs1465598476 1979 dbSNP
rs1203300401 1988 dbSNP
rs955612206 1993 dbSNP
rs1335826186 1998 dbSNP
rs1021663034 2003 dbSNP
rs1182591197 2004 dbSNP
rs1249897107 2006 dbSNP
rs1417300406 2014 dbSNP
rs1161168714 2017 dbSNP
rs1020353010 2026 dbSNP
rs1469044869 2030 dbSNP
rs989072902 2034 dbSNP
rs1322207156 2037 dbSNP
rs957223533 2046 dbSNP
rs1033375149 2049 dbSNP
rs1001371156 2055 dbSNP
rs1371604826 2055 dbSNP
rs1168177611 2056 dbSNP
rs1428014786 2061 dbSNP
rs1290702329 2062 dbSNP
rs1330260046 2067 dbSNP
rs1261657997 2068 dbSNP
rs1427570577 2073 dbSNP
rs1211063301 2074 dbSNP
rs1232418054 2076 dbSNP
rs1191774721 2077 dbSNP
rs905538468 2078 dbSNP
rs1244898928 2082 dbSNP
rs1023901057 2085 dbSNP
rs529888402 2095 dbSNP
rs1013862454 2099 dbSNP
rs886211202 2103 dbSNP
rs1414721846 2104 dbSNP
rs1047472043 2111 dbSNP
rs1352284065 2119 dbSNP
rs1463021123 2155 dbSNP
rs930170873 2156 dbSNP
rs561233071 2161 dbSNP
rs898631232 2166 dbSNP
rs1202799998 2168 dbSNP
rs1038637400 2179 dbSNP
rs1281832819 2180 dbSNP
rs1370145464 2186 dbSNP
rs1272481160 2195 dbSNP
rs942909432 2195 dbSNP
rs1349515305 2196 dbSNP
rs1275424983 2198 dbSNP
rs1490178303 2200 dbSNP
rs533263281 2203 dbSNP
rs911241680 2203 dbSNP
rs1478210459 2208 dbSNP
rs544207234 2209 dbSNP
rs749831752 2211 dbSNP
rs548038259 2217 dbSNP
rs3913867 2222 dbSNP
rs1218112063 2240 dbSNP
rs531404082 2241 dbSNP
rs1912410 2242 dbSNP
rs1424636110 2245 dbSNP
rs1912411 2247 dbSNP
rs565244018 2248 dbSNP
rs545437932 2251 dbSNP
rs1437565359 2253 dbSNP
rs957439892 2254 dbSNP
rs1351674871 2256 dbSNP
rs566705254 2260 dbSNP
rs186274764 2261 dbSNP
rs1358758053 2269 dbSNP
rs1220204087 2272 dbSNP
rs980006254 2276 dbSNP
rs1214879440 2284 dbSNP
rs1240138140 2296 dbSNP
rs1408392424 2298 dbSNP
rs562439411 2300 dbSNP
rs1361054350 2315 dbSNP
rs553197489 2327 dbSNP
rs1384092492 2331 dbSNP
rs150379257 2332 dbSNP
rs574183353 2344 dbSNP
rs1416665094 2345 dbSNP
rs1406460288 2348 dbSNP
rs868561438 2351 dbSNP
rs557619641 2379 dbSNP
rs1413975025 2383 dbSNP
rs756489050 2387 dbSNP
rs1321419680 2390 dbSNP
rs752997526 2390 dbSNP
rs1382133563 2394 dbSNP
rs114055727 2395 dbSNP
rs1223111842 2400 dbSNP
rs1281943179 2404 dbSNP
rs1330882746 2405 dbSNP
rs1208995985 2414 dbSNP
rs1472854304 2424 dbSNP
rs1250994196 2425 dbSNP
rs1179670916 2427 dbSNP
rs1242067126 2428 dbSNP
rs1484143462 2432 dbSNP
rs867471601 2433 dbSNP
rs1237523219 2434 dbSNP
rs1473442146 2435 dbSNP
rs558084910 2436 dbSNP
rs1237688173 2445 dbSNP
rs181601694 2446 dbSNP
rs1309914632 2451 dbSNP
rs1160199629 2453 dbSNP
rs1285691583 2462 dbSNP
rs1228508398 2468 dbSNP
rs1038521613 2473 dbSNP
rs1179514027 2476 dbSNP
rs1288285400 2481 dbSNP
rs1408375279 2486 dbSNP
rs1007047797 2487 dbSNP
rs566553631 2488 dbSNP
rs1441415973 2489 dbSNP
rs369359455 2492 dbSNP
rs9903055 2493 dbSNP
rs1228843717 2494 dbSNP
rs1321026076 2495 dbSNP
rs567382497 2507 dbSNP
rs371012140 2515 dbSNP
rs12600454 2517 dbSNP
rs1473850325 2524 dbSNP
rs1183437010 2527 dbSNP
rs1428988522 2532 dbSNP
rs1464774961 2535 dbSNP
rs925802431 2537 dbSNP
rs979929564 2540 dbSNP
rs1409379577 2548 dbSNP
rs1326780042 2553 dbSNP
rs1352338555 2558 dbSNP
rs1411124513 2559 dbSNP
rs530795869 2572 dbSNP
rs1282456501 2574 dbSNP
rs1343360319 2574 dbSNP
rs565179354 2578 dbSNP
rs1235003858 2580 dbSNP
rs917199311 2584 dbSNP
rs1425300220 2586 dbSNP
rs1338199025 2587 dbSNP
rs986535801 2588 dbSNP
rs1193633256 2591 dbSNP
rs1414323489 2595 dbSNP
rs1276150566 2598 dbSNP
rs1181093249 2599 dbSNP
rs992726082 2604 dbSNP
rs145526517 2605 dbSNP
rs1025957870 2610 dbSNP
rs528545463 2611 dbSNP
rs1208750013 2623 dbSNP
rs879082405 2628 dbSNP
rs1166840860 2630 dbSNP
rs963154723 2633 dbSNP
rs1430361516 2634 dbSNP
rs868006055 2637 dbSNP
rs9912504 2638 dbSNP
rs1197445704 2640 dbSNP
rs1268050309 2641 dbSNP
rs1237580149 2650 dbSNP
rs1299236455 2651 dbSNP
rs1342189673 2651 dbSNP
rs1324048791 2653 dbSNP
rs1295090197 2654 dbSNP
rs1313829228 2658 dbSNP
rs1291603298 2664 dbSNP
rs889949138 2674 dbSNP
rs1051352928 2676 dbSNP
rs1268461563 2692 dbSNP
rs1446692360 2693 dbSNP
rs1186858715 2698 dbSNP
rs1392140853 2700 dbSNP
rs998408566 2701 dbSNP
rs891808849 2702 dbSNP
rs1459377220 2704 dbSNP
rs1293934916 2706 dbSNP
rs1383940677 2708 dbSNP
rs1432475192 2717 dbSNP
rs147525025 2746 dbSNP
rs935986743 2749 dbSNP
rs1451201285 2750 dbSNP
rs926079080 2753 dbSNP
rs1388048770 2754 dbSNP
rs1247605568 2758 dbSNP
rs763203641 2759 dbSNP
rs1459336000 2760 dbSNP
rs1207064496 2766 dbSNP
rs1250073395 2767 dbSNP
rs1367603655 2769 dbSNP
rs1465503486 2771 dbSNP
rs1350432296 2782 dbSNP
rs1254132078 2785 dbSNP
rs1044451910 2789 dbSNP
rs917042314 2790 dbSNP
rs1455382467 2794 dbSNP
rs75746632 2797 dbSNP
rs1160940069 2802 dbSNP
rs993173278 2804 dbSNP
rs563704361 2807 dbSNP
rs1300623636 2808 dbSNP
rs139690578 2812 dbSNP
rs1398341110 2813 dbSNP
rs919156958 2819 dbSNP
rs1350271854 2825 dbSNP
rs1227007893 2829 dbSNP
rs1391621982 2832 dbSNP
rs973114119 2834 dbSNP
rs1188885144 2836 dbSNP
rs1254357684 2840 dbSNP
rs963035232 2841 dbSNP
rs1448320633 2847 dbSNP
rs1249658316 2852 dbSNP
rs1471559530 2854 dbSNP
rs150622272 2858 dbSNP
rs1412412658 2859 dbSNP
rs558070925 2863 dbSNP
rs1211140795 2864 dbSNP
rs1360396403 2867 dbSNP
rs115753348 2868 dbSNP
rs1466054457 2869 dbSNP
rs1266556073 2872 dbSNP
rs985841873 2878 dbSNP
rs753859593 2887 dbSNP
rs1290649457 2890 dbSNP
rs188899344 2890 dbSNP
rs1029807052 2896 dbSNP
rs572777885 2897 dbSNP
rs866042811 2902 dbSNP
rs998856263 2904 dbSNP
rs553016320 2909 dbSNP
rs1032337375 2910 dbSNP
rs1482053838 2915 dbSNP
rs1388598285 2917 dbSNP
rs1000188541 2918 dbSNP
rs535932139 2920 dbSNP
rs1456199073 2925 dbSNP
rs1426904094 2926 dbSNP
rs1169184432 2931 dbSNP
rs567374955 2932 dbSNP
rs764074491 2935 dbSNP
rs1310348027 2937 dbSNP
rs1371561445 2943 dbSNP
rs1436133457 2961 dbSNP
rs1044463721 2963 dbSNP
rs948783936 2972 dbSNP
rs141883488 2973 dbSNP
rs1296998467 2992 dbSNP
rs1387938681 2993 dbSNP
rs1056995209 2995 dbSNP
rs1275200473 2998 dbSNP
rs1433322220 3001 dbSNP
rs769969648 3002 dbSNP
rs1248213354 3003 dbSNP
rs929116202 3005 dbSNP
rs919218469 3006 dbSNP
rs973718968 3008 dbSNP
rs778878067 3009 dbSNP
rs910179200 3009 dbSNP
rs985895606 3012 dbSNP
rs954415111 3013 dbSNP
rs1437499902 3014 dbSNP
rs1320064151 3018 dbSNP
rs537250371 3020 dbSNP
rs976970301 3021 dbSNP
rs956396266 3028 dbSNP
rs1277150959 3029 dbSNP
rs1206357476 3038 dbSNP
rs1031931532 3039 dbSNP
rs1322057160 3053 dbSNP
rs1207715243 3065 dbSNP
rs1245756764 3068 dbSNP
rs1465966091 3069 dbSNP
rs1341641321 3070 dbSNP
rs1236348314 3089 dbSNP
rs1387789107 3094 dbSNP
rs1472785244 3098 dbSNP
rs1000365114 3105 dbSNP
rs1416420622 3131 dbSNP
rs1235499135 3137 dbSNP
rs904551575 3145 dbSNP
rs1386814078 3159 dbSNP
rs1321362578 3163 dbSNP
rs749768331 3163 dbSNP
rs1339898937 3174 dbSNP
rs1445772900 3181 dbSNP
rs1285813229 3184 dbSNP
rs1022894279 3187 dbSNP
rs1227621777 3190 dbSNP
rs571553181 3191 dbSNP
rs1208939799 3192 dbSNP
rs551730693 3195 dbSNP
rs1403083320 3223 dbSNP
rs1440135308 3226 dbSNP
rs1012858987 3228 dbSNP
rs1239783664 3231 dbSNP
rs1352283074 3232 dbSNP
rs530076354 3237 dbSNP
rs895926861 3249 dbSNP
rs375102514 3251 dbSNP
rs1409000782 3252 dbSNP
rs1159326759 3257 dbSNP
rs201770613 3265 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gugaccauguucccaACCCUCu 5'
                         |||||| 
Target 5' --------------gUGGGAGa 3'
 		1 - 8
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions A549 , H1975
Disease 80725.0
Location of target site 3'UTR
Tools used in this research miRanda , TargetScan
Original Description (Extracted from the article) ... "By overexpressing or knocking down miR-150 in lung adenocarcinoma A549 cells and H1975 cells ...

- Cao M; Hou D; Liang H; Gong F; Wang Y; Yan et al., 2014, European journal of cancer (Oxford, England : 1990).

Article - Cao M; Hou D; Liang H; Gong F; Wang Y; Yan et al.
- European journal of cancer (Oxford, England : 1990), 2014
microRNAs (miRNAs) are a class of endogenously expressed, small non-coding RNAs that play an important role in the regulation of gene expression at the post-transcriptional level. Dysregulation of miRNAs is associated with a variety of diseases, including lung cancer. In the present study, miR-150 was found to be significantly upregulated in lung cancer clinical specimens by quantitative real-time polymerase chain reaction (RT-PCR). Using bioinformatics analysis, v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (SRC) kinase signalling inhibitor 1 (SRCIN1), an important regulator of SRC activity, was predicted to be a potential target of miR-150. Furthermore, an inverse correlation between miR-150 and SRCIN1 protein levels, but not mRNA levels, was identified in human lung cancer tissue samples. By overexpressing or knocking down miR-150 in lung adenocarcinoma A549 cells and H1975 cells, it was experimentally validated that miR-150 is a direct regulator of SRCIN1. It was further confirmed that miR-150 directly recognises the 3'-untranslated region (3'-UTR) of SRCIN1 transcript with a luciferase reporter assay. Finally, it was demonstrated that the repression of SRCIN1 by miR-150 consequently triggered the activation of the Src/focal adhesion kinase (FAK) and Src/Ras/extracellular signal-regulated kinase (ERK) pathway, which eventually promoted the proliferation and migration of A549 cells, and this promotion by miR-150 could be reversed by overexpressing SRCIN1. Taken together, our findings provide the first clues regarding the role of miR-150 as an oncogene in lung cancer through the inhibition of SRCIN1 translation.
LinkOut: [PMID: 24456795]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000264659.7 | 3UTR | GUGGGAGACCCCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.693 2.5e-4 -0.587 2.6e-3 21 Click to see details
GSE19783 ER- ER- breast cancer -0.239 1.7e-2 -0.178 5.8e-2 79 Click to see details
GSE21032 Prostate cancer -0.2 3.5e-2 -0.184 4.8e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.359 3.9e-2 -0.345 4.6e-2 25 Click to see details
GSE28260 Renal cortex and medulla 0.429 7.2e-2 0.489 4.5e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.139 9.6e-2 0.133 1.1e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.382 1.1e-1 -0.224 2.4e-1 12 Click to see details
GSE17306 Multiple myeloma 0.138 1.7e-1 0.165 1.3e-1 49 Click to see details
GSE19536 Breast cancer -0.073 2.4e-1 -0.033 3.7e-1 100 Click to see details
GSE27834 Pluripotent stem cells 0.189 2.4e-1 0.024 4.6e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.267 2.4e-1 -0.033 4.7e-1 9 Click to see details
GSE19783 ER+ ER+ breast cancer 0.16 2.5e-1 0.177 2.3e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.113 3.2e-1 0.011 4.8e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.04 3.8e-1 -0.026 4.2e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.055 4.0e-1 -0.119 2.9e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.035 4.4e-1 -0.063 3.8e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.028 4.4e-1 0.192 1.5e-1 32 Click to see details
GSE28544 Breast cancer -0.032 4.4e-1 0.348 4.8e-2 24 Click to see details
GSE28544 Breast cancer -0.032 4.4e-1 0.348 4.8e-2 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC -0.413 0 -0.276 0.05 38 Click to see details
STAD -0.438 0.01 -0.292 0.05 32 Click to see details
BLCA 0.563 0.01 0.548 0.01 18 Click to see details
PRAD -0.341 0.01 -0.305 0.02 50 Click to see details
BRCA -0.236 0.02 -0.286 0 84 Click to see details
UCEC 0.444 0.03 0.421 0.04 19 Click to see details
HNSC -0.26 0.05 -0.214 0.09 42 Click to see details
KIRC -0.202 0.05 -0.175 0.08 68 Click to see details
ESCA 0.352 0.14 0.355 0.14 11 Click to see details
CHOL -0.371 0.16 -0.350 0.18 9 Click to see details
THCA 0.113 0.2 0.141 0.14 59 Click to see details
CESC -0.733 0.24 -1.000 0.5 3 Click to see details
COAD 0.249 0.28 0.286 0.25 8 Click to see details
LUAD -0.191 0.28 -0.224 0.24 12 Click to see details
KICH 0.12 0.28 -0.041 0.42 25 Click to see details
PAAD 0.235 0.38 -0.200 0.4 4 Click to see details
LIHC 0.037 0.4 0.034 0.41 49 Click to see details
KIRP 0.033 0.43 0.091 0.31 32 Click to see details
PCPG -0.112 0.46 0.500 0.33 3 Click to see details
PCPG -0.112 0.46 0.500 0.33 3 Click to see details
PCPG -0.112 0.46 0.500 0.33 3 Click to see details
503 hsa-miR-150-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000935 MYB MYB proto-oncogene, transcription factor 5 13
MIRT003222 EGR2 early growth response 2 5 2
MIRT004272 VEGFA vascular endothelial growth factor A 2 1
MIRT004357 P2RX7 purinergic receptor P2X 7 6 4
MIRT005739 IGF2 insulin like growth factor 2 1 1
MIRT006115 MUC4 mucin 4, cell surface associated 3 1
MIRT006604 Myb myeloblastosis oncogene 3 1
MIRT006668 CXCR4 C-X-C motif chemokine receptor 4 1 1
MIRT006984 ZEB1 zinc finger E-box binding homeobox 1 6 3
MIRT007016 NOTCH3 notch 3 1 1
MIRT007053 FLT3 fms related tyrosine kinase 3 1 1
MIRT007087 EP300 E1A binding protein p300 3 2
MIRT021208 cmyb v-myb avian myeloblastosis viral oncogene homolog 1 1
MIRT021209 PTPRR protein tyrosine phosphatase, receptor type R 1 1
MIRT021210 MS4A3 membrane spanning 4-domains A3 1 1
MIRT021211 CCNE1 cyclin E1 1 1
MIRT021212 AGA aspartylglucosaminidase 1 1
MIRT045387 ATP13A3 ATPase 13A3 1 1
MIRT052652 TP53 tumor protein p53 4 2
MIRT054633 BIRC5 baculoviral IAP repeat containing 5 3 1
MIRT054852 SRCIN1 SRC kinase signaling inhibitor 1 5 3
MIRT054868 CBL Cbl proto-oncogene 3 1
MIRT133589 ADIPOR2 adiponectin receptor 2 2 1
MIRT136366 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT222062 PURB purine rich element binding protein B 2 6
MIRT222128 FOXK1 forkhead box K1 2 2
MIRT232510 MBD6 methyl-CpG binding domain protein 6 2 2
MIRT293382 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT388973 CNPPD1 cyclin Pas1/PHO80 domain containing 1 2 2
MIRT392627 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT437627 SYNPO2 synaptopodin 2 2 1
MIRT437628 PDIA6 protein disulfide isomerase family A member 6 2 1
MIRT437629 EREG epiregulin 4 3
MIRT437630 TOM1 target of myb1 membrane trafficking protein 2 1
MIRT437631 CNST consortin, connexin sorting protein 2 1
MIRT437632 TRPS1 transcriptional repressor GATA binding 1 2 1
MIRT437633 CAST calpastatin 2 1
MIRT437634 AIFM2 apoptosis inducing factor, mitochondria associated 2 4 3
MIRT437635 C16orf63 FGFR1OP N-terminal like 2 1
MIRT437823 COL4A4 collagen type IV alpha 4 chain 1 1
MIRT437824 SP1 Sp1 transcription factor 3 2
MIRT437917 CISH cytokine inducible SH2 containing protein 3 1
MIRT438120 CCR6 C-C motif chemokine receptor 6 3 1
MIRT447959 WDR77 WD repeat domain 77 2 2
MIRT461324 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT493802 GAN gigaxonin 2 6
MIRT495023 C2CD4B C2 calcium dependent domain containing 4B 2 2
MIRT495046 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT496570 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT497483 XPR1 xenotropic and polytropic retrovirus receptor 1 2 2
MIRT497936 ABCB7 ATP binding cassette subfamily B member 7 2 2
MIRT503982 C4orf29 abhydrolase domain containing 18 2 4
MIRT504020 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT504765 TEP1 telomerase associated protein 1 2 4
MIRT504841 RRP36 ribosomal RNA processing 36 2 6
MIRT505556 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT506090 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT509109 BMP8B bone morphogenetic protein 8b 2 6
MIRT513390 TUBB4A tubulin beta 4A class IVa 2 2
MIRT514115 SERF2 small EDRK-rich factor 2 2 2
MIRT514299 FXYD5 FXYD domain containing ion transport regulator 5 2 4
MIRT514959 SIGLEC11 sialic acid binding Ig like lectin 11 2 2
MIRT515171 AHI1 Abelson helper integration site 1 2 2
MIRT515373 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT515723 SEPT14 septin 14 2 4
MIRT516023 A1CF APOBEC1 complementation factor 2 2
MIRT516252 BCAS4 breast carcinoma amplified sequence 4 2 2
MIRT516535 MIXL1 Mix paired-like homeobox 2 2
MIRT516803 ZNF708 zinc finger protein 708 2 4
MIRT516989 COX19 COX19, cytochrome c oxidase assembly factor 2 4
MIRT517038 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT517097 CCDC30 coiled-coil domain containing 30 2 4
MIRT517794 EFCAB11 EF-hand calcium binding domain 11 2 4
MIRT518871 NKD1 naked cuticle homolog 1 2 2
MIRT519497 MAPK13 mitogen-activated protein kinase 13 2 2
MIRT520436 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT520989 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT521526 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT521645 PROSC pyridoxal phosphate binding protein 2 2
MIRT522851 KIAA1551 KIAA1551 2 2
MIRT522973 INTU inturned planar cell polarity protein 2 2
MIRT523061 HYPK huntingtin interacting protein K 2 2
MIRT523581 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT524273 CYCS cytochrome c, somatic 2 4
MIRT524435 CNKSR3 CNKSR family member 3 2 2
MIRT524603 CACYBP calcyclin binding protein 2 2
MIRT524962 AGO3 argonaute 3, RISC catalytic component 2 4
MIRT525288 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT526171 ANKRD65 ankyrin repeat domain 65 2 2
MIRT526618 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT527226 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT528701 TRAF3IP2 TRAF3 interacting protein 2 2 4
MIRT529981 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT530022 KIAA1875 WD repeat domain 97 2 2
MIRT530238 PLXDC1 plexin domain containing 1 2 2
MIRT530573 ABHD15 abhydrolase domain containing 15 2 2
MIRT530807 GPR182 G protein-coupled receptor 182 2 2
MIRT531755 TXK TXK tyrosine kinase 2 2
MIRT532028 FHDC1 FH2 domain containing 1 2 2
MIRT534310 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT535305 PHF12 PHD finger protein 12 2 2
MIRT537947 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT540257 FAM89A family with sequence similarity 89 member A 2 2
MIRT540369 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT540648 ZNF514 zinc finger protein 514 2 2
MIRT540669 MIS18A MIS18 kinetochore protein A 2 4
MIRT542033 PTRF caveolae associated protein 1 2 2
MIRT542124 DIS3L DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT542350 MED16 mediator complex subunit 16 2 2
MIRT544456 KRBOX4 KRAB box domain containing 4 2 2
MIRT547164 PDZD8 PDZ domain containing 8 2 2
MIRT548162 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT551677 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT551694 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT555324 PPP2CB protein phosphatase 2 catalytic subunit beta 2 2
MIRT555448 POLR3A RNA polymerase III subunit A 2 2
MIRT557269 HMGB1 high mobility group box 1 2 4
MIRT557564 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT563033 CEP72 centrosomal protein 72 2 2
MIRT572904 RUNDC3B RUN domain containing 3B 2 2
MIRT575896 Dis3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT607666 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT608731 MYH9 myosin heavy chain 9 2 2
MIRT608837 PTCHD1 patched domain containing 1 2 2
MIRT609296 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT610291 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT610301 KLHL21 kelch like family member 21 2 2
MIRT610640 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT611035 RRP1B ribosomal RNA processing 1B 2 2
MIRT612595 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT613614 FAM185A family with sequence similarity 185 member A 2 2
MIRT614242 WDR53 WD repeat domain 53 2 4
MIRT615157 SPIB Spi-B transcription factor 2 2
MIRT615549 TNFSF15 TNF superfamily member 15 2 2
MIRT617736 ATCAY ATCAY, caytaxin 2 4
MIRT618237 PGBD4 piggyBac transposable element derived 4 2 2
MIRT618289 ZNF682 zinc finger protein 682 2 2
MIRT618692 CAMK1D calcium/calmodulin dependent protein kinase ID 2 2
MIRT619031 SLC35G1 solute carrier family 35 member G1 2 2
MIRT619053 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT619079 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT619258 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT619659 CORO2A coronin 2A 2 4
MIRT619759 MYO1F myosin IF 2 4
MIRT620183 TRIM72 tripartite motif containing 72 2 2
MIRT620889 ANO7 anoctamin 7 2 2
MIRT620905 MUT methylmalonyl-CoA mutase 2 2
MIRT621044 PPP2R3A protein phosphatase 2 regulatory subunit B''alpha 2 2
MIRT621088 WDR12 WD repeat domain 12 2 2
MIRT621237 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT621448 TCN2 transcobalamin 2 2 2
MIRT621707 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT621721 TRAPPC10 trafficking protein particle complex 10 2 2
MIRT622504 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 4
MIRT623203 MTSS1L MTSS1L, I-BAR domain containing 2 2
MIRT623514 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT623799 GK5 glycerol kinase 5 (putative) 2 4
MIRT624223 CXorf21 chromosome X open reading frame 21 2 2
MIRT625681 SYAP1 synapse associated protein 1 2 2
MIRT625818 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT626154 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626174 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 4
MIRT626202 PNRC1 proline rich nuclear receptor coactivator 1 2 4
MIRT626803 TTPAL alpha tocopherol transfer protein like 2 2
MIRT626912 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT627968 NIPAL1 NIPA like domain containing 1 2 2
MIRT629503 AS3MT arsenite methyltransferase 2 2
MIRT629823 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT630112 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT630643 ELK1 ELK1, ETS transcription factor 2 2
MIRT631462 FBXO47 F-box protein 47 2 2
MIRT631508 FFAR4 free fatty acid receptor 4 2 2
MIRT631740 NKX2-1 NK2 homeobox 1 2 2
MIRT632154 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT632501 RAB13 RAB13, member RAS oncogene family 2 2
MIRT632582 POLQ DNA polymerase theta 2 2
MIRT633103 CBX5 chromobox 5 2 2
MIRT633206 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT633814 WDR92 WD repeat domain 92 2 2
MIRT634081 APOH apolipoprotein H 2 2
MIRT634291 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT634636 HIP1 huntingtin interacting protein 1 2 4
MIRT634883 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT634936 GTF2H2C GTF2H2 family member C 2 2
MIRT635444 SLC25A44 solute carrier family 25 member 44 2 2
MIRT635751 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT636475 KLHL7 kelch like family member 7 2 2
MIRT636869 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637182 TMEM50A transmembrane protein 50A 2 2
MIRT638017 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT638109 YPEL1 yippee like 1 2 2
MIRT638739 FAXC failed axon connections homolog 2 2
MIRT638924 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT639858 TBC1D16 TBC1 domain family member 16 2 2
MIRT640453 IP6K2 inositol hexakisphosphate kinase 2 2 4
MIRT640896 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT641015 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT641259 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT641762 ZNF207 zinc finger protein 207 2 2
MIRT641819 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT641969 PWWP2A PWWP domain containing 2A 2 2
MIRT642223 RABAC1 Rab acceptor 1 2 2
MIRT642330 ZNF573 zinc finger protein 573 2 2
MIRT642473 C16orf58 chromosome 16 open reading frame 58 2 2
MIRT642610 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643113 SMIM7 small integral membrane protein 7 2 2
MIRT643598 SPAG16 sperm associated antigen 16 2 2
MIRT643643 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 2
MIRT643902 TCEB2 elongin B 2 2
MIRT644048 WWC2 WW and C2 domain containing 2 2 2
MIRT644189 LAT2 linker for activation of T-cells family member 2 2 2
MIRT644530 TMEM134 transmembrane protein 134 2 2
MIRT644842 SEC14L4 SEC14 like lipid binding 4 2 2
MIRT645545 RBL1 RB transcriptional corepressor like 1 2 2
MIRT646835 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT647519 PPIE peptidylprolyl isomerase E 2 2
MIRT647786 ASB8 ankyrin repeat and SOCS box containing 8 2 2
MIRT648208 TRIM35 tripartite motif containing 35 2 2
MIRT648267 ZNF582 zinc finger protein 582 2 2
MIRT648368 CYB5A cytochrome b5 type A 2 2
MIRT648452 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT648672 ZNF626 zinc finger protein 626 2 2
MIRT648832 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT648921 ZNF551 zinc finger protein 551 2 2
MIRT649211 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT649728 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT649821 PSMC1 proteasome 26S subunit, ATPase 1 2 2
MIRT650419 FKBP9 FK506 binding protein 9 2 2
MIRT650938 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651025 ZNF699 zinc finger protein 699 2 2
MIRT651604 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652017 TTYH3 tweety family member 3 2 2
MIRT652285 TNS4 tensin 4 2 2
MIRT652335 TMOD3 tropomodulin 3 2 4
MIRT652352 TMOD2 tropomodulin 2 2 4
MIRT652359 TMEM92 transmembrane protein 92 2 2
MIRT652404 TMEM33 transmembrane protein 33 2 2
MIRT652917 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT653393 SLFN13 schlafen family member 13 2 2
MIRT653609 SLC33A1 solute carrier family 33 member 1 2 2
MIRT653858 SHE Src homology 2 domain containing E 2 2
MIRT654009 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT654056 S1PR1 sphingosine-1-phosphate receptor 1 2 2
MIRT654233 RNF165 ring finger protein 165 2 2
MIRT654504 RABIF RAB interacting factor 2 2
MIRT654973 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT655024 PLA2G16 phospholipase A2 group XVI 2 2
MIRT655509 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT655745 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT656186 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT657019 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT657104 JDP2 Jun dimerization protein 2 2 2
MIRT657466 C21orf33 chromosome 21 open reading frame 33 2 2
MIRT658458 FAM13B family with sequence similarity 13 member B 2 2
MIRT658577 EPHB2 EPH receptor B2 2 2
MIRT658696 EMC3 ER membrane protein complex subunit 3 2 2
MIRT658869 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT659038 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659449 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT659591 CEP135 centrosomal protein 135 2 2
MIRT659645 CDK2 cyclin dependent kinase 2 2 2
MIRT660332 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT660548 ARHGAP29 Rho GTPase activating protein 29 2 2
MIRT661925 MLN motilin 2 2
MIRT662388 ICA1L islet cell autoantigen 1 like 2 4
MIRT662936 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT662982 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663592 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT664898 EMC7 ER membrane protein complex subunit 7 2 2
MIRT665117 DNASE2 deoxyribonuclease 2, lysosomal 2 2
MIRT666531 RNF157 ring finger protein 157 2 2
MIRT667341 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT668932 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT669579 AKIRIN1 akirin 1 2 2
MIRT669700 ABHD2 abhydrolase domain containing 2 2 2
MIRT670609 NPHP1 nephrocystin 1 2 2
MIRT670886 CYTIP cytohesin 1 interacting protein 2 2
MIRT670937 LIPG lipase G, endothelial type 2 2
MIRT671957 SPPL3 signal peptide peptidase like 3 2 2
MIRT673112 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT673403 WNT7B Wnt family member 7B 2 2
MIRT673545 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674411 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT676075 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676146 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT676294 SLC25A37 solute carrier family 25 member 37 2 2
MIRT676444 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676502 GJD3 gap junction protein delta 3 2 2
MIRT676625 CSNK1E casein kinase 1 epsilon 2 2
MIRT676658 LRRC27 leucine rich repeat containing 27 2 2
MIRT676693 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT676779 NPHS1 NPHS1, nephrin 2 2
MIRT676788 CXorf38 chromosome X open reading frame 38 2 6
MIRT676939 EMP2 epithelial membrane protein 2 2 2
MIRT676949 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT677098 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677239 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677370 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677490 GTF2H2 general transcription factor IIH subunit 2 2 2
MIRT677539 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT677677 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT677765 GRM6 glutamate metabotropic receptor 6 2 2
MIRT678016 SPIC Spi-C transcription factor 2 2
MIRT678038 CCS copper chaperone for superoxide dismutase 2 2
MIRT678358 PPAP2B phospholipid phosphatase 3 2 2
MIRT678445 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT678508 LCTL lactase like 2 2
MIRT678523 ZNF347 zinc finger protein 347 2 4
MIRT678643 PDCD4 programmed cell death 4 5 3
MIRT678725 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678925 XPOT exportin for tRNA 2 2
MIRT678988 SLC1A5 solute carrier family 1 member 5 2 2
MIRT679073 MANEAL mannosidase endo-alpha like 2 2
MIRT679116 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT679280 MIPOL1 mirror-image polydactyly 1 2 2
MIRT679378 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT679700 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT679714 RPL24 ribosomal protein L24 2 2
MIRT679889 SNX2 sorting nexin 2 2 2
MIRT679936 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT679993 RUNDC1 RUN domain containing 1 2 2
MIRT680064 CD96 CD96 molecule 2 2
MIRT680080 THAP1 THAP domain containing 1 2 2
MIRT680093 SLC35F6 solute carrier family 35 member F6 2 4
MIRT680452 PDE6A phosphodiesterase 6A 2 2
MIRT680489 XIAP X-linked inhibitor of apoptosis 2 2
MIRT681820 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT683311 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT683378 ESR2 estrogen receptor 2 2 2
MIRT683419 ZNF878 zinc finger protein 878 2 2
MIRT683486 ZNF7 zinc finger protein 7 2 2
MIRT683619 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT683682 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683864 OCIAD1 OCIA domain containing 1 2 2
MIRT683938 MYLK3 myosin light chain kinase 3 2 4
MIRT683969 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT684072 TLR7 toll like receptor 7 2 2
MIRT684125 CEP104 centrosomal protein 104 2 2
MIRT684473 INTS7 integrator complex subunit 7 2 2
MIRT684484 GPR137B G protein-coupled receptor 137B 2 2
MIRT684704 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT685188 DCTN5 dynactin subunit 5 2 2
MIRT685238 F2RL1 F2R like trypsin receptor 1 2 2
MIRT685513 MSH3 mutS homolog 3 2 2
MIRT685619 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT685655 C11orf1 chromosome 11 open reading frame 1 2 2
MIRT685701 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685734 C12orf65 chromosome 12 open reading frame 65 2 2
MIRT685775 ZNF426 zinc finger protein 426 2 2
MIRT685876 RTN2 reticulon 2 2 2
MIRT685941 PTGIS prostaglandin I2 synthase 2 2
MIRT686099 TNIP3 TNFAIP3 interacting protein 3 2 2
MIRT686149 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT686278 WWC1 WW and C2 domain containing 1 2 2
MIRT686310 VPS53 VPS53, GARP complex subunit 2 2
MIRT686355 USP15 ubiquitin specific peptidase 15 2 2
MIRT686381 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT686472 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT686484 TRIOBP TRIO and F-actin binding protein 2 2
MIRT686685 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT686821 SLC7A11 solute carrier family 7 member 11 2 2
MIRT686908 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT686977 SERINC1 serine incorporator 1 2 2
MIRT687036 RNF115 ring finger protein 115 2 2
MIRT687071 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT687245 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT687395 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT687640 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687830 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT687853 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT687922 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688023 GPN2 GPN-loop GTPase 2 2 2
MIRT688266 FAM213A family with sequence similarity 213 member A 2 2
MIRT688500 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT688628 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688672 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT688822 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689061 AGMAT agmatinase 2 2
MIRT689116 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689165 ZNF665 zinc finger protein 665 2 2
MIRT689792 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT689837 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT690069 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690688 PTCHD3 patched domain containing 3 2 2
MIRT690731 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT690978 ZNF578 zinc finger protein 578 2 2
MIRT691070 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691323 KIAA1841 KIAA1841 2 2
MIRT691489 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT692063 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT692204 NOL9 nucleolar protein 9 2 2
MIRT692315 RFK riboflavin kinase 2 2
MIRT692375 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692435 METTL8 methyltransferase like 8 2 2
MIRT692472 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT692538 PARD3 par-3 family cell polarity regulator 2 2
MIRT692600 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT692781 SYNPO2L synaptopodin 2 like 2 2
MIRT692872 RBM41 RNA binding motif protein 41 2 2
MIRT692976 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693347 RNF34 ring finger protein 34 2 2
MIRT694048 PRIM1 DNA primase subunit 1 2 2
MIRT694091 KIAA0930 KIAA0930 2 2
MIRT694658 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694811 STX4 syntaxin 4 2 2
MIRT694930 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT695658 MAN2B2 mannosidase alpha class 2B member 2 2 2
MIRT695828 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT695970 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT696179 GNB5 G protein subunit beta 5 2 2
MIRT696328 FAM153B family with sequence similarity 153 member B 2 2
MIRT696858 UBOX5 U-box domain containing 5 2 2
MIRT696900 C14orf105 coiled-coil domain containing 198 2 2
MIRT697242 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697386 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698328 TMEM127 transmembrane protein 127 2 2
MIRT698923 SPEM1 spermatid maturation 1 2 2
MIRT699262 SLC6A4 solute carrier family 6 member 4 2 2
MIRT699313 SLC35F5 solute carrier family 35 member F5 2 4
MIRT699628 SH3BP5 SH3 domain binding protein 5 2 2
MIRT699818 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT700044 RPL14 ribosomal protein L14 2 2
MIRT700100 RNF19B ring finger protein 19B 2 2
MIRT700506 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 2
MIRT700751 PLAA phospholipase A2 activating protein 2 2
MIRT700834 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT701202 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT701292 NUDT3 nudix hydrolase 3 2 2
MIRT701823 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702046 METTL21A methyltransferase like 21A 2 2
MIRT702438 KIAA1549 KIAA1549 2 2
MIRT703033 HAS2 hyaluronan synthase 2 2 4
MIRT703087 GPRIN3 GPRIN family member 3 2 2
MIRT703842 ETV3 ETS variant 3 2 2
MIRT704108 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT704142 DNAL1 dynein axonemal light chain 1 2 2
MIRT704179 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT704192 LDHD lactate dehydrogenase D 2 2
MIRT704758 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705345 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706024 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706040 F2R coagulation factor II thrombin receptor 2 2
MIRT706103 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706346 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706512 MTMR9 myotubularin related protein 9 2 2
MIRT706798 RAI1 retinoic acid induced 1 2 2
MIRT708366 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 2 2
MIRT708653 LYRM7 LYR motif containing 7 2 2
MIRT708813 CDS2 CDP-diacylglycerol synthase 2 2 2
MIRT709069 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709501 RHOH ras homolog family member H 2 2
MIRT709533 ZBED1 zinc finger BED-type containing 1 2 2
MIRT709958 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT710521 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT711654 RAB21 RAB21, member RAS oncogene family 2 2
MIRT711849 AMOTL2 angiomotin like 2 2 2
MIRT712974 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT713935 PIGR polymeric immunoglobulin receptor 2 2
MIRT714303 ZNF454 zinc finger protein 454 2 2
MIRT714609 EXO5 exonuclease 5 2 2
MIRT714993 TSPAN11 tetraspanin 11 2 2
MIRT715730 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT715791 TBL3 transducin beta like 3 2 2
MIRT716541 GOLGA2 golgin A2 2 2
MIRT716624 CRCP CGRP receptor component 2 2
MIRT717144 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT717414 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT717527 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT717916 LRRC15 leucine rich repeat containing 15 2 2
MIRT717971 PXMP4 peroxisomal membrane protein 4 2 2
MIRT718744 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719068 ACOX1 acyl-CoA oxidase 1 2 2
MIRT719098 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 2 2
MIRT719144 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719223 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719923 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 2
MIRT720721 RAPGEF6 Rap guanine nucleotide exchange factor 6 2 2
MIRT721507 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721911 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT722613 TEAD1 TEA domain transcription factor 1 2 2
MIRT722704 ZNF460 zinc finger protein 460 2 2
MIRT722874 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT723730 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT723998 LMTK2 lemur tyrosine kinase 2 2 2
MIRT724002 TMEM174 transmembrane protein 174 2 2
MIRT724383 NEK8 NIMA related kinase 8 2 2
MIRT724547 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT724839 ATAD2B ATPase family, AAA domain containing 2B 2 2
MIRT731116 SSSCA1 Sjogren syndrome/scleroderma autoantigen 1 3 1
MIRT732237 CREB1 cAMP responsive element binding protein 1 3 1
MIRT732355 STAT5B signal transducer and activator of transcription 5B 3 1
MIRT733221 FOXP3 forkhead box P3 3 0
MIRT733222 IGF1R insulin like growth factor 1 receptor 3 0
MIRT733289 PLP2 proteolipid protein 2 3 0
MIRT734121 SNAI2 snail family transcriptional repressor 2 3 0
MIRT734221 BACH2 BTB domain and CNC homolog 2 3 0
MIRT734464 SUFU SUFU negative regulator of hedgehog signaling 3 0
MIRT735346 AGO2 argonaute 2, RISC catalytic component 3 0
MIRT735864 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736321 CDKN1B cyclin dependent kinase inhibitor 1B 3 0
MIRT755475 PDAP1 PDGFA associated protein 1 6 1
MIRT756267 TREM1 triggering receptor expressed on myeloid cells 1 3 1
MIRT756410 BAP1 BRCA1 associated protein 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-150 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-150 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 down-regulated
miR-150 Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 down-regulated
miR-150 cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 down-regualted
miR-150 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-150 Methamphetamine approved 10836 Quantitative real-time PCR CD4+ T cells 24434277 2014 up-regulated
miR-150 Imatinib mesylate approved 123596 Quantitative real-time PCR chronic myeloid leukemia 20460641 2010 up-regulated
miR-150 Imatinib mesylate approved 123596 TaqMan low-density array chronic myeloid leukemia 20460641 2010 up-regulated
miR-150 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-150 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-150 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-150 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-150 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-150 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-150 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-150 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-150 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-150 Tripterygium wilfordii Hook F sensitive tissue
hsa-mir-150 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-150 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-150-5p (1'S,2'S,11'R)-11'-phenylsulfanylspiro[1,3-dioxolane-2,10'-8-oxa-7-azatricyclo[7.4.0.02,7]tridecane]-13'-one 392646 NSC693225 sensitive
hsa-miR-150-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-150-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-phenylcyclobutyl)methanol 385235 NSC676348 sensitive
hsa-miR-150-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 sensitive
hsa-miR-150-5p (11E)-11-(4-iodobutylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 5472476 NSC719211 sensitive
hsa-miR-150-5p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-150-5p (19E,21E,23Z,25Z,27E,29E,31E)-33-[3,5-dihydroxy-6-methyl-4-[[2-(4-methylpiperazin-1-yl)acetyl]amino]oxan-2-yl]oxy-N-[2-(dimethylamino)ethyl]-1,3,5,7,9,13,37-heptahydroxy-17-[5-hydroxy-7-[4-(methylamino)phenyl]-7-oxoheptan-2-yl]-18-methyl-11,15-dioxo-16,39 5472916 NSC722659 sensitive
hsa-miR-150-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-150-5p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-150-5p (1Z)-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-(2-methylanilino)-2-oxoethanimidoyl cyanide 5466280 NSC683608 sensitive
hsa-miR-150-5p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-150-5p (2E)-2-[(3,4-dimethoxyphenyl)methylidene]-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 21141940 NSC639516 sensitive
hsa-miR-150-5p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-150-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-150-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-150-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-150-5p (2R,6R)-9,11-dibromo-5-oxa-10-thia-3-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 383027 NSC671009 sensitive
hsa-miR-150-5p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-150-5p (2S,4S,5S,8R,11Z,15S)-8,28-dihydroxy-5-methyl-3-oxa-16-azaheptacyclo[15.12.0.02,4.02,8.04,15.018,27.020,25]nonacosa-1(29),11,17,20,22,24,27-heptaen-9,13-diyne-7,19,26-trione 54608726 NSC670656 sensitive
hsa-miR-150-5p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-150-5p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-150-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-150-5p (3,4,4-trichloro-2-nitro-1-phenylsulfanylbuta-1,3-dienyl)sulfanylbenzene 379911 NSC665103 sensitive
hsa-miR-150-5p (3e)-3-[(2-chloro-5-methoxy-6-methyl-1h-indol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471478 NSC711618 sensitive
hsa-miR-150-5p (3E)-3-[(3-hydroxyphenyl)methylidene]chromen-4-one 5386998 NSC619390 sensitive
hsa-miR-150-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-150-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-150-5p (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-150-5p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-150-5p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-150-5p (3E,5E)-1-methyl-3,5-bis[(2-nitrophenyl)methylidene]piperidin-4-one;hydrochloride 5468196 NSC666038 sensitive
hsa-miR-150-5p (3E,5E)-3,5-bis[(3,4-dichlorophenyl)methylidene]-1-[3-(dimethylamino)propanoyl]piperidin-4-one;hydrochloride 5388808 NSC638645 sensitive
hsa-miR-150-5p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-150-5p (3s,6s)-3,6-bis(5-bromo-1h-indol-3-yl)piperazine-2,5-dione 6712394 NSC679833 sensitive
hsa-miR-150-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-150-5p (3s,8r,9s,10r,13s,14s,16e,17e)-17-hydroxyimino-16-[(4-methoxyphenyl)methylidene]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-ol 9572507 NSC718185 sensitive
hsa-miR-150-5p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-150-5p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-150-5p (3Z,5E)-3,5-dibenzylidene-1-[(E)-3-phenylprop-2-enoyl]piperidin-4-one 5351375 NSC638634 sensitive
hsa-miR-150-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(dimethylamino)propanoyl]piperidin-4-one 6477768 NSC634784 sensitive
hsa-miR-150-5p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-150-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-150-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-150-5p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-150-5p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828 NSC719362 sensitive
hsa-miR-150-5p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-150-5p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-150-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-150-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-150-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-150-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-150-5p (6aS)-3-[3-[4-[3-[[(6aS)-8,8-difluoro-2-methoxy-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propyl]piperazin-1-yl]propoxy]-8,8-difluoro-2-methoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-11-one 44204058 NSC744331 sensitive
hsa-miR-150-5p (6aS)-3-[4-[6-(4-fluorophenyl)-2-methylpyrimidin-4-yl]oxybutoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 405944 NSC723732 sensitive
hsa-miR-150-5p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-150-5p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-150-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-150-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-150-5p (E)-1-(3,4-dimethoxyphenyl)-3-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl]prop-2-en-1-one 54599698 NSC750746 sensitive
hsa-miR-150-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-150-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-150-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-150-5p (e)-3-(1,3-benzodioxol-5-yl)-1-(3,5-ditert-butyl-4-hydroxyphenyl)prop-2-en-1-one 5471158 NSC709102 sensitive
hsa-miR-150-5p (E)-3-(3,4-dihydroxyphenyl)-N-[(8R,9S,13S,14S,17S)-3-methoxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]prop-2-enamide 11546817 NSC734307 sensitive
hsa-miR-150-5p (e)-3-(4-chlorophenyl)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]prop-2-en-1-one 25113941 NSC743862 sensitive
hsa-miR-150-5p (E)-3-(6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 50908742 NSC750743 sensitive
hsa-miR-150-5p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-150-5p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-150-5p (e)-3-chloro-3-(3,4-dimethoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387397 NSC623176 sensitive
hsa-miR-150-5p (E)-but-2-enedioic acid;1-[[3-(diethylamino)-2-hydroxypropyl]amino]-4-(oxiran-2-ylmethylamino)anthracene-9,10-dione 5388837 NSC639366 sensitive
hsa-miR-150-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 sensitive
hsa-miR-150-5p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-150-5p (ne)-n-[(3e,8r,9s,10r,13s,14s,16e)-16-[(3,4-dimethoxyphenyl)methylidene]-3-hydroxyimino-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthren-17-ylidene]hydroxylamine 9572443 NSC716260 sensitive
hsa-miR-150-5p (z)-2-(9h-carbazol-2-yloxy)-n-methoxy-1-(4-methoxyphenyl)ethanimine 11405724 NSC726373 resistant
hsa-miR-150-5p (z)-4-bromo-4-iodo-3-phenyl-3-buten-2-one 3004479 NSC657561 sensitive
hsa-miR-150-5p [(1R)-1-[[(2S)-2-amino-3-naphthalen-1-ylpropanoyl]amino]-3-methylbutyl]boronic acid;hydrochloride 387440 NSC681229 sensitive
hsa-miR-150-5p [(1R,2S,6R,9Z)-9-(acetyloxymethyl)-4-(hydroxymethyl)-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradec-9-en-2-yl] 2-methylprop-2-enoate 5468206 NSC666113 sensitive
hsa-miR-150-5p [(1s,2r)-1-benzamido-3-[[(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-2-benzoyloxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl]oxy]-3-oxo-1- 16129931 NSC705435 sensitive
hsa-miR-150-5p [(1s,2s,3r,4r,7r,8r,11s,14r,15r,17s)-15-hydroxy-14-methoxy-4,8,11,15-tetramethyl-9-oxo-10,18-dioxatetracyclo[9.7.0.02,7.03,17]octadecan-4-yl] butanoate 11015858 NSC737077 sensitive
hsa-miR-150-5p [(1s,4s,7r,9s,10s,12r)-4,12-diacetyloxy-15-[3-[(3-chlorobenzoyl)amino]-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-2-y 6712240 NSC662158 sensitive
hsa-miR-150-5p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-150-5p [(2S,3S)-3-[(E)-3-(3,4-diacetyloxyphenyl)prop-2-enoyl]oxybutan-2-yl] (E)-3-(3,4-diacetyloxyphenyl)prop-2-enoate 5470293 NSC699168 sensitive
hsa-miR-150-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-150-5p [(3S)-3-[tert-butyl(diphenyl)silyl]oxy-4-(2-methoxyethoxymethoxy)-4-methylpentyl] acetate 357861 NSC617394 sensitive
hsa-miR-150-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-150-5p [(3S,10R,13S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-3-pyrrolidin-1-yl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-17-yl] acetate 24204019 NSC730460 sensitive
hsa-miR-150-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-150-5p [(5S,8R,9S,10S,13S,14S,17S)-10,13-dimethyl-3-oxo-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320803 NSC269721 sensitive
hsa-miR-150-5p [(z)-[2-[[6-[[2-[(z)-(carbamothioylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]thiourea 54611756 NSC715648 resistant
hsa-miR-150-5p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-150-5p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-150-5p [2-(4-methoxyphenyl)quinolin-4-yl]-piperidin-2-ylmethanol;dihydrochloride 91885392 NSC23925 sensitive
hsa-miR-150-5p [2-(5-fluoro-2,4-dioxopyrimidin-1-yl)-6-methyl-5-oxo-2h-pyran-4-yl] acetate 358202 NSC618093 sensitive
hsa-miR-150-5p [2-[(2E)-2-[1-(2-hydroxyphenyl)-2-(3-oxo-1H-2-benzofuran-1-yl)ethylidene]hydrazinyl]-2-oxoethyl]-trimethylazanium;chloride 135483962 NSC647614 sensitive
hsa-miR-150-5p [2-amino-9-[3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1H-purin-6-ylidene]sulfanium;(2-hydroxy-5-nitrophenyl)mercury 135403618 NSC321239 sensitive
hsa-miR-150-5p [3-(chloromethyl)indolin-1-yl]-(5,6,7-trimethoxy-1h-indol-2-yl)methanone 393954 NSC696990 sensitive
hsa-miR-150-5p [3-(furan-2-carbonyl)-2-thioxo-imidazolidin-1-yl]-(2-furyl)methanone 396757 NSC703467 sensitive
hsa-miR-150-5p [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-150-5p [3-[(3E,5E)-3,5-dibenzylidene-4-oxopiperidin-1-yl]-3-oxopropyl]-trimethylazanium;bromide 5388801 NSC638635 sensitive
hsa-miR-150-5p [3-[[5-(4-amino-2-oxopyrimidin-1-yl)-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-2-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 394836 NSC698688 sensitive
hsa-miR-150-5p [3-butanoyloxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl butanoate 379286 NSC663792 sensitive
hsa-miR-150-5p [3-keto-bmt(sup 1)]-[val(sup 2)]-cyclosporin 5467197 NSC648265 sensitive
hsa-miR-150-5p [3,4,5-triacetyloxy-6-(1-cyano-2-sulfanylidene-4-thiophen-2-yl-5,6-dihydrobenzo[f]isoquinolin-3-yl)oxan-2-yl]methyl acetate 386291 NSC678049 sensitive
hsa-miR-150-5p [3,4,5-triacetyloxy-6-[(4Z)-4-[(4-chlorophenyl)methylidene]-5-oxo-1-prop-2-enylimidazol-2-yl]sulfanyloxan-2-yl]methyl acetate 5470570 NSC703037 resistant
hsa-miR-150-5p [3,4,5-triacetyloxy-6-[4-(4-chlorophenyl)-3-cyano-7,7-dimethyl-5-oxo-2-sulfanylidene-6,8-dihydroquinolin-1-yl]oxan-2-yl]methyl acetate 385412 NSC676591 sensitive
hsa-miR-150-5p [4-(5,8-diacetyloxy-1-tetracyclo[6.6.0.02,7.09,14]tetradeca-2(7),3,5,9,11,13-hexaenyl)phenyl] acetate 231714 NSC28365 sensitive
hsa-miR-150-5p [4-[(E)-[3-[(dimethylamino)methyl]-2-oxocyclopentylidene]methyl]phenoxy]methyl propanoate;hydrochloride 50988761 NSC639514 sensitive
hsa-miR-150-5p [4-amino-2-[(4-methoxyphenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399016 NSC709437 sensitive
hsa-miR-150-5p [4-fluoro-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 380992 NSC666869 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] [5-[5-fluoro-4-(hexadecylamino)-2-oxopyrimidin-1-yl]-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 387052 NSC680420 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] butanoate 379284 NSC663790 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-[[[5-[4-(hexadecanoylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl] acetate 390212 NSC687369 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methoxy-N-(1-methoxy-1-oxo-3-phenylpropan-2-yl)phosphonamidic acid 384407 NSC674182 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl (2-hydroxy-3-octadecoxypropyl) hydrogen phosphate 387050 NSC680418 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl bis(2,2,2-trichloroethyl) phosphate 382829 NSC670653 sensitive
hsa-miR-150-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl butanoate 379285 NSC663791 sensitive
hsa-miR-150-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] 2-phenoxyacetate 9555563 NSC185057 sensitive
hsa-miR-150-5p [6-methoxy-3,4-bis-(4-methylphenyl)sulfonyloxyoxan-2-yl]methyl 4-methylbenzenesulfonate 359615 NSC620674 resistant
hsa-miR-150-5p [6,7-difluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-phenylmethanone 406024 NSC723906 sensitive
hsa-miR-150-5p [7-chloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635647 NSC728078 sensitive
hsa-miR-150-5p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-150-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-150-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-150-5p 1-(3-methoxyphenyl)-4-phenyl-[1,2,4]triazolo[4,3-a]quinoxaline 399100 NSC709516 sensitive
hsa-miR-150-5p 1-(4'-phthalimidopropyl-carbonyl)-5-fluorouracil 388985 NSC684405 sensitive
hsa-miR-150-5p 1-(4-chloronaphthalen-1-yl)-2-(dimethylamino)ethanol 4-methylbenzenesulfonate(1:1) 230791 NSC26074 sensitive
hsa-miR-150-5p 1-(4-chlorophenyl)-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135424828 NSC674103 sensitive
hsa-miR-150-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-150-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-150-5p 1-[(3-chloro-2-hydroxypropyl)amino]-4-[[3-(diethylamino)-2-hydroxypropyl]amino]anthracene-9,10-dione;hydrochloride 368387 NSC639365 sensitive
hsa-miR-150-5p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-150-5p 1-[[4-[(4-methoxy-6-nitroacridin-9-yl)amino]phenyl]sulfonyl]guanidine 391138 NSC689864 sensitive
hsa-miR-150-5p 1-[4-[4-[(5-fluoro-2,4-dioxopyrimidin-1-yl)methyl]triazol-1-yl]-5-[[(4-methoxyphenyl)-diphenylmethoxy]methyl]oxolan-2-yl]-5-methylpyrimidine-2,4-dione 392020 NSC691819 sensitive
hsa-miR-150-5p 1-[4-[tert-butyl(dimethyl)silyl]oxy-5-[[tert-butyl(dimethyl)silyl]oxymethyl]oxolan-2-yl]-5-fluoropyrimidine-2,4-dione 388209 NSC682803 sensitive
hsa-miR-150-5p 1-[5-[[[4-chlorobutyl(2,3-dihydroxypropyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-4-hydroxyoxolan-2-yl]-5-fluoropyrimidine-2,4-dione 24205136 NSC734430 sensitive
hsa-miR-150-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-ethynyl-6-iodopyrimidine-2,4-dione 45028651 NSC743558 sensitive
hsa-miR-150-5p 1-[6,7-dichloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]ethanone 403949 NSC719715 sensitive
hsa-miR-150-5p 1-allyl-3-[(z)-(5-nitro-2-oxo-indolin-3-ylidene)amino]thiourea 135426761 NSC716765 sensitive
hsa-miR-150-5p 1-allyl-3-[(z)-[1-(morpholinomethyl)-5-nitro-2-oxo-indolin-3-ylidene]amino]thiourea NSC716768 sensitive
hsa-miR-150-5p 1-azido-2-phenyl-3-phenalenone 381891 NSC669152 sensitive
hsa-miR-150-5p 1-benzyl-3-chloro-4-(3-chloro-2-methylanilino)pyrrole-2,5-dione 1570150 NSC727885 sensitive
hsa-miR-150-5p 1-benzyl-3-chloro-4-(3-chloroanilino)pyrrole-2,5-dione 1554887 NSC727759 sensitive
hsa-miR-150-5p 1-di(propan-2-yloxy)phosphoryl-n'-[4-[[di(propan-2-yloxy)phosphoryl-[2-(4-nitrophenyl)hydrazinyl]methylidene]amino]phenyl]-n-(4-nitroanilino)methanimidamide 3838849 NSC652151 sensitive
hsa-miR-150-5p 1-ethoxy-4-[(E)-2-nitroethenyl]benzene 762460 NSC57187 sensitive
hsa-miR-150-5p 11-ethyl-4,5,12-trimethyl-6-thia-1,8,11-triazatricyclo[7.4.0.03,7]trideca-3(7),4,8,12-tetraen-2-one 45028557 NSC743244 sensitive
hsa-miR-150-5p 11-hydroxyusambarine chlorhydrate 401426 NSC715082 sensitive
hsa-miR-150-5p 11-pyridin-2-yl-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 4595742 NSC686554 sensitive
hsa-miR-150-5p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-150-5p 13-benzoyl-18,19-dimethoxy-5,7-dioxa-13-azapentacyclo[10.7.1.02,10.04,8.016,20]icosa-1(20),2,4(8),9,16,18-hexaene-12-carbonitrile 363096 NSC627666 resistant
hsa-miR-150-5p 14,16-bis[3-(dimethylamino)propyl]-4-methoxy-10-nitro-8,14,16-triazatetracyclo[7.7.1.02,7.013,17]heptadeca-1,3,5,7,9,11,13(17)-heptaene-15-thione;hydrochloride 392049 NSC691845 sensitive
hsa-miR-150-5p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-150-5p 170d343 259210 NSC88915 sensitive
hsa-miR-150-5p 1h-imidazole-4-carboxamide, 5-(3-methyl-1-tetrazenyl)- 135493930 NSC684047 sensitive
hsa-miR-150-5p 1h-indole, 5-bromo-3-[2-(2-pyridinyl)-4-thiazolyl]- 397551 NSC705871 sensitive
hsa-miR-150-5p 2-(2-furyl)-4-(2-nitrophenyl)-1-(4-pyridyl)-4a,7a-dihydro-4h-furo[3,4-b]pyridine-5,7-dione NSC692577 sensitive
hsa-miR-150-5p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-150-5p 2-(4-amino-3-bromopyrrolo[2,3-d]pyridazin-1-yl)-5-(hydroxymethyl)oxolane-3,4-diol 365915 NSC634037 sensitive
hsa-miR-150-5p 2-(4-chloro-2-methylanilino)-n-[(e)-(2-chlorophenyl)methylideneamino]-6-(trifluoromethyl)pyridine-3-carboxamide 46227884 NSC747198 sensitive
hsa-miR-150-5p 2-(4-chlorophenoxy)-1-[5-hydroxy-3-(5-nitrofuran-2-yl)-5-phenyl-4,5-dihydro-1h-pyrazol-1-yl]ethanone 367872 NSC638038 sensitive
hsa-miR-150-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-150-5p 2-(4-chlorophenyl)-2-(4-hydroxyiminocyclohexa-2,5-dien-1-ylidene)acetonitrile 346832 NSC405158 sensitive
hsa-miR-150-5p 2-(4-fluoroanilino)-N-[[1-[(3-phenoxyphenyl)methyl]triazol-4-yl]methyl]pyridine-3-carboxamide 90680998 NSC758359 resistant
hsa-miR-150-5p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-150-5p 2-(4-methylphenoxy)aniline 88730 NSC624229 sensitive
hsa-miR-150-5p 2-(8-(4-methoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl)hydrazinecarboxamide NSC667911 sensitive
hsa-miR-150-5p 2-(diethylaminomethyl)-4-[(10-methylindolo[3,2-b]quinolin-11-yl)amino]phenol;hydrochloride 373149 NSC649091 sensitive
hsa-miR-150-5p 2-[(2-aminophenyl)sulfanylmethyl]-3-methoxy-xanthen-9-one 330512 NSC319447 sensitive
hsa-miR-150-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-150-5p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxycyclohexa-2,5-diene-1,4-dione;hydrochloride 5387996 NSC630511 sensitive
hsa-miR-150-5p 2-[(e)-(2-methyl-6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)methylideneamino]guanidine;hydrochloride 24204549 NSC732178 sensitive
hsa-miR-150-5p 2-[(e)-(2-methyl-6-thiophen-3-ylimidazo[2,1-b][1,3]thiazol-5-yl)methylideneamino]guanidine;hydrochloride 24204551 NSC732179 sensitive
hsa-miR-150-5p 2-[(e)-[6-(2,4-dichloro-5-nitrophenyl)-2,3-dimethylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572631 NSC722877 sensitive
hsa-miR-150-5p 2-[(e)-[6-(3,6-dimethoxy-2-nitrophenyl)-2-propylimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 9572654 NSC723548 sensitive
hsa-miR-150-5p 2-[(E)-2-(1,3-benzodioxol-5-yl)ethenyl]-5-(5-methyl-1H-pyrazol-3-yl)-1,3,4-oxadiazole 155808300 NSC763646 sensitive
hsa-miR-150-5p 2-[(E)-3-bromo-2,3-dichloro-1-nitroprop-2-enylidene]imidazolidine 3005154 NSC678033 sensitive
hsa-miR-150-5p 2-[[(e)-(4-methoxyphenyl)iminocarbamoyl]amino]-4-methyl-pentanamide 390563 NSC688071 sensitive
hsa-miR-150-5p 2-[[[4-chlorobutyl(methyl)amino]-[[5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methoxy]phosphoryl]oxymethyl]-5-methoxy-1-methylindole-4,7-dione 404843 NSC721387 sensitive
hsa-miR-150-5p 2-[[1H-benzimidazol-2-ylmethyl(benzyl)amino]methyl]-6-[[bis(1H-benzimidazol-2-ylmethyl)amino]methyl]-4-methylphenol;hydrochloride 386989 NSC680300 sensitive
hsa-miR-150-5p 2-[1-[(z)-3-(4-chlorophenyl)-1-(3,4-dimethoxyphenyl)-3-oxoprop-1-en-2-yl]pyridin-2-ylidene]propanedinitrile 5470857 NSC705928 sensitive
hsa-miR-150-5p 2-[16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaen-4-yl]acetonitrile 391834 NSC691421 resistant
hsa-miR-150-5p 2-[3-methyl-N-(2-methylsulfonyloxyethyl)-4-[[4-(2-methyl-1,3-thiazol-4-yl)phenyl]iminomethyl]anilino]ethyl methanesulfonate;hydrochloride 24194270 NSC166237 sensitive
hsa-miR-150-5p 2-[4-[(2e)-2-[[(1e)-2-[4-(carboxymethoxy)-2,3-dichlorophenyl]-1-[5-(4-fluorophenyl)dithiol-3-ylidene]-2-oxoethyl]disulfanyl]-2-[5-(4-fluorophenyl)dithiol-3-ylidene]acetyl]-2,3-dichlorophenoxy]acetic a 3000383 NSC641283 sensitive
hsa-miR-150-5p 2-[4-[(e)-(4-oxochromen-3-ylidene)methyl]phenoxy]-n-(1,3-thiazol-2-yl)acetamide 45028758 NSC744063 sensitive
hsa-miR-150-5p 2-[4-[(z)-(4-oxothiochromen-3-ylidene)methyl]phenoxy]-n-(1,3-thiazol-2-yl)acetamide 45028765 NSC744070 sensitive
hsa-miR-150-5p 2-[4-[[2-(2,4-dinitrophenyl)hydrazinyl]diazenyl]phenyl]-1h-benzimidazole 6712853 NSC716951 sensitive
hsa-miR-150-5p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-150-5p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 sensitive
hsa-miR-150-5p 2-acetamido-N-(4-chloro-3-oxo-1-phenylbutan-2-yl)-4-methylpentanamide 299926 NSC173905 sensitive
hsa-miR-150-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-150-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-150-5p 2-amino-4-(2-hydroxy-4-methylphenyl)-5-phenylpyrimidine 392744 NSC693547 sensitive
hsa-miR-150-5p 2-amino-4-(3,4-dimethoxyphenyl)-10-methyl-5,6-dihydro-[1]benzothiepino[4,5-c]pyridine-1-carbonitrile 391881 NSC691562 sensitive
hsa-miR-150-5p 2-amino-4-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-6-morpholin-4-ylpyrimidine-5-carbonitrile 24204821 NSC733008 sensitive
hsa-miR-150-5p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-150-5p 2-amino-6-ethylsulfanyl-4-(furan-2-yl)pyridine-3,5-dicarbonitrile 745534 NSC731356 sensitive
hsa-miR-150-5p 2-amino-6-methyl-5-pyridin-4-ylsulfanyl-3H-quinazolin-4-one 135400184 NSC648316 sensitive
hsa-miR-150-5p 2-amino-8-fluoro-4,6-dimethyl-3-oxo-1-n,9-n-bis[7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3,10-di(propan-2-yl)-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]phenoxazine-1,9-dicarboxamide 383041 NSC671031 sensitive
hsa-miR-150-5p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 sensitive
hsa-miR-150-5p 2-amino-N-[4-chloro-2-(1H-pyrrole-2-carbonyl)phenyl]acetamide 284708 NSC140873 sensitive
hsa-miR-150-5p 2-bromo-5-methoxybenzal-2',3'-dimethoxy-5-naphthylamine 387181 NSC680717 sensitive
hsa-miR-150-5p 2-bromochalcone 5918180 NSC700203 sensitive
hsa-miR-150-5p 2-butenoic acid, 3-[(1,3-dihydroxy-2-naphthalenyl)thio]-, ethyl ester, (z)- 5358773 NSC278632 sensitive
hsa-miR-150-5p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 sensitive
hsa-miR-150-5p 2-hydroxy-6,6-dimethyl-4-[(e)-(p-tolylhydrazono)methyl]cyclohexa-2,4-diene-1,1,3-tricarbonitrile 9571495 NSC672219 sensitive
hsa-miR-150-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-150-5p 2-isoquinolin-2-ium-2-yl-1-phenanthren-3-ylethanone;iodide 5351160 NSC35489 sensitive
hsa-miR-150-5p 2-mercapto-6-(2-phenylhydrazino)-4-pyrimidinol 3005146 NSC677260 sensitive
hsa-miR-150-5p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-150-5p 2-methyl-n-[3-[methyl-[3-[(2-methylbenzo[g]indazole-3-carbonyl)amino]propyl]amino]propyl]benzo[g]indazole-3-carboxamide 403555 NSC718579 sensitive
hsa-miR-150-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(3,4,5-trimethoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028707 NSC743876 sensitive
hsa-miR-150-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(4-methoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028705 NSC743874 sensitive
hsa-miR-150-5p 2-phenyl-N-[3-[4-[3-[(2-phenylquinoline-4-carbonyl)amino]propyl]piperazin-1-yl]propyl]quinoline-4-carboxamide;hydrochloride 384385 NSC674092 sensitive
hsa-miR-150-5p 2-propenyl estradiol 5468270 NSC667047 sensitive
hsa-miR-150-5p 2,1,3-benzoselanadiazole, nitro-6-(trifluoromethyl)- 362897 NSC627371 sensitive
hsa-miR-150-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-150-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-150-5p 2,3-dibromo-4-(5-chloro-2-methoxyanilino)-4-oxobutanoic acid 307450 NSC205555 sensitive
hsa-miR-150-5p 2,3,6,7-tetrabenzoylthiopyrano[3,2-b]thiopyran-4,8-dione 399527 NSC710391 sensitive
hsa-miR-150-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-150-5p 2,5-dibenzyl-2-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368538 NSC639617 sensitive
hsa-miR-150-5p 2,6-dibenzylidenecyclohexanone 1550330 NSC40618 sensitive
hsa-miR-150-5p 2,6-dichloro-7-[4-(4-methylphenoxy)-5-[(4-methylphenoxy)methyl]oxolan-2-yl]purine 389535 NSC685833 sensitive
hsa-miR-150-5p 2,6-dimethoxy-4-[7-methyl-6-(2-phenylhydrazinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl]phenol NSC671173 sensitive
hsa-miR-150-5p 2,6-dimethyl-4-(3-nitrophenyl)-3-n,5-n-bis(4-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxamide 367764 NSC637703 sensitive
hsa-miR-150-5p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 sensitive
hsa-miR-150-5p 2[4'aminobiphenyl]5,6dichlorobenzimidazole 24205088 NSC734231 sensitive
hsa-miR-150-5p 2h-1-benzopyran-2-one, 4-(2-benzofuranyl)-7-methoxy- 364364 NSC630375 resistant
hsa-miR-150-5p 3-(2-(5-bromo-2-hydroxyphenyl)-3-chloro-4-oxo-1-azetidinyl)-4(3h)-quinazolinone 373572 NSC650025 sensitive
hsa-miR-150-5p 3-(2-aminoethylsulfanyl)propanoic acid 420295 NSC122621 sensitive
hsa-miR-150-5p 3-(2-fluoro-2,2-dinitro-ethoxy)propane-1,2-diol 388365 NSC683260 sensitive
hsa-miR-150-5p 3-(4-bromophenyl)-2-methylbenzo[f]benzimidazole-4,9-dione 229013 NSC22348 sensitive
hsa-miR-150-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 sensitive
hsa-miR-150-5p 3-(4-fluorophenyl)-3-(4-hydroxy-2-methylphenyl)phthalide 387973 NSC682335 resistant
hsa-miR-150-5p 3-(4-fluorophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388534 NSC683516 sensitive
hsa-miR-150-5p 3-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(2,3-dichlorophenyl)benzamide 1574647 NSC728128 sensitive
hsa-miR-150-5p 3-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-[2-chloro-5-(trifluoromethyl)phenyl]benzamide 1574661 NSC732851 sensitive
hsa-miR-150-5p 3-[(3,5-dibenzyloxyphenyl)-(4-hydroxy-2-oxo-chromen-3-yl)methyl]-4-hydroxy-chromen-2-one 54682817 NSC686385 sensitive
hsa-miR-150-5p 3-[(3,5-dichlorobenzyl)(methyl)amino]-1,2-diphenylpropan-1-one 360991 NSC623723 sensitive
hsa-miR-150-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 sensitive
hsa-miR-150-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive