miRTarBase - #MIRT055413


—
pre-miRNA Information
pre-miRNA hsa-mir-5699   
Genomic Coordinates chr10: 641689 - 641778
Description Homo sapiens miR-5699 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5699-5p
Sequence 10| UGCCCCAACAAGGAAGGACAAG |31
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 10 - 641763 29233923 MiREDiBase
A-to-I 8 10 - 641762 29233923 MiREDiBase
A-to-I 15 10 - 641755 29233923 MiREDiBase
A-to-I 18 10 - 641752 29233923 MiREDiBase
A-to-I 20 10 - 641750 29233923 MiREDiBase
A-to-I 21 10 - 641749 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1375475673 1 dbSNP
rs1277107905 2 dbSNP
rs1444021873 2 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SHOC2   
Synonyms SIAA0862, SOC2, SUR8
Description SHOC2, leucine rich repeat scaffold protein
Transcript NM_007373   
Expression
Putative miRNA Targets on SHOC2
3'UTR of SHOC2
(miRNA target sites are highlighted)		 
>SHOC2|NM_007373|3'UTR
   1 TATAAATCTGCTGGTCCCACACACTGTTCAAAAATAGACTGCCATTAATGTTTCTTATCTATATCTGTATCTATTTATGT
  81 AGATATTGGTATATGGCAGATTTATAAAAATTGCATTATGTGTTTCTGCTAATAGAGGAATCATAGCCATTTAGAATTTT
 161 TTTTAAATTCTGTACAAAAGGCTTATATAAGTTTTCTTTGCTGAATTTGATGGATGTTTTTCTGTTGTGTAATCTGATAT
 241 GCCAGTTTGCTTAAAACATTTGCCAACACATTATGAAGTTATTAAATTTAAGGGACAGAGGTAGTATAGTTAGATATACT
 321 TTCTCTTAGGAAAAATAATGGGCAAAAATTTTTGTTGCAACTTTTCATATATATTTTCCCCTTACCAATTGTTTTATCCT
 401 TATAGTATTGTAGGCCCTGAAAGTAGAATTTTTCTTTAACTTATTTTGAGATTTGAGATTTAAATTTTATGTATTGTTTA
 481 CAGTCAGAGTAAATCACTGGATTTCTTTTGTTTGTTTTGATTTGCTCTGTTTTATTCAGTCAAATCTAGAGTTTGAATCC
 561 TCTGCTAAAGAATTTGCATCCACTGGTGTAAACAGTGAAAGGTATTTGCTTGTTGAAAAAAAAAACTGGCAAAGTGAAAA
 641 GATACAGTCAAAAATCTAGAATTTCTTTAATTTTGCTTCTCTGACGAGTTGTGAAGCAAAATACCTGAAGTGAGTCTTTG
 721 GGTAGGGGAAGGGTATTGAGACCTTTTCTAGTATGAATATTTTTTAAGTTTGGGGGAAGAGAAACTTGCAGTGAAAAGGA
 801 GTTTTTTCATTCCTGAAAGTTGCAGATCCACAAAACTAACAGGATAATTGGGCAAATAAATTACATATAAACACACACAA
 881 TCTATATATGTATATACAATGCTATATAGATATGTATTTATTATATCATAAACTACAGTAGGTAACTTTAAGGATTTCTT
 961 CCTATCCTTGTACAATGACATGAATGTCTTTCTTTGAAAACTGCAATGTATGTATGTTTCAAGGTTATTTAACAGTGTAC
1041 TATGGTTTTATATCTTGACTTGCCTTGTACATCTTTCAATTCTGGAATATCTGTGTCTAAGCACAATATCTTCACACTGT
1121 GCTGTATTGCTGCTGAACTAAATGCACTTTTCCCCACATATGGGGCACTGGCTTCAAACAATTCAGTTCAGTATCATTAC
1201 TTTTAATCTCATCTTTCCTTTCTTGGTAGTTGTTAATACAGTTATGGAAAAGAGGCACATTGCATAGAAGCCATTGGGGA
1281 GTTCAGTGGAAGTTCTGTAAGATGTGCATGTACTATTTGATGCGTTTTCTTTGCTTCACTGCTTTTAATACTTAGCAGTA
1361 TTGTTGGTCTAAGTCAATTTGATTATTGAGGAGTCTCAGAGCAAGGTGCGTTCTAGATGTCATCCTAAAAAACACTTCAT
1441 ATATAATTAATCACTATTTTGTATAATTACATATTGCTGCTTGTGTGTTTTTTTTTTTTTCCATTTAGTTGGGCGTTGTG
1521 TTTTACACAAAACCATTTTTGAATTAAGGCTATGATATTAAGATAGAAATTTGGACTGTTGTTCTGCTTTTCCTGGCACT
1601 CAAATTCATGACTAGTTTTGAGGTCAAACCTATGTTCGTAATGAGAGATTTTATAAGGATCAACTAAGAAATGGAAGGCA
1681 GGTGAAGATATAAAACCCTAGAATGCTTAAATGTGCTGTAAAACTATTGTAGATGTCACTGGATTTTACCAAGTAATATC
1761 CTTTCTTTTTTTTTTCCCCCCATCTGCTGTGGCTTTTCAGTTAAAATTTTGTTTATAAAAGGAATTTGTTTATTACAGCT
1841 CTACCTAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaacaggAAGGAA--C-AACCCCgu 5'
                 ||::||  | ||||||  
Target 5' atgaataTTTTTTAAGTTTGGGGga 3'
 753 - 777 129.00 -10.60
2 
miRNA  3' gaACAGGAAGG--AA-CAACCCcgu 5'
            | |::||||  || ||||||   
Target 5' ttTTTTTTTCCATTTAGTTGGGcgt 3'
 1492 - 1516 126.00 -13.00
3 
miRNA  3' gaacaggaaggaacAACCCCgu 5'
                        ||||||  
Target 5' ttgcatagaagccaTTGGGGag 3'
 1260 - 1281 120.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
181525 4 ClinVar
378581 17 ClinVar
984487 17 ClinVar
879344 21 ClinVar
298865 165 ClinVar
298866 405 ClinVar
298867 506 ClinVar
298868 519 ClinVar
298869 615 ClinVar
298870 616 ClinVar
298871 657 ClinVar
879705 686 ClinVar
298872 698 ClinVar
298873 774 ClinVar
879706 826 ClinVar
298874 915 ClinVar
298875 959 ClinVar
877760 980 ClinVar
877761 991 ClinVar
298876 1062 ClinVar
298877 1107 ClinVar
298878 1219 ClinVar
298879 1246 ClinVar
877762 1270 ClinVar
298880 1324 ClinVar
298881 1325 ClinVar
878792 1382 ClinVar
298882 1484 ClinVar
298883 1486 ClinVar
298884 1487 ClinVar
298885 1488 ClinVar
298886 1504 ClinVar
878793 1509 ClinVar
298887 1576 ClinVar
298888 1766 ClinVar
298889 1776 ClinVar
COSN30518494 17 COSMIC
COSN30453026 23 COSMIC
COSN30599808 47 COSMIC
COSN31554104 147 COSMIC
COSN8529214 147 COSMIC
COSN28840592 165 COSMIC
COSN26056258 210 COSMIC
COSN6056671 264 COSMIC
COSN6056672 419 COSMIC
COSN16529725 726 COSMIC
COSN17540041 967 COSMIC
COSN16698609 1010 COSMIC
COSN23635756 1094 COSMIC
COSN26551615 1125 COSMIC
COSN26556972 1136 COSMIC
COSN15325663 1161 COSMIC
COSN28797786 1293 COSMIC
COSN28939734 1488 COSMIC
COSN20107548 1501 COSMIC
COSN14463567 1603 COSMIC
COSN23108089 1776 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767523465 3 dbSNP
rs143187497 4 dbSNP
rs760047969 11 dbSNP
rs377043455 12 dbSNP
rs938277839 14 dbSNP
rs574959049 16 dbSNP
rs753327392 17 dbSNP
rs371005619 21 dbSNP
rs753016007 22 dbSNP
rs1355437825 24 dbSNP
rs1455226481 27 dbSNP
rs944382341 36 dbSNP
rs1301838443 38 dbSNP
rs1353178224 39 dbSNP
rs758762850 45 dbSNP
rs1293346959 47 dbSNP
rs1317261860 51 dbSNP
rs1222504732 62 dbSNP
rs775803610 62 dbSNP
rs1169548041 66 dbSNP
rs1040144710 68 dbSNP
rs575011429 70 dbSNP
rs1421610660 72 dbSNP
rs542333379 74 dbSNP
rs1196568516 84 dbSNP
rs866531238 87 dbSNP
rs1248746001 91 dbSNP
rs1479832656 96 dbSNP
rs1482109220 98 dbSNP
rs1224246962 100 dbSNP
rs377205004 101 dbSNP
rs1181615270 102 dbSNP
rs1042167767 105 dbSNP
rs1204306036 108 dbSNP
rs1252410751 111 dbSNP
rs900213298 114 dbSNP
rs931728986 115 dbSNP
rs902242330 116 dbSNP
rs761226703 119 dbSNP
rs1412730473 123 dbSNP
rs1284044651 141 dbSNP
rs936410980 145 dbSNP
rs772535731 150 dbSNP
rs1297359330 157 dbSNP
rs896472847 157 dbSNP
rs191293913 165 dbSNP
rs1402299398 166 dbSNP
rs201494424 175 dbSNP
rs1166465738 184 dbSNP
rs1174166137 184 dbSNP
rs900133151 188 dbSNP
rs969409307 192 dbSNP
rs1200399961 209 dbSNP
rs1368377995 213 dbSNP
rs576218739 217 dbSNP
rs996096984 230 dbSNP
rs1030249563 233 dbSNP
rs890328883 241 dbSNP
rs1481154857 243 dbSNP
rs1308151104 250 dbSNP
rs1260463910 252 dbSNP
rs1005107793 259 dbSNP
rs1323504842 271 dbSNP
rs1351827066 280 dbSNP
rs1444927340 281 dbSNP
rs1334140796 283 dbSNP
rs1015699953 290 dbSNP
rs542446944 293 dbSNP
rs543400072 294 dbSNP
rs1378832463 302 dbSNP
rs1334494312 307 dbSNP
rs1469210520 308 dbSNP
rs764385450 310 dbSNP
rs1406772865 315 dbSNP
rs1173750036 324 dbSNP
rs957249586 331 dbSNP
rs1362769468 332 dbSNP
rs989120443 349 dbSNP
rs1441202810 352 dbSNP
rs1378901885 353 dbSNP
rs182433736 354 dbSNP
rs1229311118 359 dbSNP
rs1461231568 362 dbSNP
rs1026947396 368 dbSNP
rs944608848 372 dbSNP
rs959364848 380 dbSNP
rs975712602 381 dbSNP
rs1260287622 386 dbSNP
rs539394184 405 dbSNP
rs918158727 406 dbSNP
rs1204745760 408 dbSNP
rs970944296 414 dbSNP
rs1312594067 415 dbSNP
rs1451650872 416 dbSNP
rs978684067 429 dbSNP
rs532446734 431 dbSNP
rs1383364226 434 dbSNP
rs1336075730 437 dbSNP
rs1275382202 454 dbSNP
rs931697816 459 dbSNP
rs1288991319 486 dbSNP
rs1048829012 488 dbSNP
rs1439647217 494 dbSNP
rs1421085522 495 dbSNP
rs1383039352 496 dbSNP
rs887931765 501 dbSNP
rs541359882 502 dbSNP
rs1161987839 503 dbSNP
rs371679867 506 dbSNP
rs1236900795 507 dbSNP
rs1190217442 508 dbSNP
rs1472995511 511 dbSNP
rs924105012 511 dbSNP
rs936426575 516 dbSNP
rs886046731 519 dbSNP
rs559270881 524 dbSNP
rs896700397 528 dbSNP
rs1053493127 532 dbSNP
rs921636466 541 dbSNP
rs1245593167 542 dbSNP
rs931627740 557 dbSNP
rs573586846 560 dbSNP
rs1051710493 570 dbSNP
rs1448456922 571 dbSNP
rs905219486 579 dbSNP
rs1325805726 584 dbSNP
rs1168857275 589 dbSNP
rs1401314899 591 dbSNP
rs890349094 593 dbSNP
rs1004777626 596 dbSNP
rs1302137196 602 dbSNP
rs1424979589 606 dbSNP
rs1391868200 613 dbSNP
rs886046732 615 dbSNP
rs1032456352 616 dbSNP
rs886046733 616 dbSNP
rs957423845 616 dbSNP
rs1194401816 617 dbSNP
rs1010032840 624 dbSNP
rs1036617326 627 dbSNP
rs1020545643 634 dbSNP
rs1452454829 635 dbSNP
rs1359147806 636 dbSNP
rs1291695937 640 dbSNP
rs965923949 643 dbSNP
rs560726584 646 dbSNP
rs898963211 650 dbSNP
rs1363493914 651 dbSNP
rs557334390 657 dbSNP
rs1220462515 660 dbSNP
rs1343095268 678 dbSNP
rs749942762 686 dbSNP
rs984941982 687 dbSNP
rs1198858390 689 dbSNP
rs1332486270 692 dbSNP
rs1325898196 694 dbSNP
rs189140753 698 dbSNP
rs1396298913 708 dbSNP
rs148246156 713 dbSNP
rs1427259549 720 dbSNP
rs1036496682 725 dbSNP
rs1024952105 745 dbSNP
rs1478454262 761 dbSNP
rs114628508 774 dbSNP
rs1179330179 776 dbSNP
rs978335298 785 dbSNP
rs1258551680 789 dbSNP
rs1464279974 790 dbSNP
rs924106725 793 dbSNP
rs193126887 799 dbSNP
rs989262645 810 dbSNP
rs905188414 817 dbSNP
rs1219340794 821 dbSNP
rs921664394 826 dbSNP
rs1277394430 834 dbSNP
rs1441111625 837 dbSNP
rs1335514894 841 dbSNP
rs1332517146 843 dbSNP
rs1449588119 848 dbSNP
rs185620695 852 dbSNP
rs1476745147 866 dbSNP
rs1404572126 867 dbSNP
rs1175712976 868 dbSNP
rs1415124112 871 dbSNP
rs1427429588 873 dbSNP
rs1157045067 875 dbSNP
rs540708199 880 dbSNP
rs1469857967 884 dbSNP
rs931658865 887 dbSNP
rs1180300814 892 dbSNP
rs1425301590 893 dbSNP
rs1459895177 893 dbSNP
rs1242463257 898 dbSNP
rs766192638 903 dbSNP
rs751455255 905 dbSNP
rs1051445922 908 dbSNP
rs1210798748 911 dbSNP
rs1415498566 914 dbSNP
rs1054277943 915 dbSNP
rs189223963 915 dbSNP
rs940610806 928 dbSNP
rs192135385 930 dbSNP
rs1242769222 935 dbSNP
rs1381147331 937 dbSNP
rs1302765704 940 dbSNP
rs1449495369 947 dbSNP
rs1434913555 950 dbSNP
rs1316376326 953 dbSNP
rs372493479 959 dbSNP
rs1160168322 974 dbSNP
rs1381187671 974 dbSNP
rs1442529300 978 dbSNP
rs994617323 980 dbSNP
rs1231118801 985 dbSNP
rs1048485840 986 dbSNP
rs1274288913 991 dbSNP
rs1484222860 994 dbSNP
rs895255595 1006 dbSNP
rs1345831053 1007 dbSNP
rs568680803 1025 dbSNP
rs1266166977 1028 dbSNP
rs1464266150 1039 dbSNP
rs536012063 1041 dbSNP
rs1209180040 1043 dbSNP
rs1488373301 1052 dbSNP
rs1287730466 1058 dbSNP
rs1263374537 1059 dbSNP
rs1449477956 1061 dbSNP
rs530047047 1062 dbSNP
rs886046734 1062 dbSNP
rs1312516949 1064 dbSNP
rs1025405291 1065 dbSNP
rs557280270 1079 dbSNP
rs906496375 1080 dbSNP
rs1229376057 1090 dbSNP
rs751517745 1092 dbSNP
rs1268453719 1094 dbSNP
rs1399485023 1101 dbSNP
rs1361349390 1105 dbSNP
rs118172559 1107 dbSNP
rs997422272 1108 dbSNP
rs1031242870 1109 dbSNP
rs1165245122 1117 dbSNP
rs1481134517 1133 dbSNP
rs1417298918 1134 dbSNP
rs184177524 1140 dbSNP
rs1179205114 1155 dbSNP
rs1477853004 1156 dbSNP
rs958219170 1158 dbSNP
rs1410473061 1162 dbSNP
rs1457023571 1166 dbSNP
rs1160421289 1171 dbSNP
rs1490099635 1173 dbSNP
rs1387633035 1174 dbSNP
rs1222813984 1181 dbSNP
rs1323961016 1185 dbSNP
rs1028950726 1188 dbSNP
rs953024686 1194 dbSNP
rs984436423 1209 dbSNP
rs1280230768 1210 dbSNP
rs1403283625 1212 dbSNP
rs1367202930 1218 dbSNP
rs886046735 1219 dbSNP
rs908876475 1223 dbSNP
rs961790746 1229 dbSNP
rs972240205 1232 dbSNP
rs1169871048 1236 dbSNP
rs1466115990 1240 dbSNP
rs1425127004 1241 dbSNP
rs754913685 1246 dbSNP
rs1479883283 1248 dbSNP
rs1029142477 1259 dbSNP
rs953120890 1260 dbSNP
rs1315571572 1265 dbSNP
rs772654155 1270 dbSNP
rs1231566697 1278 dbSNP
rs911549613 1282 dbSNP
rs141791891 1298 dbSNP
rs972421078 1305 dbSNP
rs576948558 1306 dbSNP
rs1286362382 1309 dbSNP
rs936926753 1314 dbSNP
rs1053763780 1317 dbSNP
rs1330487326 1320 dbSNP
rs371721188 1324 dbSNP
rs559572636 1325 dbSNP
rs1173551406 1332 dbSNP
rs894280946 1339 dbSNP
rs1041181045 1340 dbSNP
rs1177747592 1353 dbSNP
rs1416986919 1355 dbSNP
rs1236675268 1356 dbSNP
rs948143573 1365 dbSNP
rs188505184 1378 dbSNP
rs1240587158 1379 dbSNP
rs747905159 1381 dbSNP
rs997392575 1382 dbSNP
rs1482963417 1387 dbSNP
rs1256707298 1388 dbSNP
rs1235668007 1393 dbSNP
rs757582531 1395 dbSNP
rs1046472169 1410 dbSNP
rs779208280 1411 dbSNP
rs541969990 1418 dbSNP
rs1378950926 1420 dbSNP
rs1290232538 1421 dbSNP
rs1334595294 1428 dbSNP
rs1490693236 1432 dbSNP
rs780618180 1442 dbSNP
rs745972322 1443 dbSNP
rs796796451 1446 dbSNP
rs1304098805 1457 dbSNP
rs1451120924 1462 dbSNP
rs563188768 1464 dbSNP
rs1379303470 1472 dbSNP
rs199880082 1482 dbSNP
rs180979375 1484 dbSNP
rs1456714361 1485 dbSNP
rs1382621262 1486 dbSNP
rs549502834 1486 dbSNP
rs753811687 1486 dbSNP
rs776585204 1486 dbSNP
rs143768227 1487 dbSNP
rs759715534 1487 dbSNP
rs7074770 1488 dbSNP
rs769907720 1488 dbSNP
rs771402535 1488 dbSNP
rs1355581834 1489 dbSNP
rs971773144 1489 dbSNP
rs1312708932 1490 dbSNP
rs552284342 1491 dbSNP
rs1341022670 1493 dbSNP
rs1306221023 1501 dbSNP
rs1314154214 1501 dbSNP
rs1349977761 1502 dbSNP
rs1410300255 1503 dbSNP
rs1327552 1504 dbSNP
rs1309063358 1507 dbSNP
rs1338482281 1508 dbSNP
rs202206864 1509 dbSNP
rs1362824766 1510 dbSNP
rs1265641641 1512 dbSNP
rs1161852458 1513 dbSNP
rs528458429 1515 dbSNP
rs1369554224 1516 dbSNP
rs1189645426 1524 dbSNP
rs771841691 1524 dbSNP
rs1273217366 1529 dbSNP
rs1483103637 1537 dbSNP
rs980866319 1553 dbSNP
rs1031691813 1560 dbSNP
rs1194621920 1572 dbSNP
rs886046736 1576 dbSNP
rs1489405248 1580 dbSNP
rs1287419229 1585 dbSNP
rs1209023344 1588 dbSNP
rs1196815863 1600 dbSNP
rs1356886424 1605 dbSNP
rs926807353 1605 dbSNP
rs747506750 1609 dbSNP
rs936915996 1611 dbSNP
rs990164034 1616 dbSNP
rs865926990 1621 dbSNP
rs913891085 1626 dbSNP
rs1801901 1630 dbSNP
rs945404848 1633 dbSNP
rs1446622504 1634 dbSNP
rs546692011 1638 dbSNP
rs1166964077 1639 dbSNP
rs1041149992 1642 dbSNP
rs568695891 1683 dbSNP
rs953485111 1692 dbSNP
rs901220679 1707 dbSNP
rs1464559931 1716 dbSNP
rs1801900 1719 dbSNP
rs1422945226 1726 dbSNP
rs932733512 1731 dbSNP
rs373459532 1753 dbSNP
rs1462620843 1756 dbSNP
rs1299800886 1760 dbSNP
rs1245211042 1766 dbSNP
rs527775221 1766 dbSNP
rs886046737 1766 dbSNP
rs888963635 1767 dbSNP
rs1269247858 1772 dbSNP
rs1247310563 1776 dbSNP
rs535776105 1776 dbSNP
rs1219941211 1782 dbSNP
rs1313108211 1793 dbSNP
rs777538590 1803 dbSNP
rs1018684517 1804 dbSNP
rs551193817 1815 dbSNP
rs971775017 1824 dbSNP
rs746829098 1825 dbSNP
rs1296419884 1835 dbSNP
rs1326008783 1837 dbSNP
rs993162076 1839 dbSNP
rs1342244561 1842 dbSNP
rs920235268 1844 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8036.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8036.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000369452.4 | 3UTR | AACUAAAUGCACUUUUCCCCACAUAUGGGGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000369452.4 | 3UTR | AUCUUCACACUGUGCUGUAUUGCUGCUGAACUAAAUGCACUUUUCCCCACAUAUGGGGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000369452.4 | 3UTR | AACUAAAUGCACUUUUCCCCACAUAUGGGGCACUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000369452.4 | 3UTR | AACUAAAUGCACUUUUCCCCACAUAUGGGGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000369452.4 | 3UTR | CUGCUGAACUAAAUGCACUUUUCCCCACAUAUGGGGCACUGGCUUCAAACAAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000369452.4 | 3UTR | AACUAAAUGCACUUUUCCCCACAUAUGGGGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
59 hsa-miR-5699-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055413 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT060377 RBM14 RNA binding motif protein 14 2 8
MIRT263579 GHITM growth hormone inducible transmembrane protein 2 2
MIRT286017 TVP23B trans-golgi network vesicle protein 23 homolog B 2 2
MIRT451747 CES3 carboxylesterase 3 2 2
MIRT477629 EFNA1 ephrin A1 2 2
MIRT488659 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT490933 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 2 2
MIRT495129 METTL24 methyltransferase like 24 2 2
MIRT496508 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT501883 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT504587 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 2 4
MIRT506761 KMT2D lysine methyltransferase 2D 2 2
MIRT512455 POLR3G RNA polymerase III subunit G 2 2
MIRT525672 NHLRC4 NHL repeat containing 4 2 2
MIRT525946 SLC8A3 solute carrier family 8 member A3 2 4
MIRT526658 PRSS42 protease, serine 42 2 4
MIRT526846 GALNT11 polypeptide N-acetylgalactosaminyltransferase 11 2 2
MIRT527019 PABPN1L poly(A) binding protein nuclear 1 like, cytoplasmic 2 2
MIRT527978 TSLP thymic stromal lymphopoietin 2 2
MIRT532723 DDTL D-dopachrome tautomerase like 2 2
MIRT533225 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT535016 PRMT7 protein arginine methyltransferase 7 2 4
MIRT535149 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT535384 PER1 period circadian clock 1 2 2
MIRT543163 GTF2A1 general transcription factor IIA subunit 1 2 2
MIRT552721 YTHDC1 YTH domain containing 1 2 2
MIRT553255 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT555530 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT558257 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT563107 IFRD2 interferon related developmental regulator 2 2 2
MIRT565200 TSC22D4 TSC22 domain family member 4 2 2
MIRT572806 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT623521 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT639982 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT641191 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT642519 CNTROB centrobin, centriole duplication and spindle assembly protein 2 2
MIRT643669 WDR5 WD repeat domain 5 2 2
MIRT650824 LZTR1 leucine zipper like transcription regulator 1 2 2
MIRT652425 TMEM239 transmembrane protein 239 2 2
MIRT657379 HMGA1 high mobility group AT-hook 1 2 2
MIRT668054 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT683065 NUP205 nucleoporin 205 2 2
MIRT685079 HPSE heparanase 2 2
MIRT687567 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 2 2
MIRT696103 SETD1A SET domain containing 1A 2 2
MIRT700183 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT704889 CCND1 cyclin D1 2 2
MIRT709135 GLG1 golgi glycoprotein 1 2 2
MIRT709191 SAPCD2 suppressor APC domain containing 2 2 2
MIRT713409 PEX16 peroxisomal biogenesis factor 16 2 2
MIRT713470 SLC22A12 solute carrier family 22 member 12 2 2
MIRT713964 KLHDC4 kelch domain containing 4 2 2
MIRT714546 COL14A1 collagen type XIV alpha 1 chain 2 2
MIRT717326 PGK1 phosphoglycerate kinase 1 2 2
MIRT718254 ZDHHC8 zinc finger DHHC-type containing 8 2 2
MIRT718524 WDR33 WD repeat domain 33 2 2
MIRT721374 RASL10A RAS like family 10 member A 2 2
MIRT723004 FADS1 fatty acid desaturase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-5699 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-5699-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-5699-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-5699-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-5699-5p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-5699-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-5699-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-5699-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-5699-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-5699-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission