>EFNA1|NM_004428|3'UTR
   1 AGGTGTATGCCACACCTGGCCTTAAAGAGGGACAGGCTGAAGAGAGGGACAGGCACTCCAAACCTGTCTTGGGGCCACTT
  81 TCAGAGCCCCCAGCCCTGGGAACCACTCCCACCACAGGCATAAGCTATCACCTAGCAGCCTCAAAACGGGTCAGTATTAA
 161 GGTTTTCAACCGGAAGGAGGCCAACCAGCCCGACAGTGCCATCCCCACCTTCACCTCGGAGGGATGGAGAAAGAAGTGGA
 241 GACAGTCCTTTCCCACCATTCCTGCCTTTAAGCCAAAGAAACAAGCTGTGCAGGCATGGTCCCTTAAGGCACAGTGGGAG
 321 CTGAGCTGGAAGGGGCCACGTGGATGGGCAAAGCTTGTCAAAGATGCCCCCTCCAGGAGAGAGCCAGGATGCCCAGATGA
 401 ACTGACTGAAGGAAAAGCAAGAAACAGTTTCTTGCTTGGAAGCCAGGTACAGGAGAGGCAGCATGCTTGGGCTGACCCAG
 481 CATCTCCCAGCAAGACCTCATCTGTGGAGCTGCCACAGAGAAGTTTGTAGCCAGGTACTGCATTCTCTCCCATCCTGGGG
 561 CAGCACTCCCCAGAGCTGTGCCAGCAGGGGGGCTGTGCCAACCTGTTCTTAGAGTGTAGCTGTAAGGGCAGTGCCCATGT
 641 GTACATTCTGCCTAGAGTGTAGCCTAAAGGGCAGGGCCCACGTGTATAGTATCTGTATATAAGTTGCTGTGTGTCTGTCC
 721 TGATTTCTACAACTGGAGTTTTTTTATACAATGTTCTTTGTCTCAAAATAAAGCAATGTGTTTTTTCGGACATGCTTTTC
 801 TGCCACTCCATATTAAAACATATGACCATTGAGTCCCTGCTAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuaauuuguUAAGAGAc 5' ||||||| Target 5' aggtactgcATTCTCTc 3'	533 - 549	140.00	-6.30
2	miRNA 3' cuAAUUUGU--UAAGAGAc 5' ||| ||| :||||:| Target 5' ttTTATACAATGTTCTTTg 3'	742 - 760	125.00	-7.30
3	miRNA 3' cuaaUUUGUUAAGAGAc 5' |||| | |:||| Target 5' caagAAAC-AGTTTCTt 3'	418 - 433	104.00	-6.60

Mutant ID	Mutant Position	Mutant Source
COSN30182678	4	COSMIC
COSN18008252	8	COSMIC
COSN30495323	18	COSMIC
COSN20073781	38	COSMIC
COSN31574130	69	COSMIC
COSN9363737	95	COSMIC
COSN21104414	242	COSMIC
COSN31536087	301	COSMIC
COSN32057311	325	COSMIC
COSN24297590	341	COSMIC
COSN1407223	573	COSMIC
COSN1407225	695	COSMIC
rs12904	155	GWAS

Mutant ID	Mutant Position	Mutant Source
rs1244650794	4	dbSNP
rs774976417	6	dbSNP
rs9297	8	dbSNP
rs564674783	9	dbSNP
rs1254258538	12	dbSNP
rs201450895	18	dbSNP
rs374822353	21	dbSNP
rs1032932621	26	dbSNP
rs1342555827	27	dbSNP
rs1364770752	30	dbSNP
rs1215500145	32	dbSNP
rs1289663005	38	dbSNP
rs750303308	40	dbSNP
rs775058359	42	dbSNP
rs760336648	45	dbSNP
rs1371905169	47	dbSNP
rs1488002735	49	dbSNP
rs1214621476	51	dbSNP
rs112138844	64	dbSNP
rs1429301781	68	dbSNP
rs966154810	71	dbSNP
rs562426563	84	dbSNP
rs1402828173	85	dbSNP
rs974521537	88	dbSNP
rs529720837	94	dbSNP
rs73001398	96	dbSNP
rs1454441829	97	dbSNP
rs1396417038	101	dbSNP
rs1054624003	105	dbSNP
rs994788856	119	dbSNP
rs1485237945	120	dbSNP
rs1242658414	122	dbSNP
rs1217789563	134	dbSNP
rs1440489936	145	dbSNP
rs1042163120	148	dbSNP
rs1233916933	148	dbSNP
rs903705846	149	dbSNP
rs1000730338	150	dbSNP
rs12904	155	dbSNP
rs1289979359	173	dbSNP
rs527586697	181	dbSNP
rs552004505	186	dbSNP
rs146467377	190	dbSNP
rs1374093001	192	dbSNP
rs1463029462	193	dbSNP
rs1185325576	195	dbSNP
rs1046115052	206	dbSNP
rs537630211	218	dbSNP
rs189626946	219	dbSNP
rs1396546257	220	dbSNP
rs1012950487	224	dbSNP
rs6694256	226	dbSNP
rs894970726	234	dbSNP
rs1427463266	239	dbSNP
rs982869037	241	dbSNP
rs994701362	246	dbSNP
rs1256606005	248	dbSNP
rs1211293101	254	dbSNP
rs1486506639	255	dbSNP
rs1469316072	257	dbSNP
rs1161817478	263	dbSNP
rs769668333	278	dbSNP
rs1306994347	290	dbSNP
rs1296377170	294	dbSNP
rs148327042	296	dbSNP
rs1354085020	297	dbSNP
rs1177219447	300	dbSNP
rs181155559	313	dbSNP
rs1415809204	316	dbSNP
rs1428550131	317	dbSNP
rs1296101516	323	dbSNP
rs962909410	336	dbSNP
rs749287793	340	dbSNP
rs746542928	345	dbSNP
rs921556380	347	dbSNP
rs1459846437	360	dbSNP
rs1383712370	367	dbSNP
rs572423902	368	dbSNP
rs185165544	372	dbSNP
rs1248069793	377	dbSNP
rs965779246	382	dbSNP
rs1480420466	389	dbSNP
rs1252012991	424	dbSNP
rs974891598	431	dbSNP
rs1200639786	436	dbSNP
rs912215440	448	dbSNP
rs921715420	450	dbSNP
rs957518396	453	dbSNP
rs1357831879	469	dbSNP
rs990253537	470	dbSNP
rs1390511091	471	dbSNP
rs1373568869	483	dbSNP
rs913415564	491	dbSNP
rs1803186	495	dbSNP
rs1459433593	497	dbSNP
rs946257759	498	dbSNP
rs1165565811	500	dbSNP
rs1267276957	502	dbSNP
rs1480216604	508	dbSNP
rs1361903742	513	dbSNP
rs1200506342	514	dbSNP
rs1158070762	525	dbSNP
rs981720208	526	dbSNP
rs928622496	529	dbSNP
rs1431528724	539	dbSNP
rs773230383	549	dbSNP
rs937390157	555	dbSNP
rs1056268568	558	dbSNP
rs936532485	569	dbSNP
rs1359053106	573	dbSNP
rs1238819506	587	dbSNP
rs1317845854	587	dbSNP
rs200465926	587	dbSNP
rs79858335	593	dbSNP
rs77542364	594	dbSNP
rs895037071	596	dbSNP
rs1438175020	606	dbSNP
rs1013941659	611	dbSNP
rs1325976843	612	dbSNP
rs1443071682	617	dbSNP
rs1024271920	623	dbSNP
rs907212363	631	dbSNP
rs141515891	633	dbSNP
rs1015708848	639	dbSNP
rs576609812	641	dbSNP
rs1301039866	662	dbSNP
rs1344680891	675	dbSNP
rs768372089	680	dbSNP
rs974239896	680	dbSNP
rs774117591	682	dbSNP
rs761357675	683	dbSNP
rs1405171856	686	dbSNP
rs1028928225	697	dbSNP
rs760796408	700	dbSNP
rs1205000821	712	dbSNP
rs1370462841	716	dbSNP
rs11545252	718	dbSNP
rs1222707705	720	dbSNP
rs1288596176	727	dbSNP
rs987466022	734	dbSNP
rs1005207619	740	dbSNP
rs543632739	744	dbSNP
rs1303551678	749	dbSNP
rs1318029470	750	dbSNP
rs901494573	752	dbSNP
rs1218612657	753	dbSNP
rs1324118010	754	dbSNP
rs1290041285	756	dbSNP
rs1294782312	756	dbSNP
rs995881508	757	dbSNP
rs1386941905	763	dbSNP
rs113958160	765	dbSNP
rs1223433081	765	dbSNP
rs945084884	767	dbSNP
rs1271328782	774	dbSNP
rs1375102977	775	dbSNP
rs977792741	781	dbSNP
rs1479055812	782	dbSNP
rs1371338251	785	dbSNP
rs150889956	787	dbSNP
rs1429613064	788	dbSNP
rs111787654	792	dbSNP
rs957087207	796	dbSNP
rs575134804	801	dbSNP
rs925062922	811	dbSNP
rs1485524481	813	dbSNP
rs1280621629	820	dbSNP
rs1336961293	823	dbSNP
rs989864014	827	dbSNP
rs1420773746	830	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.