| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-5697 |
| Genomic Coordinates | chr1: 9967381 - 9967458 |
| Description | Homo sapiens miR-5697 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-5697 | |||||||||||||||
| Sequence | 10| UCAAGUAGUUUCAUGAUAAAGG |31 | |||||||||||||||
| Evidence | Experimental | |||||||||||||||
| Experiments | Illumina | |||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||
| Putative Targets | ||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PLEKHA1 | ||||||||||||||||||||
| Synonyms | TAPP1 | ||||||||||||||||||||
| Description | pleckstrin homology domain containing A1 | ||||||||||||||||||||
| Transcript | NM_001001974 | ||||||||||||||||||||
| Other Transcripts | NM_021622 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PLEKHA1 | |||||||||||||||||||||
| 3'UTR of PLEKHA1 (miRNA target sites are highlighted) |
>PLEKHA1|NM_001001974|3'UTR 1 GGCAGAAGCGCACGGAGCCTGCCTGCCTCTGCCGTCCTCAGTTTCCTTTCATGAGGCTTCTAGCCAAAGATGATAAAGGG 81 GGAAATGGTTTTTAGTGCGTATATTATACTGCCTCTTAGGTGTACTCTTTATAAGCTGGTAAACCAAGAATCTAGGGAGT 161 GGCCAAACTAAATATAATTTCTTTAAAAAAGAAAGAAAAAGGAAAAATCCAAAATATCTCAGTATCATCTGTCTGAAGCA 241 TTGTGTGTTCTCATTCGGGTGGTAACAATGTATGTGTAATATTTTTTTCTTAGTGATTTTGACAGTTTAAATGTTTAACA 321 ACTTAAAGCATTAAAAATGCTTATTAATAACTTTGGTCATTTAAAAAATGCTACAATGACTTCCTATTAAAGGTTCAATA 401 TTTACACATTCTTATTGGTTGATATTACCACATGAAATATTGCCAGACCAAGATACCTAAACTCATGATGTCTGTGGTGC 481 TGTAAAATTTATACTAAAATGTGGACTATTTTGAAATTATAACCATTTTTGATGCCCTGAATCTTGAGGTGACTTATTTT 561 GCATAGAGGATATGGATAGACCAACAGTAAGGGTTGTGGGTTATACCGGCATAGAGAAAAGAAGAAAACTAGAATTGAAA 641 CAACTGTGTCTTAGACATTTGTTTGAAAAAGCTTCATCAGGCCTTGGAGCAGTCACTGCTTTATTCCGCAAAAATTATTT 721 GGTAGGAAATTTTTGGGAGATCTGATTTTCTTATCCAAGTTTTGTAAATAGTTGTTATTTCTATATTTGGATTGGTGAAA 801 GACCTCAAGTTTATATGTAAAGACATAACTGCCCTTAGTCATGAAATTGTTGTGACCTCTACTTTTTGTCACTAATAGCC 881 TACATTCAAGTGCCTGTGTTTTTTCATCTTGTTTAGGAATGTTTTGAGATTAATGTGCTTAAAAGTCCTACGTGACTGAT 961 TTTAAACATTGTGATAAAATTAATTTTCAGTAGAATAGTTGAATGTGTTAAGATAGGATTTTATGTTAGAGATACCAGAA 1041 TGCTGGTATTCTACTACTTGTGCAATATATATGTTTTAAAAAACAAATTTGAGAATACATTTAATCATAGGGATATAGAT 1121 ATAAGCACCTCTCTAAAGAATCTTTAGTTTCCGACGTTGAATTATAGACCAGTTTGAGTAAGTACTGCTTTTTTTTTTTG 1201 GAGACGGGCTCTCGCTCTGTTGCTCAGGCTGGAGTGCAGTGGCGTGATCTCAGCTCACTACAGCCTCCACCTCGTGGGTT 1281 CAAACAGTTGTGCTGCCTCAGCTTCCCGAGTAGCTAGGATTACAGGTGCATGCCACCACACCTGGCTAATTTTTGTATTT 1361 TAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTCGTCTCGAACTCCTGACTTCAGGTGATCCACCCATCTCAGCCTCC 1441 CAAAGTGCTGGGATTACAGGCGTGAGCCACCATGCCCGGCCCATAAGTACCGTTTTTGAGGTTCAGTCTTAAACATTTGC 1521 TTTAAGAAAACAGTCTTGAATTTCACATGCTGCTATTTTTATATTTTGCCATTTTACAGTACTGTTTTGTTTTGAATTCA 1601 TGCATATCATTGAAAATTTCTCGTTTTCATTTTCTTAGATGACTTCTTGTCTGAGACAGAAAAATTTCCTACTACAGCAG 1681 TGCAGTCCAGAGGTTAAGATGTATTAGAATTATACAATATCAGTTTAAAAATCTGTATGCATAAAGAATGCACCACTCAA 1761 CTTTTTTATTCATAAGCTAATATTTTTTTAAAGTTACATTAAGATTTTTTCTCTTTTGCAGCTACATTTGAAAGTGATAG 1841 AATAAAGAGATTTTAATGAGTTATCACTTTTTCAGCTGATATATTCATTTTAATGGCTTTTTTGAAAGTTCCTTTTTCAT 1921 GAACACACCCGAGAAATCTTAAATAGACACTTTGCAATATTTAAGAACCTAATGCTGTTTAATTTTGGTACAGCTTCCAC 2001 ATTGCATGTTCACTTTAGTATTTGCAATTTGATATATTTCATGGTGGCAAAATATTAGCTCTGTTTTGGGACATTTTAAA 2081 ATAGAACTATCCTTGTTCGATAGCATAGGAAAATGTTCTGGTGATTGTCAGGGTCTCCTAATATTTATCTCAATTCTTTT 2161 ATAAGTCTATGGAAATTATTTAATTATTTTAAAACGTACACACTTTTCTTGTAAATATGTCACATCTGAGTTCAAAAAAA 2241 TTACTTTGAATACCTTAATATTTGCTGCATTTTTTTCCGTATATATAACATGTCTTCTTTCAGAATGGGAATATATGTGT 2321 GCCTCCCAACATTTACTGTTAAAGTGTGTTATCTTTATATGTCAAACTGGTTGAACACTGTAATGAGAATAAACTGCACA 2401 GAGTTTATTCTGACTTAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 59338.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 59338.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 59338.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000538022.1 | 3UTR | GUAUUCUACUACUUGUGCAAUAUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000538022.1 | 3UTR | GUAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000538022.1 | 3UTR | CUGGUAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000538022.1 | 3UTR | AUUCUACUACUUGUGCAAUAUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000538022.1 | 3UTR | CUGGUAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000538022.1 | 3UTR | UAUUCUACUACUUGUGCAAUAUAUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
139 hsa-miR-5697 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT055801 | PLEKHA1 | pleckstrin homology domain containing A1 |  |
|
2 | 12 | ||||||
| MIRT066822 | ZDHHC18 | zinc finger DHHC-type containing 18 | |
|
2 | 2 | ||||||
| MIRT067331 | SESN2 | sestrin 2 | |
|
2 | 4 | ||||||
| MIRT072105 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 4 | ||||||
| MIRT080621 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | |
|
2 | 8 | ||||||
| MIRT085213 | SLC5A3 | solute carrier family 5 member 3 | |
|
2 | 4 | ||||||
| MIRT086450 | NABP1 | nucleic acid binding protein 1 | |
|
2 | 6 | ||||||
| MIRT087916 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 4 | ||||||
| MIRT089461 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 2 | ||||||
| MIRT089610 | MAT2A | methionine adenosyltransferase 2A | |
|
2 | 10 | ||||||
| MIRT107597 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | |
|
2 | 6 | ||||||
| MIRT116036 | DEPDC1 | DEP domain containing 1 | |
|
2 | 6 | ||||||
| MIRT147331 | KPNA2 | karyopherin subunit alpha 2 | |
|
2 | 10 | ||||||
| MIRT206552 | RHOQ | ras homolog family member Q | |
|
2 | 2 | ||||||
| MIRT211198 | FGF2 | fibroblast growth factor 2 | |
|
2 | 6 | ||||||
| MIRT215297 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT227712 | TBC1D13 | TBC1 domain family member 13 | |
|
2 | 2 | ||||||
| MIRT243969 | MAP1B | microtubule associated protein 1B | |
|
2 | 2 | ||||||
| MIRT250417 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 6 | ||||||
| MIRT294604 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT300122 | STRADB | STE20-related kinase adaptor beta | |
|
2 | 2 | ||||||
| MIRT354709 | SLC25A36 | solute carrier family 25 member 36 | |
|
2 | 2 | ||||||
| MIRT442368 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | |
|
2 | 2 | ||||||
| MIRT443617 | AVPR1A | arginine vasopressin receptor 1A | |
|
2 | 2 | ||||||
| MIRT444711 | ZNF772 | zinc finger protein 772 | |
|
2 | 2 | ||||||
| MIRT447556 | C14orf37 | chromosome 14 open reading frame 37 | |
|
2 | 2 | ||||||
| MIRT448685 | MAPK6 | mitogen-activated protein kinase 6 | |
|
2 | 2 | ||||||
| MIRT450817 | LIFR | LIF receptor alpha | |
|
2 | 2 | ||||||
| MIRT451368 | UQCR11 | ubiquinol-cytochrome c reductase, complex III subunit XI | |
|
2 | 2 | ||||||
| MIRT457302 | ZBTB45 | zinc finger and BTB domain containing 45 | |
|
2 | 2 | ||||||
| MIRT458779 | CES2 | carboxylesterase 2 | |
|
2 | 2 | ||||||
| MIRT458864 | CD55 | CD55 molecule (Cromer blood group) | |
|
2 | 2 | ||||||
| MIRT460276 | SLC26A2 | solute carrier family 26 member 2 | |
|
2 | 2 | ||||||
| MIRT461711 | ZNF426 | zinc finger protein 426 | |
|
2 | 2 | ||||||
| MIRT466690 | TAF13 | TATA-box binding protein associated factor 13 | |
|
2 | 4 | ||||||
| MIRT468811 | SACS | sacsin molecular chaperone | |
|
2 | 10 | ||||||
| MIRT476013 | GTF2A1 | general transcription factor IIA subunit 1 | |
|
2 | 8 | ||||||
| MIRT477764 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | |
|
2 | 2 | ||||||
| MIRT478541 | CTNS | cystinosin, lysosomal cystine transporter | |
|
2 | 2 | ||||||
| MIRT479230 | CKS2 | CDC28 protein kinase regulatory subunit 2 | |
|
2 | 2 | ||||||
| MIRT479980 | CARD10 | caspase recruitment domain family member 10 | |
|
2 | 2 | ||||||
| MIRT480800 | BLOC1S2 | biogenesis of lysosomal organelles complex 1 subunit 2 | |
|
2 | 6 | ||||||
| MIRT482442 | ADM | adrenomedullin | |
|
2 | 10 | ||||||
| MIRT487566 | LOXL2 | lysyl oxidase like 2 | |
|
2 | 2 | ||||||
| MIRT499512 | RNF6 | ring finger protein 6 | |
|
2 | 6 | ||||||
| MIRT501861 | MTDH | metadherin | |
|
2 | 2 | ||||||
| MIRT502460 | FRAT2 | FRAT2, WNT signaling pathway regulator | |
|
2 | 6 | ||||||
| MIRT502704 | CREBZF | CREB/ATF bZIP transcription factor | |
|
2 | 6 | ||||||
| MIRT502856 | CHEK2 | checkpoint kinase 2 | |
|
2 | 6 | ||||||
| MIRT503188 | ADAM17 | ADAM metallopeptidase domain 17 | |
|
2 | 2 | ||||||
| MIRT503528 | ATG12 | autophagy related 12 | |
|
2 | 2 | ||||||
| MIRT505087 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 6 | ||||||
| MIRT507490 | E2F7 | E2F transcription factor 7 | |
|
2 | 6 | ||||||
| MIRT518010 | RPL4 | ribosomal protein L4 | |
|
2 | 4 | ||||||
| MIRT520767 | TCF23 | transcription factor 23 | |
|
2 | 2 | ||||||
| MIRT524551 | CCND2 | cyclin D2 | |
|
2 | 8 | ||||||
| MIRT527916 | B3GALT5 | beta-1,3-galactosyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT530025 | KIAA1875 | WD repeat domain 97 | |
|
2 | 2 | ||||||
| MIRT532306 | HAUS3 | HAUS augmin like complex subunit 3 | |
|
2 | 2 | ||||||
| MIRT532898 | ZNF451 | zinc finger protein 451 | |
|
2 | 2 | ||||||
| MIRT533591 | TOB1 | transducer of ERBB2, 1 | |
|
2 | 6 | ||||||
| MIRT534161 | SLC9A7 | solute carrier family 9 member A7 | |
|
2 | 2 | ||||||
| MIRT539776 | KIAA0408 | KIAA0408 | |
|
2 | 6 | ||||||
| MIRT541045 | SOGA3 | SOGA family member 3 | |
|
2 | 6 | ||||||
| MIRT544310 | VANGL2 | VANGL planar cell polarity protein 2 | |
|
2 | 4 | ||||||
| MIRT545812 | ZNF608 | zinc finger protein 608 | |
|
2 | 2 | ||||||
| MIRT546436 | SNX5 | sorting nexin 5 | |
|
2 | 2 | ||||||
| MIRT547715 | KLHL15 | kelch like family member 15 | |
|
2 | 4 | ||||||
| MIRT549105 | C16orf70 | chromosome 16 open reading frame 70 | |
|
2 | 4 | ||||||
| MIRT551192 | EPB41L3 | erythrocyte membrane protein band 4.1 like 3 | |
|
2 | 2 | ||||||
| MIRT551671 | RPL9 | ribosomal protein L9 | |
|
2 | 4 | ||||||
| MIRT552050 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | |
|
2 | 2 | ||||||
| MIRT553113 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
|
2 | 2 | ||||||
| MIRT553329 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT554371 | SFPQ | splicing factor proline and glutamine rich | |
|
2 | 2 | ||||||
| MIRT555745 | PDCD10 | programmed cell death 10 | |
|
2 | 2 | ||||||
| MIRT556351 | MAN2A1 | mannosidase alpha class 2A member 1 | |
|
2 | 2 | ||||||
| MIRT557461 | GSK3B | glycogen synthase kinase 3 beta | |
|
2 | 4 | ||||||
| MIRT558082 | EPC2 | enhancer of polycomb homolog 2 | |
|
2 | 2 | ||||||
| MIRT558501 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | |
|
2 | 4 | ||||||
| MIRT560288 | HRH2 | histamine receptor H2 | |
|
2 | 2 | ||||||
| MIRT561124 | ATP2B1 | ATPase plasma membrane Ca2+ transporting 1 | |
|
2 | 2 | ||||||
| MIRT562629 | ARNTL2 | aryl hydrocarbon receptor nuclear translocator like 2 | |
|
2 | 2 | ||||||
| MIRT564087 | NSA2 | NSA2, ribosome biogenesis homolog | |
|
2 | 2 | ||||||
| MIRT564209 | SDE2 | SDE2 telomere maintenance homolog | |
|
2 | 2 | ||||||
| MIRT564327 | CCNT1 | cyclin T1 | |
|
2 | 2 | ||||||
| MIRT564996 | WNK1 | WNK lysine deficient protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT565212 | TROVE2 | TROVE domain family member 2 | |
|
2 | 2 | ||||||
| MIRT568261 | BMP2K | BMP2 inducible kinase | |
|
2 | 2 | ||||||
| MIRT571352 | RPL37 | ribosomal protein L37 | |
|
2 | 4 | ||||||
| MIRT574715 | HAUS8 | HAUS augmin like complex subunit 8 | |
|
2 | 2 | ||||||
| MIRT610600 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | |
|
2 | 2 | ||||||
| MIRT615444 | FAXC | failed axon connections homolog | |
|
2 | 2 | ||||||
| MIRT618242 | PGBD4 | piggyBac transposable element derived 4 | |
|
2 | 2 | ||||||
| MIRT618694 | CAMK1D | calcium/calmodulin dependent protein kinase ID | |
|
2 | 2 | ||||||
| MIRT620289 | GLTP | glycolipid transfer protein | |
|
2 | 2 | ||||||
| MIRT621242 | SIGLEC9 | sialic acid binding Ig like lectin 9 | |
|
2 | 4 | ||||||
| MIRT626894 | ANGEL1 | angel homolog 1 | |
|
2 | 2 | ||||||
| MIRT631347 | LATS1 | large tumor suppressor kinase 1 | |
|
2 | 2 | ||||||
| MIRT631742 | NKX2-1 | NK2 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT633819 | WDR92 | WD repeat domain 92 | |
|
2 | 2 | ||||||
| MIRT648370 | CYB5A | cytochrome b5 type A | |
|
2 | 2 | ||||||
| MIRT648892 | TUBGCP5 | tubulin gamma complex associated protein 5 | |
|
2 | 2 | ||||||
| MIRT653570 | SLC35B3 | solute carrier family 35 member B3 | |
|
2 | 2 | ||||||
| MIRT654652 | PTAFR | platelet activating factor receptor | |
|
2 | 2 | ||||||
| MIRT657173 | INTU | inturned planar cell polarity protein | |
|
2 | 2 | ||||||
| MIRT658874 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
|
2 | 2 | ||||||
| MIRT666654 | RBM48 | RNA binding motif protein 48 | |
|
2 | 2 | ||||||
| MIRT669273 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT671790 | RGS17 | regulator of G protein signaling 17 | |
|
2 | 2 | ||||||
| MIRT673619 | HPSE | heparanase | |
|
2 | 4 | ||||||
| MIRT676182 | HIST1H2BJ | histone cluster 1 H2B family member j | |
|
2 | 2 | ||||||
| MIRT676317 | GTF2H2C | GTF2H2 family member C | |
|
2 | 2 | ||||||
| MIRT676661 | LRRC27 | leucine rich repeat containing 27 | |
|
2 | 2 | ||||||
| MIRT676678 | ICA1L | islet cell autoantigen 1 like | |
|
2 | 2 | ||||||
| MIRT677497 | GTF2H2 | general transcription factor IIH subunit 2 | |
|
2 | 2 | ||||||
| MIRT678021 | SPIC | Spi-C transcription factor | |
|
2 | 2 | ||||||
| MIRT678030 | SLC1A5 | solute carrier family 1 member 5 | |
|
2 | 2 | ||||||
| MIRT678363 | PPAP2B | phospholipid phosphatase 3 | |
|
2 | 2 | ||||||
| MIRT678438 | PDE4C | phosphodiesterase 4C | |
|
2 | 2 | ||||||
| MIRT678497 | ARHGEF39 | Rho guanine nucleotide exchange factor 39 | |
|
2 | 2 | ||||||
| MIRT678648 | PDCD4 | programmed cell death 4 | |
|
2 | 2 | ||||||
| MIRT679089 | PURB | purine rich element binding protein B | |
|
2 | 2 | ||||||
| MIRT679121 | NMNAT1 | nicotinamide nucleotide adenylyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT680087 | THAP1 | THAP domain containing 1 | |
|
2 | 2 | ||||||
| MIRT684600 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
|
2 | 2 | ||||||
| MIRT686267 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT687836 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | |
|
2 | 2 | ||||||
| MIRT688028 | GPN2 | GPN-loop GTPase 2 | |
|
2 | 2 | ||||||
| MIRT697864 | UBE2H | ubiquitin conjugating enzyme E2 H | |
|
2 | 2 | ||||||
| MIRT698304 | TMEM2 | transmembrane protein 2 | |
|
2 | 2 | ||||||
| MIRT701714 | MTMR12 | myotubularin related protein 12 | |
|
2 | 2 | ||||||
| MIRT703736 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT705971 | ACBD5 | acyl-CoA binding domain containing 5 | |
|
2 | 2 | ||||||
| MIRT714346 | DIP2A | disco interacting protein 2 homolog A | |
|
2 | 2 | ||||||
| MIRT714614 | EXO5 | exonuclease 5 | |
|
2 | 2 | ||||||
| MIRT722607 | CCDC152 | coiled-coil domain containing 152 | |
|
2 | 2 | ||||||
| MIRT722876 | XPNPEP3 | X-prolyl aminopeptidase 3 | |
|
2 | 2 | ||||||
| MIRT724406 | WWC1 | WW and C2 domain containing 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|