>DUSP5|NM_004419|3'UTR
   1 AACTGGGATGGAGGAATCGGCCCAGCCCCAAGAGCAACTGTGATTTTTGTTTTTAAGACTCATGGACATTTCATACCTGT
  81 GCAATACTGAAGACCTCATTCTGTCATGCTGCCCCAGTGAGATAGTGAGTGGTCACCAGGCTTGCAAATGAACTTCAGAC
 161 GGACCTCAGGGTAGGTTCTCGGGACTGAAGGAAGGCCAAGCCATTACGGGAGCACAGCATGTGCTGACTACTGTACTTCC
 241 AGACCCCTGCCCTCTTGGGACTGCCCAGTCCTTGCACCTCAGAGTTCGCCTTTTCATTTCAAGCATAAGGCAATAAATAC
 321 CTGCAGCAACGTGGGAGAAAGAAGTTGCTGGACCAGGAGAAAAGGCAGTTATGAAGCCAATTCATTTTGAAGGAAGCACA
 401 ATTTCCACCTTATTTTTTGAACTTTGGCAGTTTCAATGTCTGTCTCTGTTGCTTCGGGGCATAAGCTGATCACCGTCTAG
 481 TTGGGAAAGTAACCCTACAGGGTTTGTAGGGACATGATCAGCATCCTGATTTGAACCCTGAAATGTTGTGTAGACACCCT
 561 CTTGGGTCCAATGAGGTAGTTGGTTGAAGTAGCAAGATGTTGGCTTTTCTGGATTTTTTTTGCCATGGGTTCTTCACTGA
 641 CCTTGGACTTTGGCATGATTCTTAGTCATACTTGAACTTGTCTCATTCCACCTCTTCTCAGAGCAACTCTTCCTTTGGGA
 721 AAAGAGTTCTTCAGATCATAGACCAAAAAAGTCATACCTTCGAGGTGGTAGCAGTAGATTCCAGGAGGAGAAGGGTACTT
 801 GCTAGGTATCCTGGGTCAGTGGCGGTGCAAACTGGTTTCCTCAGCTGCCTGTCCTTCTGTGTGCTTATGTCTCTTGTGAC
 881 AATTGTTTTCCTCCCTGCCCCTGGAGGTTGTCTTCAAGCTGTGGACTTCTGGGATTTGCAGATTTTGCAACGTGGTACTA
 961 CTTTTTTTTTCTTTTTGTCTGTTAGTTATTTCTCCAGGGGAAAAGGCAATAATTTTCTAAGACCCGTGTGAATGTGAAGA
1041 AAAGCAGTATGTTACTGGTTGTTGTTGTTGTTCTTGTTTTTTATAGTGTAAAATAAAAATAGTAAAAGGAGAAAAGCAAA
1121 AAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agugGUAACG-AU-UUCACGUUAa 5' |||| | || ||||||| Target 5' tggaCATTTCATACCTGTGCAATa 3'	63 - 86	150.00	-8.20
2	miRNA 3' agUGGUAACGAUUUCACGUUaa 5' ::|| || : :|||||| Target 5' ggGTCAGTG--GCGGTGCAAac 3'	813 - 832	128.00	-7.80
3	miRNA 3' agugguAACGAUUUCACGUUaa 5' || :|| ||||:|| Target 5' tcttgtTTTTTATAGTGTAAaa 3'	1072 - 1093	124.00	-6.20

Mutant ID	Mutant Position	Mutant Source
COSN31597144	19	COSMIC
COSN31538850	76	COSMIC
COSN31565491	133	COSMIC
COSN28878440	197	COSMIC
COSN1112324	427	COSMIC
COSN31536557	622	COSMIC
COSN31566792	662	COSMIC
COSN31532961	819	COSMIC
COSN26632630	972	COSMIC
COSN1112325	1071	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1412427747	5	dbSNP
rs573652749	8	dbSNP
rs1384409618	9	dbSNP
rs1161107205	10	dbSNP
rs1399049021	13	dbSNP
rs771381831	17	dbSNP
rs376836082	19	dbSNP
rs116944066	20	dbSNP
rs1443611560	21	dbSNP
rs1301766020	22	dbSNP
rs959789119	27	dbSNP
rs1207698940	28	dbSNP
rs370971133	29	dbSNP
rs1236098475	30	dbSNP
rs1274904963	31	dbSNP
rs763062919	33	dbSNP
rs1221609786	39	dbSNP
rs764415977	41	dbSNP
rs1285338191	45	dbSNP
rs997792806	54	dbSNP
rs1029080263	60	dbSNP
rs1320048807	68	dbSNP
rs1436000495	76	dbSNP
rs1391124127	85	dbSNP
rs191238050	88	dbSNP
rs1403427103	92	dbSNP
rs1412850387	103	dbSNP
rs1163750430	105	dbSNP
rs1473769960	106	dbSNP
rs1006198119	114	dbSNP
rs1307078747	115	dbSNP
rs544874123	116	dbSNP
rs1449640723	118	dbSNP
rs559992124	119	dbSNP
rs1286022595	124	dbSNP
rs1318982832	130	dbSNP
rs1219562201	136	dbSNP
rs77749205	137	dbSNP
rs1212146689	146	dbSNP
rs1469020149	146	dbSNP
rs918199494	154	dbSNP
rs1296893537	161	dbSNP
rs1229256761	163	dbSNP
rs1236940987	169	dbSNP
rs779267431	170	dbSNP
rs911161328	181	dbSNP
rs750680883	182	dbSNP
rs1324044533	194	dbSNP
rs1178171548	196	dbSNP
rs970919826	207	dbSNP
rs1039042810	208	dbSNP
rs35610668	208	dbSNP
rs980910591	209	dbSNP
rs901803567	220	dbSNP
rs1364878332	243	dbSNP
rs575745731	245	dbSNP
rs76623091	247	dbSNP
rs886510054	248	dbSNP
rs1247586709	250	dbSNP
rs531658390	251	dbSNP
rs1394755721	252	dbSNP
rs945731046	255	dbSNP
rs1041626715	259	dbSNP
rs57113606	279	dbSNP
rs780016199	284	dbSNP
rs1206552207	288	dbSNP
rs546379805	289	dbSNP
rs1276661322	291	dbSNP
rs148448051	296	dbSNP
rs1368580096	304	dbSNP
rs1275163589	314	dbSNP
rs1016819143	330	dbSNP
rs1050264957	331	dbSNP
rs1307308811	334	dbSNP
rs1430390972	335	dbSNP
rs1355765056	341	dbSNP
rs906125999	342	dbSNP
rs1462598677	367	dbSNP
rs1328659315	373	dbSNP
rs565310822	377	dbSNP
rs564582088	381	dbSNP
rs1035363252	400	dbSNP
rs959734208	402	dbSNP
rs1281073460	410	dbSNP
rs1376620377	414	dbSNP
rs1209524247	419	dbSNP
rs1312946033	422	dbSNP
rs988424411	426	dbSNP
rs1020018484	431	dbSNP
rs142624976	437	dbSNP
rs1287558733	443	dbSNP
rs1410285784	445	dbSNP
rs1375455572	447	dbSNP
rs1446688684	449	dbSNP
rs548145148	456	dbSNP
rs41291908	457	dbSNP
rs1457715427	462	dbSNP
rs1421339907	465	dbSNP
rs942637063	469	dbSNP
rs1025183769	473	dbSNP
rs527330809	475	dbSNP
rs980879361	476	dbSNP
rs1033829991	483	dbSNP
rs760927416	487	dbSNP
rs922505098	488	dbSNP
rs1042606	492	dbSNP
rs543863068	496	dbSNP
rs182331064	498	dbSNP
rs1227720292	500	dbSNP
rs1379246637	501	dbSNP
rs945729312	508	dbSNP
rs147624233	510	dbSNP
rs1422198086	515	dbSNP
rs773047464	527	dbSNP
rs1410473856	530	dbSNP
rs923184191	536	dbSNP
rs1455705935	544	dbSNP
rs1348547116	558	dbSNP
rs1357329763	559	dbSNP
rs933251322	569	dbSNP
rs75306833	572	dbSNP
rs888937764	576	dbSNP
rs538430754	581	dbSNP
rs1037879194	589	dbSNP
rs529289174	590	dbSNP
rs1001706133	597	dbSNP
rs41291910	598	dbSNP
rs773766417	613	dbSNP
rs1183371006	614	dbSNP
rs1220735835	614	dbSNP
rs1205153482	620	dbSNP
rs1322262353	621	dbSNP
rs1316460551	626	dbSNP
rs896054849	627	dbSNP
rs569339451	630	dbSNP
rs542612784	640	dbSNP
rs1338890179	642	dbSNP
rs1009879029	643	dbSNP
rs1215233823	649	dbSNP
rs1019880830	652	dbSNP
rs1458810735	653	dbSNP
rs968448488	656	dbSNP
rs1166750025	659	dbSNP
rs1429148264	671	dbSNP
rs1025411687	676	dbSNP
rs554624859	678	dbSNP
rs978879995	688	dbSNP
rs1264921150	689	dbSNP
rs142409394	707	dbSNP
rs1490479379	720	dbSNP
rs539790780	739	dbSNP
rs1018022571	750	dbSNP
rs759127203	753	dbSNP
rs1274812043	755	dbSNP
rs767544115	762	dbSNP
rs565366601	763	dbSNP
rs1209885623	783	dbSNP
rs1300955285	783	dbSNP
rs1258603227	784	dbSNP
rs976598871	790	dbSNP
rs989648145	791	dbSNP
rs1347823716	793	dbSNP
rs558016648	794	dbSNP
rs1306665877	796	dbSNP
rs576853502	804	dbSNP
rs775630574	815	dbSNP
rs977090172	825	dbSNP
rs1464720686	826	dbSNP
rs1377332016	827	dbSNP
rs1175052447	836	dbSNP
rs1480616733	851	dbSNP
rs1190977857	854	dbSNP
rs1179847648	856	dbSNP
rs983462563	857	dbSNP
rs186950078	869	dbSNP
rs1250604220	870	dbSNP
rs1197091010	873	dbSNP
rs1475480420	878	dbSNP
rs942127991	881	dbSNP
rs1038228570	883	dbSNP
rs927390171	886	dbSNP
rs763988402	895	dbSNP
rs1223774851	896	dbSNP
rs766342541	900	dbSNP
rs937531164	903	dbSNP
rs1057207167	924	dbSNP
rs1228313742	925	dbSNP
rs1413801665	930	dbSNP
rs1174036231	937	dbSNP
rs1330949063	941	dbSNP
rs1394403845	945	dbSNP
rs1401622021	951	dbSNP
rs941802541	953	dbSNP
rs1431067444	954	dbSNP
rs1156761670	957	dbSNP
rs1037944079	959	dbSNP
rs556160577	962	dbSNP
rs897883828	962	dbSNP
rs1440151256	963	dbSNP
rs11556512	972	dbSNP
rs1296658680	974	dbSNP
rs1326041540	978	dbSNP
rs750607412	980	dbSNP
rs1046501658	981	dbSNP
rs1010410809	982	dbSNP
rs1343531991	984	dbSNP
rs1351987562	984	dbSNP
rs1234109575	989	dbSNP
rs906516049	991	dbSNP
rs1002195695	993	dbSNP
rs1313534534	996	dbSNP
rs1454774686	997	dbSNP
rs1386795326	999	dbSNP
rs1318264280	1004	dbSNP
rs1456475644	1010	dbSNP
rs189836596	1022	dbSNP
rs78292719	1026	dbSNP
rs569766922	1027	dbSNP
rs1183730432	1029	dbSNP
rs1283181859	1030	dbSNP
rs1447171081	1034	dbSNP
rs1245856661	1035	dbSNP
rs999857137	1045	dbSNP
rs1018468294	1047	dbSNP
rs530376728	1048	dbSNP
rs1286796345	1058	dbSNP
rs1356338839	1058	dbSNP
rs3833737	1058	dbSNP
rs963810137	1059	dbSNP
rs758576628	1061	dbSNP
rs3750810	1062	dbSNP
rs200502145	1065	dbSNP
rs567122256	1066	dbSNP
rs79479639	1071	dbSNP
rs998996893	1071	dbSNP
rs1042641	1074	dbSNP
rs200575714	1077	dbSNP
rs1157802308	1079	dbSNP
rs1326738671	1082	dbSNP
rs1384552501	1086	dbSNP
rs1320122501	1088	dbSNP
rs1403523144	1089	dbSNP
rs1389987367	1091	dbSNP
rs1163632452	1096	dbSNP
rs3750811	1105	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.