miRTarBase - #MIRT057504


—
pre-miRNA Information
pre-miRNA hsa-mir-548g   
Genomic Coordinates chr4: 147344629 - 147344717
Synonyms MIRN548G, hsa-mir-548g, MIR548G
Description Homo sapiens miR-548g stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548g-5p
Sequence 15| UGCAAAAGUAAUUGCAGUUUUUG |37
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 4 - 147344700 29233923 MiREDiBase
A-to-I 7 4 - 147344697 29233923 MiREDiBase
A-to-I 16 4 - 147344688 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1428532945 1 dbSNP
rs749197968 2 dbSNP
rs1271780804 3 dbSNP
rs375562730 4 dbSNP
rs1340837915 12 dbSNP
rs1222552086 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CEP55   
Synonyms C10orf3, CT111, URCC6
Description centrosomal protein 55
Transcript NM_001127182   
Other Transcripts NM_018131   
Expression
Putative miRNA Targets on CEP55
3'UTR of CEP55
(miRNA target sites are highlighted)		 
>CEP55|NM_001127182|3'UTR
   1 CAAAATAAGTATTTGTTTTGATATTAAAAGATTCAATACTGTATTTTCTGTTAGCTTGTGGGCATTTTGAATTATATATT
  81 TCACATTTTGCATAAAACTGCCTATCTACCTTTGACACTCCAGCATGCTAGTGAATCATGTATCTTTTAGGCTGCTGTGC
 161 ATTTCTCTTGGCAGTGATACCTCCCTGACATGGTTCATCATCAGGCTGCAATGACAGAATGTGGTGAGCAGCGTCTACTG
 241 AGACTACTAACATTTTGCACTGTCAAAATACTTGGTGAGGAAAAGATAGCTCAGGTTATTGCTAATGGGTTAATGCACCA
 321 GCAAGCAAAATATTTTATGTTTTGGGGGTTTTGAAAAATCAAAGATAATTAACCAAGGATCTTAACTGTGTTCGCATTTT
 401 TTATCCAAGCACTTAGAAAACCTACAATCCTAATTTTGATGTCCATTGTTAAGAGGTGGTGATAGATACTATTTTTTTTT
 481 TCATATTGTATAGCGGTTATTAGAAAAGTTGGGGATTTTCTTGATCTTTATTGCTGCTTACCATTGAAACTTAACCCAGC
 561 TGTGTTCCCCAACTCTGTTCTGCGCACGAAACAGTATCTGTTTGAGGCATAATCTTAAGTGGCCACACACAATGTTTTCT
 641 CTTATGTTATCTGGCAGTAACTGTAACTTGAATTACATTAGCACATTCTGCTTAGCTAAAATTGTTAAAATAAACTTTAA
 721 TAAACCCATGTAGCCCTCTCATTTGATTGACAGTATTTTAGTTATTTTTGGCATTCTTAAAGCTGGGCAATGTAATGATC
 801 AGATCTTTGTTTGTCTGAACAGGTATTTTTATACATGCTTTTTGTAAACCAAAAACTTTTAAATTTCTTCAGGTTTTCTA
 881 ACATGCTTACCACTGGGCTACTGTAAATGAGAAAAGAATAAAATTATTTAATGTTTTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guUUUUGACGUUAAUGAAAACgu 5'
            |: |:| :|:|||:|||||  
Target 5' acAGTATTTTAGTTATTTTTGgc 3'
 750 - 772 137.00 -11.20
2 
miRNA  3' guuUUUGACGU-UAA--UG-AAAACGu 5'
             :||:| :| |||  || |||||| 
Target 5' tttGAATTATATATTTCACATTTTGCa 3'
 66 - 92 130.00 -5.30
3 
miRNA  3' guUUUUGACGUUAAUG-AAAACGu 5'
            :|:|||  | | || |||||| 
Target 5' ctGAGACT--ACTAACATTTTGCa 3'
 238 - 259 129.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31580282 10 COSMIC
COSN30116664 20 COSMIC
COSN5293729 32 COSMIC
COSN31559862 88 COSMIC
COSN1507337 232 COSMIC
COSN20107393 353 COSMIC
COSN1507338 526 COSMIC
COSN24266314 910 COSMIC
COSN5889592 929 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1028668062 2 dbSNP
rs376713552 10 dbSNP
rs760563203 10 dbSNP
rs369071979 12 dbSNP
rs1211983142 16 dbSNP
rs1260245458 36 dbSNP
rs1474474428 37 dbSNP
rs1179589907 38 dbSNP
rs1187854963 40 dbSNP
rs755379142 41 dbSNP
rs560507013 42 dbSNP
rs1253863908 49 dbSNP
rs1227080551 67 dbSNP
rs968202669 75 dbSNP
rs1235196746 77 dbSNP
rs544562270 79 dbSNP
rs1305970680 87 dbSNP
rs900048835 92 dbSNP
rs1378938859 93 dbSNP
rs574084114 109 dbSNP
rs1466184850 113 dbSNP
rs1401812308 115 dbSNP
rs1209740651 117 dbSNP
rs1467730349 123 dbSNP
rs1378587508 140 dbSNP
rs1178339745 141 dbSNP
rs1438458073 161 dbSNP
rs1240559898 168 dbSNP
rs1178768346 172 dbSNP
rs1254506412 174 dbSNP
rs554798269 182 dbSNP
rs1481717075 191 dbSNP
rs1441304479 194 dbSNP
rs1196459540 197 dbSNP
rs1201850719 200 dbSNP
rs992748106 200 dbSNP
rs1051511803 206 dbSNP
rs770861276 212 dbSNP
rs918134214 215 dbSNP
rs1237684310 228 dbSNP
rs1355826216 232 dbSNP
rs1309846084 233 dbSNP
rs969614202 234 dbSNP
rs111293847 244 dbSNP
rs772620389 244 dbSNP
rs1332210737 247 dbSNP
rs1431210482 257 dbSNP
rs1433583089 258 dbSNP
rs1175046966 260 dbSNP
rs1403174329 261 dbSNP
rs980735946 263 dbSNP
rs776571066 271 dbSNP
rs543160106 272 dbSNP
rs1382744792 280 dbSNP
rs1463150092 281 dbSNP
rs186840462 286 dbSNP
rs1366221986 288 dbSNP
rs75712754 293 dbSNP
rs34087318 307 dbSNP
rs1442713588 315 dbSNP
rs1262007534 319 dbSNP
rs908639455 320 dbSNP
rs1002441386 323 dbSNP
rs35067961 326 dbSNP
rs1286398310 337 dbSNP
rs940508657 338 dbSNP
rs1354086301 339 dbSNP
rs1282565314 345 dbSNP
rs1030416457 347 dbSNP
rs370079649 349 dbSNP
rs3834415 349 dbSNP
rs552052805 349 dbSNP
rs200560574 350 dbSNP
rs12779614 353 dbSNP
rs771876020 361 dbSNP
rs901724369 368 dbSNP
rs1219041841 370 dbSNP
rs1299558995 375 dbSNP
rs559622627 378 dbSNP
rs1020855695 380 dbSNP
rs1319330269 388 dbSNP
rs12245643 395 dbSNP
rs1389203656 407 dbSNP
rs1164556261 408 dbSNP
rs1472821411 426 dbSNP
rs1422407845 428 dbSNP
rs1050073562 430 dbSNP
rs1191088203 431 dbSNP
rs1478562639 438 dbSNP
rs1263637539 445 dbSNP
rs1220550550 449 dbSNP
rs1449850680 454 dbSNP
rs1291908627 460 dbSNP
rs1211755454 466 dbSNP
rs1229391185 467 dbSNP
rs140828289 472 dbSNP
rs547824055 472 dbSNP
rs979105238 472 dbSNP
rs1274095262 483 dbSNP
rs1482094694 484 dbSNP
rs1202992773 486 dbSNP
rs12245717 489 dbSNP
rs975948291 493 dbSNP
rs921461189 495 dbSNP
rs1190424643 496 dbSNP
rs536647524 497 dbSNP
rs550329956 498 dbSNP
rs191623783 505 dbSNP
rs542866649 509 dbSNP
rs1423877963 512 dbSNP
rs956668041 515 dbSNP
rs1013667592 521 dbSNP
rs764332748 524 dbSNP
rs1476901666 526 dbSNP
rs183868661 536 dbSNP
rs774734037 541 dbSNP
rs1038416498 543 dbSNP
rs145548789 551 dbSNP
rs1002308265 557 dbSNP
rs1196829631 558 dbSNP
rs1350978413 559 dbSNP
rs1436313509 560 dbSNP
rs1320348869 563 dbSNP
rs919903881 564 dbSNP
rs1218824719 570 dbSNP
rs572706896 572 dbSNP
rs1364516294 576 dbSNP
rs762103787 584 dbSNP
rs746630554 585 dbSNP
rs1328757743 586 dbSNP
rs1448319302 588 dbSNP
rs908592615 594 dbSNP
rs768006824 605 dbSNP
rs535024318 623 dbSNP
rs1248274350 633 dbSNP
rs1020821418 635 dbSNP
rs1290615586 641 dbSNP
rs975913620 645 dbSNP
rs375737489 646 dbSNP
rs931866303 657 dbSNP
rs1220738706 664 dbSNP
rs964787990 665 dbSNP
rs1244805433 675 dbSNP
rs1459124986 685 dbSNP
rs1233476507 706 dbSNP
rs1050308685 715 dbSNP
rs1310591207 718 dbSNP
rs41290214 725 dbSNP
rs1371184015 728 dbSNP
rs574122915 729 dbSNP
rs1307667579 730 dbSNP
rs1449603877 745 dbSNP
rs1373457595 759 dbSNP
rs542999367 760 dbSNP
rs986999595 779 dbSNP
rs188965147 784 dbSNP
rs1164506703 793 dbSNP
rs892211531 797 dbSNP
rs778926169 806 dbSNP
rs1013322787 807 dbSNP
rs1160405356 818 dbSNP
rs1419540193 819 dbSNP
rs189688979 830 dbSNP
rs1025084687 844 dbSNP
rs1181345270 850 dbSNP
rs1405361506 857 dbSNP
rs1482432731 857 dbSNP
rs116816457 859 dbSNP
rs1347361295 860 dbSNP
rs186932514 874 dbSNP
rs1242971073 878 dbSNP
rs938035190 881 dbSNP
rs1311474282 890 dbSNP
rs1226107083 896 dbSNP
rs528288559 898 dbSNP
rs1293498691 905 dbSNP
rs953086488 910 dbSNP
rs1398967517 915 dbSNP
rs1363308522 917 dbSNP
rs1358402892 918 dbSNP
rs1299734918 929 dbSNP
rs1454772385 937 dbSNP
rs1349214546 938 dbSNP
rs896599054 940 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guuuuUGACGUUAAUG-AAAACGu 5'
               |||  | | || |||||| 
Target 5' -----ACU--ACUAACAUUUUGCa 3'
 		1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55165.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000371485.3 | 3UTR | ACUACUAACAUUUUGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000371485.3 | 3UTR | UCUACUGAGACUACUAACAUUUUGCACUGUCAAAAUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000371485.3 | 3UTR | ACUACUAACAUUUUGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
249 hsa-miR-548g-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057504 CEP55 centrosomal protein 55 2 4
MIRT060829 CEP350 centrosomal protein 350 2 4
MIRT062719 MLEC malectin 2 4
MIRT064766 CCND2 cyclin D2 2 8
MIRT075336 SF3B3 splicing factor 3b subunit 3 2 2
MIRT080205 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080236 SMAD4 SMAD family member 4 2 6
MIRT087395 AGFG1 ArfGAP with FG repeats 1 2 4
MIRT088228 GRAMD4 GRAM domain containing 4 2 2
MIRT089490 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT091222 USP13 ubiquitin specific peptidase 13 2 2
MIRT092959 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT094091 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 4
MIRT097469 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT102252 HBP1 HMG-box transcription factor 1 2 4
MIRT105440 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT107286 FAM73B mitoguardin 2 2 2
MIRT113584 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT113886 KPNA6 karyopherin subunit alpha 6 2 6
MIRT126457 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT135023 ADSS adenylosuccinate synthase 2 6
MIRT139889 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT149702 LDLR low density lipoprotein receptor 2 2
MIRT163230 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT165198 GRAMD3 GRAM domain containing 2B 2 2
MIRT172169 FZD6 frizzled class receptor 6 2 8
MIRT177396 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT179427 TBRG1 transforming growth factor beta regulator 1 2 6
MIRT195617 FAM195A MAPK regulated corepressor interacting protein 2 2 6
MIRT208727 MED12L mediator complex subunit 12 like 2 6
MIRT211508 ELMOD2 ELMO domain containing 2 2 2
MIRT213434 MOB1B MOB kinase activator 1B 2 6
MIRT240121 NDRG1 N-myc downstream regulated 1 2 2
MIRT243102 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT247387 HCFC2 host cell factor C2 2 4
MIRT248057 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT249457 ZNF691 zinc finger protein 691 2 4
MIRT253421 EVI5L ecotropic viral integration site 5 like 2 2
MIRT254148 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT258906 LAPTM4B lysosomal protein transmembrane 4 beta 2 4
MIRT259391 SLC6A8 solute carrier family 6 member 8 2 4
MIRT266966 LRRC55 leucine rich repeat containing 55 2 4
MIRT279001 GMFB glia maturation factor beta 2 10
MIRT288802 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT325678 ZNF367 zinc finger protein 367 2 2
MIRT330543 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT334269 RCC2 regulator of chromosome condensation 2 2 2
MIRT350225 PRNP prion protein 2 2
MIRT400510 SKIL SKI like proto-oncogene 2 10
MIRT405635 WBP4 WW domain binding protein 4 2 4
MIRT408651 QKI QKI, KH domain containing RNA binding 2 2
MIRT444161 ZNF701 zinc finger protein 701 2 2
MIRT444509 ZNF525 zinc finger protein 525 2 2
MIRT445209 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT446844 FOXP1 forkhead box P1 2 2
MIRT449026 ADRB1 adrenoceptor beta 1 2 2
MIRT450746 POLI DNA polymerase iota 2 4
MIRT450793 OTUD7A OTU deubiquitinase 7A 2 2
MIRT454916 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455266 DDX39B DExD-box helicase 39B 2 10
MIRT455715 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT456098 MB21D1 Mab-21 domain containing 1 2 6
MIRT463635 YY1 YY1 transcription factor 2 8
MIRT463891 WNT7B Wnt family member 7B 2 2
MIRT466262 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT466820 STX6 syntaxin 6 2 6
MIRT466879 STX16 syntaxin 16 2 2
MIRT467524 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT468199 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT468633 SELT selenoprotein T 2 2
MIRT470367 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470998 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471559 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472277 NFIB nuclear factor I B 2 4
MIRT472758 MTMR6 myotubularin related protein 6 2 8
MIRT474719 KIF13A kinesin family member 13A 2 6
MIRT475869 H3F3C H3 histone family member 3C 2 10
MIRT475903 H3F3B H3 histone family member 3B 2 8
MIRT477350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477486 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478096 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479805 CCNA2 cyclin A2 2 6
MIRT480813 BLCAP bladder cancer associated protein 2 10
MIRT481947 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483060 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484143 LRRC45 leucine rich repeat containing 45 2 4
MIRT484904 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485080 SOX4 SRY-box 4 2 10
MIRT485639 DICER1 dicer 1, ribonuclease III 2 4
MIRT485798 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT486271 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT486740 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT487167 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT491642 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491934 WDR45B WD repeat domain 45B 2 8
MIRT492232 SLC48A1 solute carrier family 48 member 1 2 2
MIRT493089 MMGT1 membrane magnesium transporter 1 2 12
MIRT494479 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT494986 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 2
MIRT495671 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT498467 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT499268 NBPF11 NBPF member 11 2 2
MIRT499855 SVOP SV2 related protein 2 12
MIRT500307 ZNF622 zinc finger protein 622 2 8
MIRT500640 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501222 SEMA4C semaphorin 4C 2 6
MIRT501526 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 8
MIRT501569 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502430 G3BP2 G3BP stress granule assembly factor 2 2 10
MIRT502967 CCNL1 cyclin L1 2 8
MIRT503470 ZNF154 zinc finger protein 154 2 6
MIRT504572 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 4
MIRT504956 ZNRF2 zinc and ring finger 2 2 6
MIRT505206 UBN2 ubinuclein 2 2 8
MIRT505238 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT507570 DEK DEK proto-oncogene 2 2
MIRT509412 MCM7 minichromosome maintenance complex component 7 2 6
MIRT510715 SPG20 spartin 2 6
MIRT510859 RAN RAN, member RAS oncogene family 2 8
MIRT510914 PSMA2 proteasome subunit alpha 2 2 4
MIRT510944 PPTC7 PTC7 protein phosphatase homolog 2 8
MIRT511072 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511213 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511959 ELOVL5 ELOVL fatty acid elongase 5 2 6
MIRT512123 CREBL2 cAMP responsive element binding protein like 2 2 8
MIRT513686 RNF111 ring finger protein 111 2 2
MIRT513896 GRB10 growth factor receptor bound protein 10 2 6
MIRT516305 F8A2 coagulation factor VIII associated 2 2 2
MIRT516331 F8A3 coagulation factor VIII associated 3 2 2
MIRT517521 ITM2C integral membrane protein 2C 2 6
MIRT517930 IMPA1 inositol monophosphatase 1 2 2
MIRT521368 RNF11 ring finger protein 11 2 6
MIRT525192 ZNF93 zinc finger protein 93 2 2
MIRT527216 CCNL2 cyclin L2 2 2
MIRT527835 NUPL1 nucleoporin 58 2 2
MIRT529433 MALT1 MALT1 paracaspase 2 2
MIRT530166 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT530515 C4orf32 family with sequence similarity 241 member A 2 4
MIRT532372 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT533855 TEAD1 TEA domain transcription factor 1 2 2
MIRT534750 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT534795 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT538602 CDK19 cyclin dependent kinase 19 2 2
MIRT539247 ANKRD50 ankyrin repeat domain 50 2 2
MIRT539467 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT543100 TNFRSF11A TNF receptor superfamily member 11a 2 2
MIRT543897 ESYT1 extended synaptotagmin 1 2 2
MIRT544980 MFF mitochondrial fission factor 2 4
MIRT545794 ZNF772 zinc finger protein 772 2 4
MIRT546009 WDR26 WD repeat domain 26 2 4
MIRT546378 STOX2 storkhead box 2 2 4
MIRT546681 RORA RAR related orphan receptor A 2 4
MIRT546947 SFTPA1 surfactant protein A1 2 2
MIRT547034 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547397 MKX mohawk homeobox 2 2
MIRT547470 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547501 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT548077 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548500 E2F8 E2F transcription factor 8 2 2
MIRT548883 CHEK2 checkpoint kinase 2 2 4
MIRT549063 CALM1 calmodulin 1 2 2
MIRT549166 BMP3 bone morphogenetic protein 3 2 2
MIRT549310 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549345 ARC activity regulated cytoskeleton associated protein 2 2
MIRT549475 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549678 ZNF598 zinc finger protein 598 2 2
MIRT550209 MAVS mitochondrial antiviral signaling protein 2 4
MIRT550356 INCENP inner centromere protein 2 4
MIRT550531 MYZAP myocardial zonula adherens protein 2 2
MIRT551156 ZNF678 zinc finger protein 678 2 2
MIRT552311 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552880 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553383 TRIM33 tripartite motif containing 33 2 2
MIRT554453 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT554868 RCAN2 regulator of calcineurin 2 2 2
MIRT556022 MYBL1 MYB proto-oncogene like 1 2 2
MIRT556175 MCC mutated in colorectal cancers 2 2
MIRT556238 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT556878 ITGA2 integrin subunit alpha 2 2 2
MIRT557575 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557690 GATA6 GATA binding protein 6 2 2
MIRT557906 FBXO8 F-box protein 8 2 2
MIRT558132 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT558481 DBN1 drebrin 1 2 2
MIRT558744 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT558760 CFL2 cofilin 2 2 2
MIRT559122 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT559406 GDNF glial cell derived neurotrophic factor 2 4
MIRT559476 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559677 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT560049 ZNF680 zinc finger protein 680 2 2
MIRT560643 ZNF107 zinc finger protein 107 2 2
MIRT562581 CBX3 chromobox 3 2 2
MIRT564188 CLVS2 clavesin 2 2 2
MIRT564530 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT564540 CCDC80 coiled-coil domain containing 80 2 2
MIRT565290 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565315 TMEM41A transmembrane protein 41A 2 2
MIRT565950 RRAGD Ras related GTP binding D 2 2
MIRT566633 NFYA nuclear transcription factor Y subunit alpha 2 4
MIRT566818 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT567529 FGFR1OP FGFR1 oncogene partner 2 2
MIRT568631 ACVR2A activin A receptor type 2A 2 2
MIRT572141 DESI1 desumoylating isopeptidase 1 2 2
MIRT616029 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT620048 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT620531 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621878 TAOK3 TAO kinase 3 2 2
MIRT623242 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623994 FAM104A family with sequence similarity 104 member A 2 2
MIRT624301 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT626283 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT627771 RAB30 RAB30, member RAS oncogene family 2 2
MIRT641139 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT644587 SPOP speckle type BTB/POZ protein 2 2
MIRT644820 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT645971 NHLRC2 NHL repeat containing 2 2 2
MIRT646171 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646496 ZNF429 zinc finger protein 429 2 2
MIRT647834 RAB23 RAB23, member RAS oncogene family 2 2
MIRT648463 CCDC127 coiled-coil domain containing 127 2 2
MIRT657281 HRK harakiri, BCL2 interacting protein 2 2
MIRT658644 ENAH ENAH, actin regulator 2 2
MIRT658677 EMP2 epithelial membrane protein 2 2 2
MIRT665229 ZZZ3 zinc finger ZZ-type containing 3 2 2
MIRT669277 C19orf44 chromosome 19 open reading frame 44 2 2
MIRT676048 AUTS8 Autism, susceptibility to, 8 2 2
MIRT681484 DIP2A disco interacting protein 2 homolog A 2 2
MIRT681555 UBXN2A UBX domain protein 2A 2 2
MIRT683143 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT688535 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT689429 CYB561 cytochrome b561 2 2
MIRT689535 KIAA0513 KIAA0513 2 2
MIRT689895 SOD2 superoxide dismutase 2 2 2
MIRT695990 SNX19 sorting nexin 19 2 2
MIRT697781 UBXN7 UBX domain protein 7 2 2
MIRT702915 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703145 GPR137C G protein-coupled receptor 137C 2 2
MIRT703525 FKBP15 FK506 binding protein 15 2 2
MIRT704537 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704998 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT705722 AMMECR1L AMMECR1 like 2 2
MIRT707121 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT707452 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707776 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT707889 SLC30A7 solute carrier family 30 member 7 2 2
MIRT720532 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT723860 CD209 CD209 molecule 2 2
MIRT725350 MUC21 mucin 21, cell surface associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548g Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-548g Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission