miRTarBase - #MIRT057521


—
pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-5p
Sequence 16| UAAAUCCCAUGGUGCCUUCUCCU |38
Evidence Experimental
Experiments SAGE
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 10 + 51299590 29233923, 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs113212828 2 dbSNP
rs1265154909 7 dbSNP
rs76759855 9 dbSNP
rs1032735304 10 dbSNP
rs1318073696 10 dbSNP
rs1486056689 11 dbSNP
rs1225930966 12 dbSNP
rs1011066926 14 dbSNP
rs1261327694 19 dbSNP
rs1020985018 22 dbSNP
rs1426923077 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CEP55   
Synonyms C10orf3, CT111, URCC6
Description centrosomal protein 55
Transcript NM_001127182   
Other Transcripts NM_018131   
Expression
Putative miRNA Targets on CEP55
3'UTR of CEP55
(miRNA target sites are highlighted)		 
>CEP55|NM_001127182|3'UTR
   1 CAAAATAAGTATTTGTTTTGATATTAAAAGATTCAATACTGTATTTTCTGTTAGCTTGTGGGCATTTTGAATTATATATT
  81 TCACATTTTGCATAAAACTGCCTATCTACCTTTGACACTCCAGCATGCTAGTGAATCATGTATCTTTTAGGCTGCTGTGC
 161 ATTTCTCTTGGCAGTGATACCTCCCTGACATGGTTCATCATCAGGCTGCAATGACAGAATGTGGTGAGCAGCGTCTACTG
 241 AGACTACTAACATTTTGCACTGTCAAAATACTTGGTGAGGAAAAGATAGCTCAGGTTATTGCTAATGGGTTAATGCACCA
 321 GCAAGCAAAATATTTTATGTTTTGGGGGTTTTGAAAAATCAAAGATAATTAACCAAGGATCTTAACTGTGTTCGCATTTT
 401 TTATCCAAGCACTTAGAAAACCTACAATCCTAATTTTGATGTCCATTGTTAAGAGGTGGTGATAGATACTATTTTTTTTT
 481 TCATATTGTATAGCGGTTATTAGAAAAGTTGGGGATTTTCTTGATCTTTATTGCTGCTTACCATTGAAACTTAACCCAGC
 561 TGTGTTCCCCAACTCTGTTCTGCGCACGAAACAGTATCTGTTTGAGGCATAATCTTAAGTGGCCACACACAATGTTTTCT
 641 CTTATGTTATCTGGCAGTAACTGTAACTTGAATTACATTAGCACATTCTGCTTAGCTAAAATTGTTAAAATAAACTTTAA
 721 TAAACCCATGTAGCCCTCTCATTTGATTGACAGTATTTTAGTTATTTTTGGCATTCTTAAAGCTGGGCAATGTAATGATC
 801 AGATCTTTGTTTGTCTGAACAGGTATTTTTATACATGCTTTTTGTAAACCAAAAACTTTTAAATTTCTTCAGGTTTTCTA
 881 ACATGCTTACCACTGGGCTACTGTAAATGAGAAAAGAATAAAATTATTTAATGTTTTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucCUCUUCCGUGGUACCCUAAAu 5'
            || ||| ::    ||||||| 
Target 5' taGAAAAGTTG----GGGATTTt 3'
 501 - 519 147.00 -8.70
2 
miRNA  3' uccucuuccgugguaCCCUAAAu 5'
                         |||:||| 
Target 5' atattttatgttttgGGGGTTTt 3'
 330 - 352 124.00 -8.40
3 
miRNA  3' uccucuucCGUGGUACCC-UAAAu 5'
                  || :::|||| |||| 
Target 5' ttctgttaGC-TTGTGGGCATTTt 3'
 46 - 68 118.00 -7.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31580282 10 COSMIC
COSN30116664 20 COSMIC
COSN5293729 32 COSMIC
COSN31559862 88 COSMIC
COSN1507337 232 COSMIC
COSN20107393 353 COSMIC
COSN1507338 526 COSMIC
COSN24266314 910 COSMIC
COSN5889592 929 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1028668062 2 dbSNP
rs376713552 10 dbSNP
rs760563203 10 dbSNP
rs369071979 12 dbSNP
rs1211983142 16 dbSNP
rs1260245458 36 dbSNP
rs1474474428 37 dbSNP
rs1179589907 38 dbSNP
rs1187854963 40 dbSNP
rs755379142 41 dbSNP
rs560507013 42 dbSNP
rs1253863908 49 dbSNP
rs1227080551 67 dbSNP
rs968202669 75 dbSNP
rs1235196746 77 dbSNP
rs544562270 79 dbSNP
rs1305970680 87 dbSNP
rs900048835 92 dbSNP
rs1378938859 93 dbSNP
rs574084114 109 dbSNP
rs1466184850 113 dbSNP
rs1401812308 115 dbSNP
rs1209740651 117 dbSNP
rs1467730349 123 dbSNP
rs1378587508 140 dbSNP
rs1178339745 141 dbSNP
rs1438458073 161 dbSNP
rs1240559898 168 dbSNP
rs1178768346 172 dbSNP
rs1254506412 174 dbSNP
rs554798269 182 dbSNP
rs1481717075 191 dbSNP
rs1441304479 194 dbSNP
rs1196459540 197 dbSNP
rs1201850719 200 dbSNP
rs992748106 200 dbSNP
rs1051511803 206 dbSNP
rs770861276 212 dbSNP
rs918134214 215 dbSNP
rs1237684310 228 dbSNP
rs1355826216 232 dbSNP
rs1309846084 233 dbSNP
rs969614202 234 dbSNP
rs111293847 244 dbSNP
rs772620389 244 dbSNP
rs1332210737 247 dbSNP
rs1431210482 257 dbSNP
rs1433583089 258 dbSNP
rs1175046966 260 dbSNP
rs1403174329 261 dbSNP
rs980735946 263 dbSNP
rs776571066 271 dbSNP
rs543160106 272 dbSNP
rs1382744792 280 dbSNP
rs1463150092 281 dbSNP
rs186840462 286 dbSNP
rs1366221986 288 dbSNP
rs75712754 293 dbSNP
rs34087318 307 dbSNP
rs1442713588 315 dbSNP
rs1262007534 319 dbSNP
rs908639455 320 dbSNP
rs1002441386 323 dbSNP
rs35067961 326 dbSNP
rs1286398310 337 dbSNP
rs940508657 338 dbSNP
rs1354086301 339 dbSNP
rs1282565314 345 dbSNP
rs1030416457 347 dbSNP
rs370079649 349 dbSNP
rs3834415 349 dbSNP
rs552052805 349 dbSNP
rs200560574 350 dbSNP
rs12779614 353 dbSNP
rs771876020 361 dbSNP
rs901724369 368 dbSNP
rs1219041841 370 dbSNP
rs1299558995 375 dbSNP
rs559622627 378 dbSNP
rs1020855695 380 dbSNP
rs1319330269 388 dbSNP
rs12245643 395 dbSNP
rs1389203656 407 dbSNP
rs1164556261 408 dbSNP
rs1472821411 426 dbSNP
rs1422407845 428 dbSNP
rs1050073562 430 dbSNP
rs1191088203 431 dbSNP
rs1478562639 438 dbSNP
rs1263637539 445 dbSNP
rs1220550550 449 dbSNP
rs1449850680 454 dbSNP
rs1291908627 460 dbSNP
rs1211755454 466 dbSNP
rs1229391185 467 dbSNP
rs140828289 472 dbSNP
rs547824055 472 dbSNP
rs979105238 472 dbSNP
rs1274095262 483 dbSNP
rs1482094694 484 dbSNP
rs1202992773 486 dbSNP
rs12245717 489 dbSNP
rs975948291 493 dbSNP
rs921461189 495 dbSNP
rs1190424643 496 dbSNP
rs536647524 497 dbSNP
rs550329956 498 dbSNP
rs191623783 505 dbSNP
rs542866649 509 dbSNP
rs1423877963 512 dbSNP
rs956668041 515 dbSNP
rs1013667592 521 dbSNP
rs764332748 524 dbSNP
rs1476901666 526 dbSNP
rs183868661 536 dbSNP
rs774734037 541 dbSNP
rs1038416498 543 dbSNP
rs145548789 551 dbSNP
rs1002308265 557 dbSNP
rs1196829631 558 dbSNP
rs1350978413 559 dbSNP
rs1436313509 560 dbSNP
rs1320348869 563 dbSNP
rs919903881 564 dbSNP
rs1218824719 570 dbSNP
rs572706896 572 dbSNP
rs1364516294 576 dbSNP
rs762103787 584 dbSNP
rs746630554 585 dbSNP
rs1328757743 586 dbSNP
rs1448319302 588 dbSNP
rs908592615 594 dbSNP
rs768006824 605 dbSNP
rs535024318 623 dbSNP
rs1248274350 633 dbSNP
rs1020821418 635 dbSNP
rs1290615586 641 dbSNP
rs975913620 645 dbSNP
rs375737489 646 dbSNP
rs931866303 657 dbSNP
rs1220738706 664 dbSNP
rs964787990 665 dbSNP
rs1244805433 675 dbSNP
rs1459124986 685 dbSNP
rs1233476507 706 dbSNP
rs1050308685 715 dbSNP
rs1310591207 718 dbSNP
rs41290214 725 dbSNP
rs1371184015 728 dbSNP
rs574122915 729 dbSNP
rs1307667579 730 dbSNP
rs1449603877 745 dbSNP
rs1373457595 759 dbSNP
rs542999367 760 dbSNP
rs986999595 779 dbSNP
rs188965147 784 dbSNP
rs1164506703 793 dbSNP
rs892211531 797 dbSNP
rs778926169 806 dbSNP
rs1013322787 807 dbSNP
rs1160405356 818 dbSNP
rs1419540193 819 dbSNP
rs189688979 830 dbSNP
rs1025084687 844 dbSNP
rs1181345270 850 dbSNP
rs1405361506 857 dbSNP
rs1482432731 857 dbSNP
rs116816457 859 dbSNP
rs1347361295 860 dbSNP
rs186932514 874 dbSNP
rs1242971073 878 dbSNP
rs938035190 881 dbSNP
rs1311474282 890 dbSNP
rs1226107083 896 dbSNP
rs528288559 898 dbSNP
rs1293498691 905 dbSNP
rs953086488 910 dbSNP
rs1398967517 915 dbSNP
rs1363308522 917 dbSNP
rs1358402892 918 dbSNP
rs1299734918 929 dbSNP
rs1454772385 937 dbSNP
rs1349214546 938 dbSNP
rs896599054 940 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000371485.3 | 3UTR | AUUUUCUUGAUCUUUAUUGCUGCUUACCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.641 0 -0.515 0.02 16 Click to see details
UCEC 0.583 0.05 0.200 0.3 9 Click to see details
BLCA 0.314 0.17 0.400 0.11 11 Click to see details
KIRP 0.215 0.2 0.108 0.34 17 Click to see details
THCA -0.097 0.26 -0.203 0.08 48 Click to see details
CHOL -0.661 0.27 -0.500 0.33 3 Click to see details
BRCA 0.073 0.31 0.040 0.4 46 Click to see details
LUAD -0.147 0.35 -0.117 0.38 9 Click to see details
LIHC 0.087 0.36 -0.051 0.42 20 Click to see details
LUSC 0.041 0.43 0.081 0.36 23 Click to see details
PRAD -0.076 0.43 0.143 0.37 8 Click to see details
KIRC 0.035 0.43 0.096 0.32 27 Click to see details
STAD 0.019 0.47 0.028 0.46 18 Click to see details
KICH -0.006 0.49 0.093 0.37 15 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
PAAD -0.013 0.5 -0.500 0.33 3 Click to see details
107 hsa-miR-605-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001230 SEC24D SEC24 homolog D, COPII coat complex component 3 1
MIRT016155 TP53 tumor protein p53 2 1
MIRT016156 TCEAL1 transcription elongation factor A like 1 1 1
MIRT016157 MDM2 MDM2 proto-oncogene 2 1
MIRT040476 YBX1 Y-box binding protein 1 1 1
MIRT040477 TMEM64 transmembrane protein 64 1 1
MIRT040478 KDM5C lysine demethylase 5C 1 1
MIRT040479 TRAF4 TNF receptor associated factor 4 1 1
MIRT040480 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT040481 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT055125 SCD stearoyl-CoA desaturase 2 2
MIRT057521 CEP55 centrosomal protein 55 2 2
MIRT081129 LDLR low density lipoprotein receptor 2 6
MIRT096817 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT100961 CENPQ centromere protein Q 2 4
MIRT263338 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT274710 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT311193 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT360127 DEK DEK proto-oncogene 2 2
MIRT438269 PSMD10 proteasome 26S subunit, non-ATPase 10 2 1
MIRT442464 SLC25A13 solute carrier family 25 member 13 2 2
MIRT446110 TSC22D2 TSC22 domain family member 2 2 2
MIRT463119 ZNF507 zinc finger protein 507 2 2
MIRT470566 POU2F1 POU class 2 homeobox 1 2 2
MIRT475059 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT482538 ACTB actin beta 2 4
MIRT494136 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT495209 EDN3 endothelin 3 2 2
MIRT495235 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT496762 MANBAL mannosidase beta like 2 2
MIRT498885 ZNF12 zinc finger protein 12 2 10
MIRT499280 NBPF11 NBPF member 11 2 2
MIRT507063 H3F3B H3 histone family member 3B 2 2
MIRT508352 HES7 hes family bHLH transcription factor 7 2 8
MIRT510740 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT519872 ZFP62 ZFP62 zinc finger protein 2 4
MIRT521272 RTN4 reticulon 4 2 4
MIRT522324 NFIB nuclear factor I B 2 6
MIRT525011 ACTN4 actinin alpha 4 2 6
MIRT526608 AASDH aminoadipate-semialdehyde dehydrogenase 2 4
MIRT529043 ARL9 ADP ribosylation factor like GTPase 9 2 2
MIRT529545 ZNF678 zinc finger protein 678 2 2
MIRT532500 HOXA13 homeobox A13 2 2
MIRT532599 SIX4 SIX homeobox 4 2 2
MIRT534044 STK4 serine/threonine kinase 4 2 2
MIRT534087 SPPL3 signal peptide peptidase like 3 2 2
MIRT534249 SLC16A1 solute carrier family 16 member 1 2 2
MIRT534286 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534555 RUNX1 runt related transcription factor 1 2 2
MIRT536765 HOXB2 homeobox B2 2 2
MIRT537227 GAN gigaxonin 2 2
MIRT551105 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT552247 DUSP3 dual specificity phosphatase 3 2 2
MIRT554361 SFXN5 sideroflexin 5 2 2
MIRT557402 H3F3C H3 histone family member 3C 2 2
MIRT559116 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT560494 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT562296 GLO1 glyoxalase I 2 2
MIRT562597 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT563857 ALYREF Aly/REF export factor 2 4
MIRT565665 SIX1 SIX homeobox 1 2 2
MIRT568253 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT609593 GPM6B glycoprotein M6B 2 2
MIRT611552 GGT6 gamma-glutamyltransferase 6 2 2
MIRT613451 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT615516 PRRC2A proline rich coiled-coil 2A 2 2
MIRT617766 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT619134 MCOLN3 mucolipin 3 2 2
MIRT621365 CAP2 cyclase associated actin cytoskeleton regulatory protein 2 2 2
MIRT625804 MDC1 mediator of DNA damage checkpoint 1 2 2
MIRT626954 PRDM2 PR/SET domain 2 2 2
MIRT627716 RCAN1 regulator of calcineurin 1 2 2
MIRT628069 KCNJ13 potassium voltage-gated channel subfamily J member 13 2 2
MIRT630451 GTPBP8 GTP binding protein 8 (putative) 2 2
MIRT635533 ELMOD2 ELMO domain containing 2 2 2
MIRT636206 SULF2 sulfatase 2 2 2
MIRT638763 EPHA4 EPH receptor A4 2 2
MIRT640324 STAT1 signal transducer and activator of transcription 1 2 2
MIRT644548 SPOP speckle type BTB/POZ protein 2 2
MIRT645114 TMX2 thioredoxin related transmembrane protein 2 2 2
MIRT647778 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT650112 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT650136 ABCB7 ATP binding cassette subfamily B member 7 2 2
MIRT650310 SLC35E2 solute carrier family 35 member E2 2 2
MIRT650930 ST6GALNAC1 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 2 2
MIRT651018 ZNF740 zinc finger protein 740 2 2
MIRT653541 SLC38A9 solute carrier family 38 member 9 2 2
MIRT655752 NR2C2 nuclear receptor subfamily 2 group C member 2 2 2
MIRT656908 KIAA1958 KIAA1958 2 2
MIRT657854 GJD3 gap junction protein delta 3 2 2
MIRT658215 FBXO21 F-box protein 21 2 2
MIRT659884 CAPN7 calpain 7 2 2
MIRT659922 CACNA1E calcium voltage-gated channel subunit alpha1 E 2 2
MIRT660055 C12orf5 TP53 induced glycolysis regulatory phosphatase 1 1
MIRT664616 LIMD1 LIM domains containing 1 2 2
MIRT665392 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT667887 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT669018 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT688419 DUSP2 dual specificity phosphatase 2 2 2
MIRT691888 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT709530 GEN1 GEN1, Holliday junction 5' flap endonuclease 2 2
MIRT711013 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT714731 CENPH centromere protein H 2 2
MIRT719897 PTGIS prostaglandin I2 synthase 2 2
MIRT725028 CX3CL1 C-X3-C motif chemokine ligand 1 2 2
MIRT734348 P2RY12 purinergic receptor P2Y12 3 0
MIRT736719 TNFAIP3 TNF alpha induced protein 3 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-605-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-605-5p Navitoclax 24978538 NSC759659 sensitive High Colorectal Cancer cell line (HCT-116, CHL1)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (BxPC‐3, PANC‐1)
hsa-miR-605-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1155)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-miR-605-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-miR-605-5p Fluorouracil 3385 NSC19893 approved resistant Low Colon Cancer cell line (HT-29, LoVo)
hsa-miR-605-5p Everolimus + Panobinostat sensitive Low Clear Cell Renal Cell Carcinoma tissue
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-605-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-605-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-605-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-605-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-605-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-605-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)
hsa-miR-605-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission