>GAL|NM_015973|3'UTR
   1 GAGCCTCCTGGGCATGTTTGTCTGTGTGCTGTAACCTGAAGTCAAACCTTAAGATAATGGATAATCTTCGGCCAATTTAT
  81 GCAGAGTCAGCCATTCCTGTTCTCTTTGCCTTGATGTTGTGTTGTTATCATTTAAGATTTTTTTTTTTTGGTAATTATTT
 161 TGAGTGGCAAAATAAAGAATAGCAATTAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugGCCGG--AUGUCCGUCUCAGu 5' ||||| | :| |||||||| Target 5' ttCGGCCAATTTATGCAGAGTCa 3'	67 - 89	165.00	-24.30
2	miRNA 3' uggccgGAUGUCCGUC-UCAGu 5' ||::| | | |||| Target 5' tgtgtgCTGTAACCTGAAGTCa 3'	23 - 44	87.00	-8.40
3	miRNA 3' uggccggauguccguCUCAgu 5' |||| Target 5' tttggtaattattttGAGTgg 3'	147 - 167	80.00	-6.87

Mutant ID	Mutant Position	Mutant Source
COSN26732575	16	COSMIC
COSN5709056	17	COSMIC
COSN30603027	37	COSMIC
COSN30155711	48	COSMIC
COSN30156734	54	COSMIC
COSN30631784	70	COSMIC
COSN30102620	78	COSMIC
COSN31573945	109	COSMIC
COSN31575324	137	COSMIC
COSN1136902	150	COSMIC
COSN18735637	150	COSMIC
COSN27966507	165	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1053227805	2	dbSNP
rs1461485959	4	dbSNP
rs771130833	6	dbSNP
rs1258630572	7	dbSNP
rs1422435013	9	dbSNP
rs1187404574	14	dbSNP
rs1316186403	15	dbSNP
rs1042577	16	dbSNP
rs759983286	17	dbSNP
rs1157033676	23	dbSNP
rs1163715419	26	dbSNP
rs770259347	27	dbSNP
rs1470392740	30	dbSNP
rs1304813457	33	dbSNP
rs1459557493	36	dbSNP
rs1021906174	37	dbSNP
rs1376648093	44	dbSNP
rs1419644802	46	dbSNP
rs775052057	48	dbSNP
rs377732390	51	dbSNP
rs538910813	52	dbSNP
rs970706455	54	dbSNP
rs557252719	66	dbSNP
rs1469846892	67	dbSNP
rs575560300	69	dbSNP
rs1191690119	70	dbSNP
rs750899082	71	dbSNP
rs1404814540	76	dbSNP
rs1001908439	87	dbSNP
rs1033307496	93	dbSNP
rs536237066	106	dbSNP
rs1213240136	110	dbSNP
rs1332942714	111	dbSNP
rs1415475843	112	dbSNP
rs888628978	114	dbSNP
rs1336728463	119	dbSNP
rs1338564105	124	dbSNP
rs80069040	130	dbSNP
rs774668297	138	dbSNP
rs796423735	138	dbSNP
rs991879879	138	dbSNP
rs75147512	139	dbSNP
rs908390210	151	dbSNP
rs1310954440	152	dbSNP
rs1377128081	154	dbSNP
rs1237902640	155	dbSNP
rs1277491316	158	dbSNP
rs573211013	161	dbSNP
rs1351226102	163	dbSNP
rs1200954767	165	dbSNP
rs1323858914	165	dbSNP
rs1262485866	168	dbSNP
rs1419286972	183	dbSNP
rs533171727	185	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.