miRTarBase - #MIRT057208


—
pre-miRNA Information
pre-miRNA hsa-mir-16-2   
Genomic Coordinates chr3: 160404745 - 160404825
Description Homo sapiens miR-16-2 stem-loop
Comment This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-16-2-3p
Sequence 53| CCAAUAUUACUGUGCUGCUUUA |74
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30477465 2 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746992239 2 dbSNP
rs775368833 4 dbSNP
rs373202341 10 dbSNP
rs768780684 13 dbSNP
rs1341798864 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPIF   
Synonyms CYP3, CyP-M, Cyp-D, CypD
Description peptidylprolyl isomerase F
Transcript NM_005729   
Expression
Putative miRNA Targets on PPIF
3'UTR of PPIF
(miRNA target sites are highlighted)		 
>PPIF|NM_005729|3'UTR
   1 TCTGTGGCCAGGGTGCTGGCATGGTGGCAGCTGCAAATGTCCATGCACCCAGGTGGCCGCGTTGGGCTGTCAGCCAAGGT
  81 GCCTGAAACGATACGTGTGCCCACTCCACTGTCACAGTGTGCCTGAGGAAGGCTGCTAGGGATGTTAGACCTCGGCCAGG
 161 ACCCACCACATTGCTTCCTAATACCCACCCTTCCTCACGACCTCATTTCTGGGCATCTTTGTGGACATGATGTCACCCAC
 241 CCCTTGTCAAGCATTGCCTGTGATTGCCCAGCCCAGATTCATCTGTGCCTTGGACATGGTGATGGTGATGGGTTGCCATC
 321 CAAGTGAAAGTCTTTTCCTTGACCAAGGGGGACAGTCAGTTTTGCAAAAGGACTCTAATACCTGTTTAATATTGTCTTCC
 401 TAATTGGGATAATTTAATTAACAAGATTGACTAGAAGTGAAACTGCAACACTAACTTCCCCGTGCTGTGGTGTGACCTGA
 481 GTTGGTGACACAGGCCACAGACCCCAGAGCTTGGCTTTTGAAACACAACTCAGGGCTTTTGTGAAGGTTCCCCCGCTGAG
 561 ATCTTTCCTCCTGGTTACTGTGAAGCCTGTTGGTTTGCTGCTGTCGTTTTTGAGGAGGGCCCATGGGGGTAGGAGCAGTT
 641 GAACCTGGGAACAAACCTCACTTGAGCTGTGCCTAGACAATGTGAATTCCTGTGTTGCTAACAGAAGTGGCCTGTAAGCT
 721 CCTGTGCTCCGGAGGGAAGCATTTCCTGGTAGGCTTTGATTTTTCTGTGTGTTAAAGAAATTCAATCTACTCATGATGTG
 801 TTATGCATAAAACATTTCTGGAACATGGATTTGTGTTCACCTTAAATGTGAAAATAAATCCTATTTTCTATGGAAGACTG
 881 GTACCTGGTTTCTGGAAGAGGGGTCTGTGACTTGGAGCTGATCTTTACTGAGCTCGCCGTGGCAGATGCCATGCTCAGGA
 961 CGTTCATGTGGATGGTTTCATGTCATCGTGCTGGCAACTTGTCCTCCCTGCCTTAGAGATGAGGCTCAGACAAACGACCT
1041 TAGCACCCATAGCCTATGCCATGAGCACTGGCTCCACCCTGAATCCCAGCTCCTCCCCTTAGTGACCCCAAGTCTGTTTC
1121 CCTCAGCTGCATAAGGAGGCGATATAGTTTGAATATTTGTCCCCAGCCAAATCTCATGTTGAACTGTAATCCCCAGTGCT
1201 GGAGGTGGGGCCTGCTACGAGGTGTTTGGATCATGGGGACGGGTATTTCATGGCTTGGTGCTGTTTTCTTGATGGTGAAT
1281 TATTGCAAGATACGGTCATTTAAAATTGTGTGGCACCTCCCCCTGCCCCCTTCTTGCTCCTGCTTTCACCATGTGACATG
1361 CCTGATCCCCCTTCACCTTTTGCCATGGTCATAAGCTTCCTGAGGCCTCCCTGGAAGCTGAGCAGATGCCAGCACCATGC
1441 TTCCTGTACATCCTGCAGAACCATAAGCCAATTAAACCTTTTTAATAATAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auUUCGUCGUGUCA---UUAUAAcc 5'
            |:||: :|:|||   ||||||  
Target 5' ggAGGCGATATAGTTTGAATATTtg 3'
 1135 - 1159 144.00 -12.90
2 
miRNA  3' auUUCGUCGUGUCA-UUAUAACc 5'
            ||| :| ||||| |:| ||| 
Target 5' ccAAGGGGGACAGTCAGTTTTGc 3'
 343 - 365 124.00 -11.50
3 
miRNA  3' auUUCGUCGUGUCAUUAUAAcc 5'
            |:|| || :|| :||:||  
Target 5' gaAGGCTGC-TAGGGATGTTag 3'
 128 - 148 111.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30526368 7 COSMIC
COSN31560084 17 COSMIC
COSN30509323 42 COSMIC
COSN30461972 59 COSMIC
COSN30133953 61 COSMIC
COSN30112251 91 COSMIC
COSN30170017 127 COSMIC
COSN31538521 160 COSMIC
COSN31566353 200 COSMIC
COSN27522198 205 COSMIC
COSN28804949 218 COSMIC
COSN8640529 253 COSMIC
COSN31532246 260 COSMIC
COSN19659142 459 COSMIC
COSN19659143 460 COSMIC
COSN20486310 463 COSMIC
COSN26642575 594 COSMIC
COSN26551635 598 COSMIC
COSN31541914 698 COSMIC
COSN31490417 805 COSMIC
COSN31607615 824 COSMIC
COSN8721879 888 COSMIC
rs7332 463 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1441146351 1 dbSNP
rs1253193720 3 dbSNP
rs892438334 4 dbSNP
rs772627956 5 dbSNP
rs1424294979 11 dbSNP
rs762914987 14 dbSNP
rs530730945 27 dbSNP
rs1318670814 38 dbSNP
rs1361505709 40 dbSNP
rs751383371 43 dbSNP
rs1250077801 45 dbSNP
rs895342757 50 dbSNP
rs376682545 51 dbSNP
rs1000613949 59 dbSNP
rs188222825 60 dbSNP
rs1244138333 61 dbSNP
rs1397739122 62 dbSNP
rs561141770 63 dbSNP
rs1299516037 71 dbSNP
rs765036683 82 dbSNP
rs1295148337 85 dbSNP
rs1007876657 90 dbSNP
rs1326439067 91 dbSNP
rs1161130822 92 dbSNP
rs1421185267 94 dbSNP
rs529848344 95 dbSNP
rs1447987706 96 dbSNP
rs553861039 104 dbSNP
rs1418825559 107 dbSNP
rs2230225 108 dbSNP
rs774050677 114 dbSNP
rs1268316916 115 dbSNP
rs996811021 119 dbSNP
rs1220319637 131 dbSNP
rs1247223845 133 dbSNP
rs532215710 154 dbSNP
rs1261490949 155 dbSNP
rs952571744 162 dbSNP
rs1314851780 165 dbSNP
rs982817439 166 dbSNP
rs1284945916 168 dbSNP
rs971688018 179 dbSNP
rs1405553874 185 dbSNP
rs754456742 189 dbSNP
rs908605390 191 dbSNP
rs960133067 194 dbSNP
rs552215672 198 dbSNP
rs992749259 199 dbSNP
rs1385264608 200 dbSNP
rs1157568051 215 dbSNP
rs753121 218 dbSNP
rs763133711 228 dbSNP
rs538540674 233 dbSNP
rs889242086 234 dbSNP
rs535150575 235 dbSNP
rs1441873127 237 dbSNP
rs944995509 239 dbSNP
rs948977346 243 dbSNP
rs568678017 244 dbSNP
rs149485754 247 dbSNP
rs1204835750 254 dbSNP
rs1235711830 259 dbSNP
rs1264818938 278 dbSNP
rs1223877838 290 dbSNP
rs1322763244 291 dbSNP
rs1281263012 294 dbSNP
rs752341402 297 dbSNP
rs934842602 300 dbSNP
rs1326558670 302 dbSNP
rs1164043564 303 dbSNP
rs556570366 305 dbSNP
rs1009593015 311 dbSNP
rs1053292278 312 dbSNP
rs554270251 313 dbSNP
rs1470483685 319 dbSNP
rs1429203547 327 dbSNP
rs117391830 330 dbSNP
rs1476667168 354 dbSNP
rs1373786044 364 dbSNP
rs545859012 368 dbSNP
rs777521085 372 dbSNP
rs1002250475 375 dbSNP
rs1204099604 376 dbSNP
rs1460657575 376 dbSNP
rs556150349 379 dbSNP
rs1034202458 385 dbSNP
rs958758157 390 dbSNP
rs192435302 395 dbSNP
rs544150041 405 dbSNP
rs1315230918 417 dbSNP
rs561018996 417 dbSNP
rs1026934671 429 dbSNP
rs888376456 431 dbSNP
rs1342851609 434 dbSNP
rs11002941 436 dbSNP
rs1412170708 437 dbSNP
rs1397810996 438 dbSNP
rs374252110 439 dbSNP
rs1015383714 444 dbSNP
rs960079304 446 dbSNP
rs879931723 452 dbSNP
rs1184383814 453 dbSNP
rs1444226545 460 dbSNP
rs7332 463 dbSNP
rs1183690596 466 dbSNP
rs183687846 471 dbSNP
rs1193576796 488 dbSNP
rs1261481702 488 dbSNP
rs532252443 489 dbSNP
rs1291853470 508 dbSNP
rs970105851 514 dbSNP
rs1282845388 520 dbSNP
rs1444756053 527 dbSNP
rs979409153 533 dbSNP
rs1328698097 536 dbSNP
rs116197316 549 dbSNP
rs934904923 553 dbSNP
rs1424313771 555 dbSNP
rs1462640350 555 dbSNP
rs528294465 556 dbSNP
rs914174689 559 dbSNP
rs1184059709 568 dbSNP
rs945578051 569 dbSNP
rs551262617 571 dbSNP
rs76010993 572 dbSNP
rs1490819027 605 dbSNP
rs113929717 607 dbSNP
rs1040824457 609 dbSNP
rs1002304546 610 dbSNP
rs114235114 613 dbSNP
rs187956293 625 dbSNP
rs1285831792 629 dbSNP
rs534478855 630 dbSNP
rs1477490508 631 dbSNP
rs547690789 633 dbSNP
rs1014544330 645 dbSNP
rs1279310443 646 dbSNP
rs1470590627 648 dbSNP
rs1024132754 650 dbSNP
rs1331216061 667 dbSNP
rs778167161 669 dbSNP
rs1048554587 670 dbSNP
rs1404342516 672 dbSNP
rs781005353 681 dbSNP
rs1004094138 692 dbSNP
rs951685906 695 dbSNP
rs1449524977 698 dbSNP
rs985746511 702 dbSNP
rs910315630 705 dbSNP
rs1015372369 716 dbSNP
rs749680632 725 dbSNP
rs965820056 727 dbSNP
rs1014734147 728 dbSNP
rs1487194454 730 dbSNP
rs758107853 731 dbSNP
rs143853873 732 dbSNP
rs1446029679 736 dbSNP
rs1284085901 747 dbSNP
rs1226884976 749 dbSNP
rs745876572 772 dbSNP
rs945630373 774 dbSNP
rs1223010020 777 dbSNP
rs539551534 778 dbSNP
rs1365645489 786 dbSNP
rs1043972548 793 dbSNP
rs556238151 800 dbSNP
rs74142395 801 dbSNP
rs1344817567 805 dbSNP
rs570394795 809 dbSNP
rs978759598 810 dbSNP
rs1406771379 812 dbSNP
rs1175555253 814 dbSNP
rs769106475 815 dbSNP
rs1055132770 817 dbSNP
rs1058740 819 dbSNP
rs1186583764 826 dbSNP
rs1474887331 827 dbSNP
rs1432249322 834 dbSNP
rs1245752492 837 dbSNP
rs1207261827 839 dbSNP
rs1033020134 841 dbSNP
rs1264120444 846 dbSNP
rs1203631314 861 dbSNP
rs1310951794 864 dbSNP
rs1297890202 871 dbSNP
rs1215177486 875 dbSNP
rs768237535 895 dbSNP
rs896599133 899 dbSNP
rs74142396 910 dbSNP
rs1454395598 917 dbSNP
rs989102842 922 dbSNP
rs1169315580 933 dbSNP
rs75781151 936 dbSNP
rs574657401 937 dbSNP
rs975330587 939 dbSNP
rs920999653 940 dbSNP
rs932396812 945 dbSNP
rs1299154906 949 dbSNP
rs1390392730 952 dbSNP
rs748099053 957 dbSNP
rs1385344749 961 dbSNP
rs878857894 962 dbSNP
rs1482569966 973 dbSNP
rs540479368 981 dbSNP
rs909586485 982 dbSNP
rs1346369050 988 dbSNP
rs1248489584 989 dbSNP
rs1017237503 1006 dbSNP
rs1314132654 1016 dbSNP
rs966190593 1020 dbSNP
rs1375487511 1027 dbSNP
rs560092095 1031 dbSNP
rs866234044 1036 dbSNP
rs1368210473 1037 dbSNP
rs1276381288 1040 dbSNP
rs1316056172 1042 dbSNP
rs975834220 1044 dbSNP
rs1384158392 1048 dbSNP
rs550587611 1070 dbSNP
rs1422391233 1079 dbSNP
rs577108161 1086 dbSNP
rs1270909290 1087 dbSNP
rs1207724463 1090 dbSNP
rs1249792903 1094 dbSNP
rs545960612 1103 dbSNP
rs895638532 1108 dbSNP
rs1360450276 1113 dbSNP
rs1265047499 1119 dbSNP
rs1242373485 1134 dbSNP
rs59038032 1137 dbSNP
rs1044636816 1141 dbSNP
rs905915090 1142 dbSNP
rs749501273 1152 dbSNP
rs1033011187 1169 dbSNP
rs373082055 1175 dbSNP
rs938238260 1177 dbSNP
rs1430819616 1187 dbSNP
rs531363186 1196 dbSNP
rs1368278798 1197 dbSNP
rs762795518 1200 dbSNP
rs1365951867 1202 dbSNP
rs1160278475 1206 dbSNP
rs192387497 1214 dbSNP
rs8837 1216 dbSNP
rs57510738 1219 dbSNP
rs1208330514 1223 dbSNP
rs1486971013 1230 dbSNP
rs142445267 1237 dbSNP
rs974900118 1239 dbSNP
rs73307964 1241 dbSNP
rs184556662 1242 dbSNP
rs151334735 1251 dbSNP
rs761238737 1253 dbSNP
rs1330052150 1262 dbSNP
rs1298515258 1263 dbSNP
rs569834379 1270 dbSNP
rs1321025880 1272 dbSNP
rs1383627482 1273 dbSNP
rs1385203789 1274 dbSNP
rs1289829454 1279 dbSNP
rs1457011787 1289 dbSNP
rs1242391702 1290 dbSNP
rs939716131 1294 dbSNP
rs1007437912 1295 dbSNP
rs1377208402 1312 dbSNP
rs1196829114 1314 dbSNP
rs1430536352 1319 dbSNP
rs1262610221 1324 dbSNP
rs1017708143 1326 dbSNP
rs1463337896 1330 dbSNP
rs1264746152 1331 dbSNP
rs1204265963 1341 dbSNP
rs901481029 1357 dbSNP
rs7898 1362 dbSNP
rs1228894423 1365 dbSNP
rs1326693199 1375 dbSNP
rs1296359420 1376 dbSNP
rs1432421588 1383 dbSNP
rs917148022 1385 dbSNP
rs950009249 1393 dbSNP
rs1044230761 1395 dbSNP
rs1339103308 1397 dbSNP
rs1020741944 1403 dbSNP
rs12779059 1407 dbSNP
rs1000269118 1409 dbSNP
rs1170900222 1419 dbSNP
rs1463554321 1422 dbSNP
rs1373880605 1428 dbSNP
rs979632241 1438 dbSNP
rs190187167 1446 dbSNP
rs1186575356 1447 dbSNP
rs139685091 1451 dbSNP
rs1183954658 1453 dbSNP
rs1422581300 1458 dbSNP
rs1441780165 1463 dbSNP
rs1253907195 1478 dbSNP
rs533887284 1479 dbSNP
rs991062585 1480 dbSNP
rs1273246538 1488 dbSNP
rs1225812040 1489 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10105.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000225174.3 | 3UTR | UUUAAUAUUGUCUUCCUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000225174.3 | 3UTR | UUUAAUAUUGUCUUCCUAAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000225174.3 | 3UTR | ACUCUAAUACCUGUUUAAUAUUGUCUUCCUAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000225174.3 | 3UTR | UUUAAUAUUGUCUUCCUAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.498 1.1e-2 0.362 5.3e-2 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.666 2.5e-2 0.733 1.2e-2 9 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.39 4.5e-2 0.226 1.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.277 9.0e-2 0.289 8.1e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.274 9.8e-2 0.301 7.6e-2 24 Click to see details
GSE28544 Breast cancer 0.237 1.3e-1 -0.087 3.4e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.33 1.4e-1 -0.176 2.8e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer 0.233 1.6e-1 0.102 3.3e-1 20 Click to see details
GSE21032 Prostate cancer 0.108 1.7e-1 0.086 2.2e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.092 2.3e-1 0.181 7.6e-2 64 Click to see details
GSE17498 Multiple myeloma -0.082 3.1e-1 -0.062 3.5e-1 40 Click to see details
GSE19783 ER- ER- breast cancer 0.042 3.6e-1 0.096 2.0e-1 79 Click to see details
GSE19350 CNS germ cell tumors -0.095 3.8e-1 -0.035 4.6e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.046 4.2e-1 0.013 4.8e-1 23 Click to see details
GSE19536 Breast cancer 0.021 4.2e-1 0.056 2.9e-1 100 Click to see details
GSE32688 Pancreatic cancer -0.034 4.3e-1 -0.051 3.9e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.003 4.9e-1 0.088 3.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.717 0 -0.715 0 25 Click to see details
STAD 0.528 0 0.475 0 31 Click to see details
UCEC 0.516 0.01 0.467 0.02 19 Click to see details
HNSC 0.315 0.02 0.352 0.01 42 Click to see details
PRAD 0.23 0.06 0.175 0.12 48 Click to see details
BRCA -0.155 0.08 -0.113 0.15 83 Click to see details
ESCA 0.394 0.12 0.291 0.19 11 Click to see details
PCPG -0.929 0.12 -0.500 0.33 3 Click to see details
KIRC 0.118 0.17 0.118 0.17 68 Click to see details
LUAD 0.285 0.18 0.301 0.17 12 Click to see details
PAAD 0.615 0.19 0.800 0.1 4 Click to see details
BLCA 0.141 0.29 0.129 0.3 18 Click to see details
CESC -0.598 0.3 -0.500 0.33 3 Click to see details
LUSC 0.077 0.32 0.059 0.36 38 Click to see details
CHOL -0.077 0.42 -0.150 0.35 9 Click to see details
THCA -0.026 0.42 0.036 0.39 59 Click to see details
LIHC 0.013 0.46 0.016 0.46 49 Click to see details
KIRP 0.011 0.48 0.021 0.45 32 Click to see details
KIRP 0.011 0.48 0.021 0.45 32 Click to see details
KIRP 0.011 0.48 0.021 0.45 32 Click to see details
75 hsa-miR-16-2-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004488 RARB retinoic acid receptor beta 3 1
MIRT038707 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT057208 PPIF peptidylprolyl isomerase F 2 4
MIRT058726 RSBN1 round spermatid basic protein 1 2 8
MIRT074502 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 4
MIRT081544 ZNF431 zinc finger protein 431 2 4
MIRT096893 ERBB2IP erbb2 interacting protein 2 2
MIRT105124 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT107898 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT109432 KLHL15 kelch like family member 15 2 6
MIRT166742 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 6
MIRT171257 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 2 2
MIRT192760 B2M beta-2-microglobulin 2 2
MIRT194905 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT215599 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT223632 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 4
MIRT241605 AMOTL1 angiomotin like 1 2 4
MIRT291174 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT444286 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT463285 ZFX zinc finger protein, X-linked 2 4
MIRT471759 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT479611 CDC25A cell division cycle 25A 2 2
MIRT481497 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 8
MIRT483117 SH3BP5 SH3 domain binding protein 5 2 2
MIRT502279 GRPEL2 GrpE like 2, mitochondrial 2 8
MIRT507838 CCNT1 cyclin T1 2 2
MIRT508179 MTRNR2L6 MT-RNR2-like 6 2 4
MIRT510576 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 6
MIRT517853 RPS4X ribosomal protein S4, X-linked 2 4
MIRT521690 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 8
MIRT525070 FRK fyn related Src family tyrosine kinase 2 2
MIRT527082 UBE2E3 ubiquitin conjugating enzyme E2 E3 2 2
MIRT529552 EI24 EI24, autophagy associated transmembrane protein 2 2
MIRT530426 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT533909 TBC1D15 TBC1 domain family member 15 2 2
MIRT536627 IPO7 importin 7 2 2
MIRT537647 ERGIC2 ERGIC and golgi 2 2 4
MIRT538512 CLCN3 chloride voltage-gated channel 3 2 2
MIRT539219 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT539348 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT539954 CCT4 chaperonin containing TCP1 subunit 4 2 2
MIRT541208 HOXA10 homeobox A10 2 2
MIRT543216 TMEM117 transmembrane protein 117 2 2
MIRT543399 DROSHA drosha ribonuclease III 2 2
MIRT546648 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT546852 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT549917 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT552998 USP46 ubiquitin specific peptidase 46 2 2
MIRT555254 PREPL prolyl endopeptidase-like 2 2
MIRT555956 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT557095 HOXA9 homeobox A9 2 2
MIRT561396 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561654 RNF219 ring finger protein 219 2 2
MIRT563101 PABPC4L poly(A) binding protein cytoplasmic 4 like 2 2
MIRT565979 RNF44 ring finger protein 44 2 2
MIRT572396 CCDC14 coiled-coil domain containing 14 2 2
MIRT574400 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT607623 VSNL1 visinin like 1 2 2
MIRT610645 CTGF connective tissue growth factor 2 2
MIRT623379 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT624687 AR androgen receptor 2 2
MIRT632089 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT644216 CBS cystathionine-beta-synthase 2 2
MIRT647841 BID BH3 interacting domain death agonist 2 2
MIRT651649 WASF2 WAS protein family member 2 2 2
MIRT689064 AGMAT agmatinase 2 2
MIRT698150 TNPO1 transportin 1 2 2
MIRT700516 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT704081 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT705970 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT715694 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT717184 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT724607 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT724854 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT725401 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-16-2 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-16-2-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-16-2-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (HOS)
hsa-miR-16-2-3p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma cell line (HOS)
hsa-miR-16-2-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-16-2-3p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-16-2-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-16-2-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-16-2-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-16-2-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-16-2-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (HCT8)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-16-2-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (MDA-231)
hsa-miR-16-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-16-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission