| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-497 |
| Genomic Coordinates | chr17: 7017911 - 7018022 |
| Synonyms | MIRN497, hsa-mir-497, MIR497 |
| Description | Homo sapiens miR-497 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | ||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-497-5p | |||||||||||||||||||||
| Sequence | 24| CAGCAGCACACUGUGGUUUGU |44 | |||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||
| Experiments | Array-cloned | |||||||||||||||||||||
| Editing Events in miRNAs |
|
|||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | AMOTL1 | ||||||||||||||||||||
| Synonyms | JEAP | ||||||||||||||||||||
| Description | angiomotin like 1 | ||||||||||||||||||||
| Transcript | NM_130847 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on AMOTL1 | |||||||||||||||||||||
| 3'UTR of AMOTL1 (miRNA target sites are highlighted) |
>AMOTL1|NM_130847|3'UTR 1 CTGCCATCCCTGTGGAATTTCAGTACAGAACACTGACAAACAAGGAAAGCGGCAGAGAAAGAAGAAAGACCTAGAAGGTT 81 GTAGATGGGAAATCAGGAATGATTTGAACTGATAAAGATTTCAGACTCATAAGAACACATTTTATAAATGTTAAACACAA 161 AAACTACATGACTGAAGATAGAAGAGAATGCGATGGATTTTATTACACATGGTGGAAGAGAGAAGAGGCGTGTAGGTTTG 241 CAAACAAAGTTAAGAAATAGGAAACTGAATTTTTCATTGTACAGAAAATGTATCTCTTGGGGAGGGCCTGTGTACCCCCA 321 TTCTCTGATTATAAACAGATAAACCCAAATGTGGATCATCCTTGGAATACCCCCATTCTCCTTGCCTCTTAGCATGTTTG 401 ATTTAAGAAAAGCCTCCAGGAAATCTTGAGAGCCTGTCTTGGCATAATGCAGTGTCACCTGTGCCAACCATGGGGTGTCC 481 CGTGAGTGTGAGTGTGGCAGTGAGAAGAAGCATCGAGGGCGAGGGGAATATGAAAGTTGGTCTTCACCTAATTACCTGTT 561 TGGTTTGGATTTTCAAGAGATGATTGGGCTTCTTAGCTTTTCTGAATTCTGCAGTATTTTCTAAACAGGATAGATTATGA 641 TCTCGGTCCCCATCCATCCTAACTTCTGAGTTCATCTCTGTCTCTGCTTTACAGTCTTTAATTTTTTGTTGTTCCTTCAT 721 TTTTTTCTTTTTAATAAGACATAGCAGAATTCCTTAGGTATGGGATTTATGAGACCAGTACCTGAACTGTCATCATTCCT 801 ACTGTGTTTGATAGTGACCAGTAGGACAAAGCCACGTGCCGACTTCCTGGCTGCTTCACCTTTGCATAGCTGGGTTGCAG 881 CTGCGAACCTCATTCTGACTGTGAACTAAGCAAGCTTTGAGGAGGCAGGAGATTCCGTGGGTCCCTGTGACATATTGCAT 961 TAAGATCGTGGCACTTGCTTTTTTGTCTTTCACATCGGCTGTCTTGCAAGGAGCTTGACATTTCCAAATTCCATTGCTCT 1041 GTTTGGGGAAGACTTAGGACAGCACTCCAGGAAACAGATGACAATTTACAGACAGTTGTCTCAGTGGTTTCCAGAATCTC 1121 ACCAGCCTCCCGTATAGCTTCTTGTATTGAGGCTCATGAGCGTATTCACACTCTTTCCTCCCCCGCGCACGCCTCTGCTT 1201 GCTCTCGATCAGCATCCAGACCTCCGTGGCACCAGGTTGCCTCTGTTGTGAACTTCTTTTGTAACCTACCAGGCCAGTTG 1281 TATATACAGTGTTGTCAGGTTTTTCCGGGTTTCAGTTTTGAGGCAGTTTATTCAAAGTGAGACAGAAGTGCCACGGAAAA 1361 GAGGCAGGAGTGTGTTAGGTGGTGGGTCCATTAGACCTCTGCTGTGACATTGCATATTCAGCTCTGCAGACACTGGCTTC 1441 CTTTACAAATCTAAGAGATGCTGGATTAGAAAAGAGGAGAAGCTCATCGGGCCATCAGAGAGATGCTCCTACAGGGTCCT 1521 GATGTTTTTGTACCTCCAGGTCAGCTGGATCGCTGTTTTCCCAGTTCCCTTTGCTCATGCTTACTTAGAGGAAGAAAGAA 1601 AGGGGGGTACCTCTTCCAAGTACCTTCTAAATGAAACACTCAAGAGAGTGCTACTCAGGAAACTTTGCTTGGATCCTAAA 1681 ATGGACTGGTCTTGGGTGTGTAACCCCGGTGAAGTTATAGCCTCCCCAAATTGAGGTGACAGAAGGAAGACAAGAGGTGT 1761 AAGCTGGAGAGGGAAGGGAAGAAATCAGTGGCTTTGGCCAGCCTCTGTGCCACCCAGTACGACAGAGGAGTGGGAACTGG 1841 CCCTCTGGGGCTCTGCTTGGCCATAGGCACTGCACATTGTGCCACCTGCTCATCACCTCCTCTAGTCTCACACTGAGCAT 1921 CGGAGTACCTGTTGTGCAGACAGGAAAACTGAGGAGCTCTGAGAGGCTGAGCATGGAGCTCACCCCATGCCATAGGGTGT 2001 GGGAAGAGGGCACAGGAGGCCTCATCCATGGGGGAAAGGGTTGAGGATGGACATGGGTGGGGAGAGGGCATAGACATCCC 2081 TTCCTAATCTCTGTTCCCACCACATTTCATAGGAGATGAGTTAGGAGATGACAGCTAACTCTCTTAAGGACATTTTGACC 2161 CCAGTTTATGTTGGGGATGGACCAGAAAGGAAAATGTCTAGAGATAGGAAGGTAAATCAACTCTGCCAGCCCCTACCATC 2241 AGGTCTGGGCCACCCCAAACTTGGGCTGCCTCCCTTAGACATAGGTTAGAGTGAGAGACCCAGCTGTTTCTCCCGAAGCC 2321 TCGTCTTCATGCCCCAGACACCTGATTGCCCCAATCAGGTGTCAGACTTGCTTGCTCTTCGAGGTCCCCCTGAGCTGCCA 2401 AGTGTTTTCATTGTAAACAGACACATCGCCATGTTTCAGGGCTTCAACGGCATTGTATTTTGGACTTTGACCGTATTTTT 2481 TTTCTCTTAACCTACTGAGACTCTTCCTTAAGAACAGGATCTATAGCTTTAAAATGTCTTCTTCTATGGGAAATTTCCTG 2561 CCAAGCCAGGGCACTAAATTCTTTCATCATTAGAGCTTTCCTGAAGTCCGGCCATATACTGAGTACCTGCTCTGAGTTCT 2641 GGGCAGCTTACAATATCTTAAACAGATTTTCAGAAAAATAATGCAACTATATTTTCTAGTGTCAACTGTATGCAAACAGT 2721 GTGGTAAATACCTTTTAATTAGTCCTCCACCCACCTGGAGTACAGGGGGTGCGTTTATTATTCTGATTTCACTGATGAGG 2801 AAATGGGCTCAGAAAGGTTAAGTCCCTTCCTGAAATCTCACAGCCAGGAGAAGCTAGGATGATTTAAAACAAAGTTTGGA 2881 GAGGCACTGGGCATAGACCCTGGCTGTACAGCCTCTAACATGCGGCACTGCATCTTGGCAGTCTCTATGCCTGTCTGTGA 2961 TGTGTGTGTGCACGTGTAACTACACACACACACACACACACACACACACACACACACAGCTATCACACATCTCAGAGCCT 3041 AAGAAATAGGACTAAGCCCAGAACTCCTAGAATCACCTATAAATGCTAGGCATAGATGGAAATTATTGTGTTCCACCAGA 3121 AGCACAGCTCCAAACTATACCTAAAAAATATTTCTGCACTTCCCAGAGACCTGGACTTCAAACTTTCCCAGTGGAGCCTG 3201 ATTATAGAACTTGAGGGTCCTATCTCAGGATGAAGGGGAGAGGCCCTGGCTTCACGGGAAGGTATTCCAGCATTGTTCTG 3281 CTTCACCCTTGACTGCGTTGTCTGGCAGTTTCTGTGTGCTGCCAGGATATTATATGGAACTGGAGAAGTTGGAGTCAGGT 3361 CTCTGAAGCTAGAGTTTCACTAATTAGATGCCTCTGTACATGAGAACTATTACTGTCTGCAGGTCCATATAGCTAAGCTG 3441 CCAGGAAAAACACATTATCTTCCAAAACTTTCAGAGCATGTGCAGAACCCTTTCTTAGCGTTTTCTTCTCAGCATTTTCT 3521 CTGCCTCCCAGAGGCTGGCAGCCAGTGACACTGCAGAGTTCAGCATGTTCTAACCATGCACGCAGGGCAGGGGCTGCCTT 3601 GGCCCTCCTCAGGCTTTCGTTGGGAGAGCAGGCAGTGGTGGAGCCCTTCTGGGTGCAGTCCTCTGGGGTTGCTCTTTGGA 3681 ACTCATGTATGAGTTTGACTCCACAAGGCTTGGCATGGATACCAAAACAGTTGCAACAAATTAGTTCTGAACCTGGAACA 3761 GAGAATTCAGTGCTTCTGTTACTCAGGAAGGAGGTGTTCAGAATGCCCCGTGCAGAGCAGCCAGTCATTACTCTTGTTTG 3841 TTCTCACCTGGGTGCGCACCCTCATGATGCAGTGGCTGTAGCACCTTCATGCCAGGTGCTGAGAGAATGGGAAATTCTTC 3921 CTCCCCATTGACCTGAGTCCCAGAGACTTAGGGACACAGACTTCAGGTGAGGCTGCGGACCTCAGAAGCAGTGGATAATA 4001 GATTGGGGCATTAAAAGCTTTTGAGGCAGGGGGCTCATGTTTTGACTGCAGGGAGTTATGCTGAGCAAAGAGATGTGTTT 4081 TTCAAAACCAGGGTTCAAAACCAGTGTCCACGCTGGAGTAAGTGGAGCATGCTTCTCTGTGTTCTCTGAATGATCTTGCA 4161 CTCCTCTTAAGCAAAGGAGTACCATGACCATAGTCAGTGGGATCCCACAAATGTTCTTAAATGGGTAAGGCTTTAAGTAG 4241 CCAGAGAGTATCCAGCCTACCATTGGCTTCTCCACATCCTAAAACCTGAGACAGCCTTGGTATATGCTTTATAAATGTTT 4321 CTTTTCTTGTTGTTTAAGTAATTAAAGTGTTTAAAATGTCTTCATTAGATGTGACGATTGTTTAATGAGTTTGCCTCTGA 4401 CGTGTGGCTCCATGGGAGATAGGCAAAGTAATTAAGAAGTTACCAGAAATTGGTCGGCTGGGGAAATGCAAAAGTTAGCA 4481 TTTCAGTAGTGAATTTCTCCTGGAACAAATGAGCAATTTTTCCTCTTTCTCTTAAGTAGTATACCCTTTTCTCACTTAGT 4561 AATTTAATGGTATATAAAGACATGTGTATAAGTGAGTGCATACATATGAGGTATGACTATAGGGTTGTTTGTGGGAATTT 4641 CTTTTCCTAACATACAGAAGATCAAAGTGTTCATCTCACCCCGCCCTCCTTAAAAGGTGTCTTTTGGGAGACTATGTGCT 4721 CATTGACTATAGTGCTGCCAAGTAAAAATATCTTGGGAACTCTTCTACTAGAATGGCCTTCAGGGCTTGGCATGTTCCTT 4801 TGGTTTACCCTTAGAGATGAGAAATCCTCCTCCTTTGAGGATGGATTTAAGTTCTGGAAATAATCTCAAGTGCTTGATAG 4881 CACAGTTGGATGAAAAAAGATGGCAATTAAGGTAAGTTACACCATTTTTGTTTCTAAAAAAATCCCTAAGAAATTTCTTG 4961 GAATGAGTCTTTGGCCTCAGAGCCTCTCAAAGTGTCCACTTCAAGGGGGGATCATCCTCATTAGCACACAGATTTTTAAA 5041 AATCAATTCTCTTGCCATGCCTCCTATGTGTTCACATCTCTGCATACACTACAGATATAAGTGCATAATCATTCATATAA 5121 ACATCTGGTAGGTATTCTGTAAAACTGTGTTTACTTTAGTGCATGTTATTGTCATGTTATGATGTGACTGGGGTGTTTCT 5201 TTGTCATGAAACTTTGCTTCTTCACAGAATTAGAATACTGCTCTCTCTATATTGAACTACATATACAGCGTTTTCTTGTA 5281 TCAGCCCCCAAAGTCTGGATGCCCGGTGTTGTGTTTACATGTGATTGTGCCTAGGAGTCTGTTCACATAGAGACACCTGT 5361 AAGTATTTATTACAAAACGGAATGTAAGCAAATATATCCACATTGGTTTTATTTGAATCAAGGTGTTTTTTTGTTTTTTG 5441 TTTTTTTTCCTTTTGAGGAGGAACAGGGAGCCTCCTCCTCCATGAGCACTTACAGAATTGTGTAAAATTCTGTGAAACAG 5521 TGGTAAGCATGGGCACCCGATTTCAGCTGTCCTGCTGCCGCTGCCCTCCAACCTGCTCTGTGTGTGTGTGTCGCTGTGCT 5601 TGGTGGCAGTGTGCCGTGCTCGTGCCGGCTCTTCCCAGCAGACTGGTATCTGGCTGTAACGTTTGACGTCTTCATATTGC 5681 CAGTCTGTATTGAGGGGTGATGTACATGGCCATACAGCCAAATGGGTCTGTGTACCAGTGTGGGGATTCCAAGAACACTG 5761 CCTGTCCCCCACAGCAAATATTGATGCTGTTGGTCAGCCAAAGATTTTCCTCTCCTTTGCTGCTTAAACTTGTGCCTTAA 5841 TATTGTACATAATAAATGGATAAAATGGCAAAATGACTCTTTTCTCTCGCTTGCTCCTTTCTTCCTTAAAGAACTTATAA 5921 ACTGATGCTCAATAAATGTTTCATTTCATTGTACCCCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 154810.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 154810.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 154810.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000317837.9 | 3UTR | CCUCUCCUUUGCUGCUUAAACUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUGUGCCUUAAUAUUGUACAUAAUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUGUGCCUUAAUAUUGUACAUAAUAAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000317837.9 | 3UTR | AUUUUCCUCUCCUUUGCUGCUUAAACUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
437 hsa-miR-497-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT006078 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase |  |
|
|
3 | 1 | |||||
| MIRT006079 | RUNX2 | runt related transcription factor 2 | |
|
|
3 | 1 | |||||
| MIRT006785 | IGF1R | insulin like growth factor 1 receptor | |
|
|
3 | 3 | |||||
| MIRT007165 | MAP2K1 | mitogen-activated protein kinase kinase 1 | |
|
|
3 | 1 | |||||
| MIRT041183 | EEF1A1 | eukaryotic translation elongation factor 1 alpha 1 | |
1 | 1 | |||||||
| MIRT041184 | TCEA1 | transcription elongation factor A1 | |
1 | 1 | |||||||
| MIRT041185 | HIST1H3H | histone cluster 1 H3 family member h | |
1 | 1 | |||||||
| MIRT041186 | ALDH9A1 | aldehyde dehydrogenase 9 family member A1 | |
1 | 1 | |||||||
| MIRT041187 | DESI2 | desumoylating isopeptidase 2 | |
1 | 1 | |||||||
| MIRT041188 | HIST2H3A | histone cluster 2 H3 family member a | |
1 | 1 | |||||||
| MIRT041189 | PANK2 | pantothenate kinase 2 | |
1 | 1 | |||||||
| MIRT041190 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 5 | ||||||
| MIRT041191 | BRD1 | bromodomain containing 1 | |
1 | 1 | |||||||
| MIRT053046 | WEE1 | WEE1 G2 checkpoint kinase | |
|
|
|
|
5 | 5 | |||
| MIRT053193 | DICER1 | dicer 1, ribonuclease III | |
|
2 | 1 | ||||||
| MIRT053195 | HDGF | heparin binding growth factor | |
|
|
|
|
5 | 5 | |||
| MIRT053471 | BCL2 | BCL2, apoptosis regulator | |
|
|
|
4 | 1 | ||||
| MIRT053773 | EIF4E | eukaryotic translation initiation factor 4E | |
|
|
3 | 1 | |||||
| MIRT054419 | BIRC5 | baculoviral IAP repeat containing 5 | |
|
2 | 1 | ||||||
| MIRT054420 | WNT7A | Wnt family member 7A | |
|
2 | 1 | ||||||
| MIRT054756 | SMURF1 | SMAD specific E3 ubiquitin protein ligase 1 | |
|
2 | 1 | ||||||
| MIRT054859 | CHEK1 | checkpoint kinase 1 | |
|
|
|
|
5 | 3 | |||
| MIRT055428 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 10 | ||||||
| MIRT055819 | PLEKHA1 | pleckstrin homology domain containing A1 | |
|
2 | 2 | ||||||
| MIRT057519 | CEP55 | centrosomal protein 55 | |
|
2 | 8 | ||||||
| MIRT057739 | ZDHHC16 | zinc finger DHHC-type containing 16 | |
|
2 | 2 | ||||||
| MIRT060581 | CCND1 | cyclin D1 | |
|
2 | 2 | ||||||
| MIRT061010 | C1ORF21 | chromosome 1 open reading frame 21 | |
|
2 | 6 | ||||||
| MIRT061251 | AMOTL1 | angiomotin like 1 | |
|
2 | 12 | ||||||
| MIRT064690 | CCND2 | cyclin D2 | |
|
2 | 4 | ||||||
| MIRT065721 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | |
|
2 | 4 | ||||||
| MIRT066299 | MTFR1L | mitochondrial fission regulator 1 like | |
|
2 | 2 | ||||||
| MIRT066317 | USP15 | ubiquitin specific peptidase 15 | |
|
2 | 2 | ||||||
| MIRT071213 | FCF1 | FCF1, rRNA-processing protein | |
|
2 | 2 | ||||||
| MIRT072827 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
|
2 | 4 | ||||||
| MIRT074535 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
|
2 | 4 | ||||||
| MIRT075257 | SNTB2 | syntrophin beta 2 | |
|
2 | 4 | ||||||
| MIRT075279 | VPS4A | vacuolar protein sorting 4 homolog A | |
|
2 | 8 | ||||||
| MIRT075899 | C16ORF72 | chromosome 16 open reading frame 72 | |
|
2 | 6 | ||||||
| MIRT076797 | GOSR1 | golgi SNAP receptor complex member 1 | |
|
2 | 2 | ||||||
| MIRT078288 | RPS6KB1 | ribosomal protein S6 kinase B1 | |
|
2 | 2 | ||||||
| MIRT079660 | NAPG | NSF attachment protein gamma | |
|
2 | 12 | ||||||
| MIRT080017 | GALNT1 | polypeptide N-acetylgalactosaminyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT081649 | CCNE1 | cyclin E1 | |
|
|
|
4 | 6 | ||||
| MIRT082990 | PNPLA6 | patatin like phospholipase domain containing 6 | |
|
2 | 2 | ||||||
| MIRT083271 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
|
2 | 6 | ||||||
| MIRT084467 | SOWAHC | sosondowah ankyrin repeat domain family member C | |
|
2 | 4 | ||||||
| MIRT086014 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | |
|
2 | 2 | ||||||
| MIRT087429 | ZNRF3 | zinc and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT087560 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | |
|
2 | 2 | ||||||
| MIRT089113 | B3GNT2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | |
|
2 | 4 | ||||||
| MIRT089213 | ACTR2 | ARP2 actin related protein 2 homolog | |
|
2 | 2 | ||||||
| MIRT091676 | RARB | retinoic acid receptor beta | |
|
2 | 6 | ||||||
| MIRT093689 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
|
2 | 6 | ||||||
| MIRT096240 | CANX | calnexin | |
|
2 | 2 | ||||||
| MIRT099637 | E2F3 | E2F transcription factor 3 | |
|
2 | 1 | ||||||
| MIRT100212 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
|
2 | 2 | ||||||
| MIRT100370 | HSPA1B | heat shock protein family A (Hsp70) member 1B | |
|
2 | 6 | ||||||
| MIRT100573 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | |
|
2 | 2 | ||||||
| MIRT100742 | VEGFA | vascular endothelial growth factor A | |
|
2 | 12 | ||||||
| MIRT100901 | CD2AP | CD2 associated protein | |
|
2 | 2 | ||||||
| MIRT102442 | CALU | calumenin | |
|
2 | 2 | ||||||
| MIRT102637 | UBN2 | ubinuclein 2 | |
|
2 | 10 | ||||||
| MIRT102976 | EN2 | engrailed homeobox 2 | |
|
2 | 6 | ||||||
| MIRT103098 | MAFK | MAF bZIP transcription factor K | |
|
2 | 4 | ||||||
| MIRT103860 | FOXK1 | forkhead box K1 | |
|
2 | 2 | ||||||
| MIRT104021 | USP42 | ubiquitin specific peptidase 42 | |
|
2 | 6 | ||||||
| MIRT104237 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT106303 | ZFHX4 | zinc finger homeobox 4 | |
|
2 | 6 | ||||||
| MIRT106738 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | |
|
2 | 2 | ||||||
| MIRT107223 | ZBTB34 | zinc finger and BTB domain containing 34 | |
|
2 | 2 | ||||||
| MIRT107690 | RECK | reversion inducing cysteine rich protein with kazal motifs | |
|
2 | 2 | ||||||
| MIRT109246 | ZNF275 | zinc finger protein 275 | |
|
2 | 2 | ||||||
| MIRT110059 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
|
2 | 6 | ||||||
| MIRT112977 | LUZP1 | leucine zipper protein 1 | |
|
2 | 6 | ||||||
| MIRT114931 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 2 | ||||||
| MIRT117661 | SCAMP4 | secretory carrier membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT120685 | PAK2 | p21 (RAC1) activated kinase 2 | |
|
2 | 2 | ||||||
| MIRT127741 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT133779 | SKI | SKI proto-oncogene | |
|
2 | 2 | ||||||
| MIRT140154 | SPRED1 | sprouty related EVH1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT140830 | SMAD3 | SMAD family member 3 | |
1 | 1 | |||||||
| MIRT142250 | DCTN5 | dynactin subunit 5 | |
|
2 | 8 | ||||||
| MIRT152289 | TNFSF9 | TNF superfamily member 9 | |
|
2 | 2 | ||||||
| MIRT154056 | RASSF2 | Ras association domain family member 2 | |
|
2 | 2 | ||||||
| MIRT156471 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | |
|
2 | 2 | ||||||
| MIRT158534 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 4 | ||||||
| MIRT165184 | GRAMD3 | GRAM domain containing 2B | |
|
2 | 2 | ||||||
| MIRT165908 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT175238 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 6 | ||||||
| MIRT179015 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT180915 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 8 | ||||||
| MIRT186376 | PNRC2 | proline rich nuclear receptor coactivator 2 | |
|
2 | 2 | ||||||
| MIRT189765 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT189966 | AGO4 | argonaute 4, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT190189 | GPR180 | G protein-coupled receptor 180 | |
|
2 | 6 | ||||||
| MIRT191461 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | |
|
2 | 2 | ||||||
| MIRT191630 | SLC39A9 | solute carrier family 39 member 9 | |
|
2 | 6 | ||||||
| MIRT194244 | FAM103A1 | family with sequence similarity 103 member A1 | |
|
2 | 6 | ||||||
| MIRT194910 | RBBP6 | RB binding protein 6, ubiquitin ligase | |
|
2 | 8 | ||||||
| MIRT196458 | TAOK1 | TAO kinase 1 | |
|
2 | 2 | ||||||
| MIRT201461 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | |
|
2 | 8 | ||||||
| MIRT204598 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
|
2 | 8 | ||||||
| MIRT204629 | MOB4 | MOB family member 4, phocein | |
|
2 | 8 | ||||||
| MIRT204745 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 12 | ||||||
| MIRT206024 | NUP50 | nucleoporin 50 | |
|
2 | 6 | ||||||
| MIRT211203 | FGF2 | fibroblast growth factor 2 | |
|
2 | 4 | ||||||
| MIRT211318 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | |
|
|
3 | 5 | |||||
| MIRT212612 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
|
2 | 8 | ||||||
| MIRT217748 | TBPL1 | TATA-box binding protein like 1 | |
|
2 | 2 | ||||||
| MIRT223696 | FZD6 | frizzled class receptor 6 | |
|
|
|
4 | 6 | ||||
| MIRT224970 | BAG4 | BCL2 associated athanogene 4 | |
|
2 | 2 | ||||||
| MIRT229352 | ZNF449 | zinc finger protein 449 | |
|
2 | 2 | ||||||
| MIRT229865 | YIPF6 | Yip1 domain family member 6 | |
|
2 | 2 | ||||||
| MIRT234347 | MSL1 | male specific lethal 1 homolog | |
|
2 | 8 | ||||||
| MIRT247242 | ELK4 | ELK4, ETS transcription factor | |
|
2 | 4 | ||||||
| MIRT247372 | GABARAPL1 | GABA type A receptor associated protein like 1 | |
|
2 | 6 | ||||||
| MIRT249454 | ZNF691 | zinc finger protein 691 | |
|
2 | 4 | ||||||
| MIRT251498 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 4 | ||||||
| MIRT255340 | SRPRB | SRP receptor beta subunit | |
|
2 | 4 | ||||||
| MIRT256312 | CDC42SE2 | CDC42 small effector 2 | |
|
2 | 2 | ||||||
| MIRT258415 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | |
|
2 | 2 | ||||||
| MIRT265062 | TBRG1 | transforming growth factor beta regulator 1 | |
|
2 | 2 | ||||||
| MIRT267533 | C1ORF226 | chromosome 1 open reading frame 226 | |
|
2 | 2 | ||||||
| MIRT270557 | SETD1B | SET domain containing 1B | |
|
2 | 2 | ||||||
| MIRT273670 | HOXC8 | homeobox C8 | |
|
2 | 2 | ||||||
| MIRT274746 | RAB3IP | RAB3A interacting protein | |
|
2 | 2 | ||||||
| MIRT277510 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | |
|
2 | 4 | ||||||
| MIRT282539 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | |
|
2 | 2 | ||||||
| MIRT289636 | CBX2 | chromobox 2 | |
|
2 | 2 | ||||||
| MIRT294288 | ZFP28 | ZFP28 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT295816 | CHMP4B | charged multivesicular body protein 4B | |
|
2 | 2 | ||||||
| MIRT297783 | GABPA | GA binding protein transcription factor alpha subunit | |
|
2 | 4 | ||||||
| MIRT300112 | STRADB | STE20-related kinase adaptor beta | |
|
2 | 2 | ||||||
| MIRT300999 | MTMR3 | myotubularin related protein 3 | |
|
2 | 2 | ||||||
| MIRT302620 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | |
|
2 | 6 | ||||||
| MIRT302830 | SOCS5 | suppressor of cytokine signaling 5 | |
|
2 | 2 | ||||||
| MIRT307146 | CTDSPL | CTD small phosphatase like | |
|
2 | 4 | ||||||
| MIRT313680 | ITGA2 | integrin subunit alpha 2 | |
|
2 | 2 | ||||||
| MIRT314056 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | |
|
2 | 8 | ||||||
| MIRT317726 | PPIL1 | peptidylprolyl isomerase like 1 | |
|
2 | 6 | ||||||
| MIRT319336 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | |
|
2 | 2 | ||||||
| MIRT320633 | ZNRF2 | zinc and ring finger 2 | |
|
2 | 2 | ||||||
| MIRT326307 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
|
2 | 2 | ||||||
| MIRT327969 | CHIC1 | cysteine rich hydrophobic domain 1 | |
|
2 | 6 | ||||||
| MIRT367270 | CRKL | CRK like proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT437794 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | |
|
2 | 1 | ||||||
| MIRT437795 | CDK4 | cyclin dependent kinase 4 | |
|
2 | 1 | ||||||
| MIRT437796 | CCND3 | cyclin D3 | |
|
2 | 1 | ||||||
| MIRT437797 | CDC25A | cell division cycle 25A | |
|
|
|
4 | 3 | ||||
| MIRT443810 | SIDT2 | SID1 transmembrane family member 2 | |
|
2 | 2 | ||||||
| MIRT446503 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT447773 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT448442 | TLL1 | tolloid like 1 | |
|
2 | 2 | ||||||
| MIRT449185 | LUC7L3 | LUC7 like 3 pre-mRNA splicing factor | |
|
2 | 2 | ||||||
| MIRT451834 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | |
|
2 | 2 | ||||||
| MIRT453283 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT453749 | CSNK1E | casein kinase 1 epsilon | |
|
2 | 2 | ||||||
| MIRT454965 | TPM2 | tropomyosin 2 | |
|
2 | 2 | ||||||
| MIRT456862 | ZNF460 | zinc finger protein 460 | |
|
2 | 10 | ||||||
| MIRT460219 | FGFR4 | fibroblast growth factor receptor 4 | |
|
2 | 2 | ||||||
| MIRT460433 | DOCK11 | dedicator of cytokinesis 11 | |
|
2 | 2 | ||||||
| MIRT461559 | ACTR3B | ARP3 actin related protein 3 homolog B | |
|
2 | 2 | ||||||
| MIRT463165 | ZNF367 | zinc finger protein 367 | |
|
2 | 10 | ||||||
| MIRT464665 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 8 | ||||||
| MIRT464749 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | |
|
2 | 2 | ||||||
| MIRT465161 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT465565 | TOB2 | transducer of ERBB2, 2 | |
|
2 | 2 | ||||||
| MIRT465929 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 8 | ||||||
| MIRT466012 | TMEM189 | transmembrane protein 189 | |
|
2 | 8 | ||||||
| MIRT466293 | TM4SF1 | transmembrane 4 L six family member 1 | |
|
2 | 2 | ||||||
| MIRT466432 | TFAP2A | transcription factor AP-2 alpha | |
|
2 | 8 | ||||||
| MIRT466922 | STK38 | serine/threonine kinase 38 | |
|
2 | 10 | ||||||
| MIRT466997 | SSRP1 | structure specific recognition protein 1 | |
|
2 | 4 | ||||||
| MIRT468053 | SIK1 | salt inducible kinase 1 | |
|
2 | 2 | ||||||
| MIRT468146 | SH3BP4 | SH3 domain binding protein 4 | |
|
2 | 2 | ||||||
| MIRT468679 | SEC24A | SEC24 homolog A, COPII coat complex component | |
|
2 | 4 | ||||||
| MIRT469085 | RNF168 | ring finger protein 168 | |
|
2 | 2 | ||||||
| MIRT469410 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 6 | ||||||
| MIRT471034 | PISD | phosphatidylserine decarboxylase | |
|
2 | 10 | ||||||
| MIRT471491 | PDE4D | phosphodiesterase 4D | |
|
2 | 4 | ||||||
| MIRT471951 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | |
|
2 | 2 | ||||||
| MIRT472267 | NFIC | nuclear factor I C | |
|
2 | 2 | ||||||
| MIRT472662 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | |
|
2 | 4 | ||||||
| MIRT474315 | LAMC1 | laminin subunit gamma 1 | |
|
2 | 2 | ||||||
| MIRT474833 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | |
|
2 | 2 | ||||||
| MIRT475064 | IVNS1ABP | influenza virus NS1A binding protein | |
|
2 | 6 | ||||||
| MIRT475125 | IPPK | inositol-pentakisphosphate 2-kinase | |
|
2 | 2 | ||||||
| MIRT475537 | HOXA3 | homeobox A3 | |
|
2 | 8 | ||||||
| MIRT475715 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | |
|
2 | 2 | ||||||
| MIRT476255 | GNB1 | G protein subunit beta 1 | |
|
2 | 6 | ||||||
| MIRT476272 | GNAL | G protein subunit alpha L | |
|
2 | 6 | ||||||
| MIRT476695 | FURIN | furin, paired basic amino acid cleaving enzyme | |
|
2 | 2 | ||||||
| MIRT477560 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
|
2 | 8 | ||||||
| MIRT477844 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | |
|
2 | 2 | ||||||
| MIRT478907 | CPSF7 | cleavage and polyadenylation specific factor 7 | |
|
2 | 6 | ||||||
| MIRT479455 | CDK6 | cyclin dependent kinase 6 | |
|
2 | 2 | ||||||
| MIRT479987 | CARD10 | caspase recruitment domain family member 10 | |
|
2 | 2 | ||||||
| MIRT481182 | AVL9 | AVL9 cell migration associated | |
|
2 | 6 | ||||||
| MIRT482114 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 4 | ||||||
| MIRT482374 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT482554 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
|
2 | 10 | ||||||
| MIRT482577 | ABHD2 | abhydrolase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT484773 | ABCC6 | ATP binding cassette subfamily C member 6 | |
|
2 | 4 | ||||||
| MIRT485219 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | |
|
2 | 8 | ||||||
| MIRT487389 | C10orf54 | V-set immunoregulatory receptor | |
|
2 | 2 | ||||||
| MIRT492710 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | |
|
2 | 2 | ||||||
| MIRT494351 | CASKIN1 | CASK interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT495142 | ZNRF1 | zinc and ring finger 1 | |
|
2 | 2 | ||||||
| MIRT496014 | CD180 | CD180 molecule | |
|
2 | 2 | ||||||
| MIRT497771 | KIAA0895 | KIAA0895 | |
|
2 | 2 | ||||||
| MIRT498979 | ORC4 | origin recognition complex subunit 4 | |
|
2 | 8 | ||||||
| MIRT499451 | ODF2L | outer dense fiber of sperm tails 2 like | |
|
2 | 8 | ||||||
| MIRT499615 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | |
|
2 | 8 | ||||||
| MIRT500092 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
|
2 | 8 | ||||||
| MIRT500325 | ZNF622 | zinc finger protein 622 | |
|
2 | 8 | ||||||
| MIRT500419 | ZMAT3 | zinc finger matrin-type 3 | |
|
2 | 4 | ||||||
| MIRT500575 | USP53 | ubiquitin specific peptidase 53 | |
|
2 | 2 | ||||||
| MIRT500859 | SYPL1 | synaptophysin like 1 | |
|
2 | 8 | ||||||
| MIRT500937 | SRPR | SRP receptor alpha subunit | |
|
2 | 6 | ||||||
| MIRT500955 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | |
|
2 | 8 | ||||||
| MIRT501087 | SMAD7 | SMAD family member 7 | |
|
2 | 8 | ||||||
| MIRT501501 | PRICKLE2 | prickle planar cell polarity protein 2 | |
|
2 | 2 | ||||||
| MIRT502041 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | |
|
2 | 2 | ||||||
| MIRT502147 | KIF5B | kinesin family member 5B | |
|
2 | 8 | ||||||
| MIRT502497 | FAM122B | family with sequence similarity 122B | |
|
2 | 8 | ||||||
| MIRT502573 | E2F7 | E2F transcription factor 7 | |
|
2 | 10 | ||||||
| MIRT502645 | DDX3X | DEAD-box helicase 3, X-linked | |
|
2 | 8 | ||||||
| MIRT502918 | CDCA4 | cell division cycle associated 4 | |
|
2 | 8 | ||||||
| MIRT502946 | CDC37L1 | cell division cycle 37 like 1 | |
|
2 | 8 | ||||||
| MIRT503142 | ATG9A | autophagy related 9A | |
|
2 | 6 | ||||||
| MIRT504333 | ASGR2 | asialoglycoprotein receptor 2 | |
|
2 | 6 | ||||||
| MIRT504535 | ZNF620 | zinc finger protein 620 | |
|
2 | 6 | ||||||
| MIRT504851 | HAUS3 | HAUS augmin like complex subunit 3 | |
|
2 | 6 | ||||||
| MIRT505113 | YTHDC1 | YTH domain containing 1 | |
|
2 | 6 | ||||||
| MIRT505345 | TMEM245 | transmembrane protein 245 | |
|
2 | 6 | ||||||
| MIRT505395 | TMEM100 | transmembrane protein 100 | |
|
2 | 2 | ||||||
| MIRT505501 | SRSF1 | serine and arginine rich splicing factor 1 | |
|
2 | 6 | ||||||
| MIRT505550 | SNX16 | sorting nexin 16 | |
|
2 | 6 | ||||||
| MIRT505688 | SESTD1 | SEC14 and spectrin domain containing 1 | |
|
2 | 6 | ||||||
| MIRT505907 | RIMS3 | regulating synaptic membrane exocytosis 3 | |
|
2 | 6 | ||||||
| MIRT505925 | RCAN3 | RCAN family member 3 | |
|
2 | 4 | ||||||
| MIRT506107 | PPIG | peptidylprolyl isomerase G | |
|
2 | 6 | ||||||
| MIRT506136 | PLRG1 | pleiotropic regulator 1 | |
|
2 | 4 | ||||||
| MIRT506165 | PLAG1 | PLAG1 zinc finger | |
|
2 | 8 | ||||||
| MIRT506190 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | |
|
2 | 6 | ||||||
| MIRT506485 | MYO5A | myosin VA | |
|
2 | 6 | ||||||
| MIRT506857 | KIF23 | kinesin family member 23 | |
|
2 | 6 | ||||||
| MIRT506998 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | |
|
2 | 6 | ||||||
| MIRT507822 | CDK1 | cyclin dependent kinase 1 | |
|
2 | 6 | ||||||
| MIRT507849 | CCNE2 | cyclin E2 | |
|
2 | 6 | ||||||
| MIRT507878 | CBX6 | chromobox 6 | |
|
2 | 2 | ||||||
| MIRT508039 | AXIN2 | axin 2 | |
|
2 | 6 | ||||||
| MIRT508640 | CASK | calcium/calmodulin dependent serine protein kinase | |
|
2 | 5 | ||||||
| MIRT509363 | DMPK | DM1 protein kinase | |
|
2 | 11 | ||||||
| MIRT509689 | ATAD5 | ATPase family, AAA domain containing 5 | |
|
2 | 4 | ||||||
| MIRT510042 | AKR1B10 | aldo-keto reductase family 1 member B10 | |
|
2 | 4 | ||||||
| MIRT511846 | GPATCH8 | G-patch domain containing 8 | |
|
2 | 4 | ||||||
| MIRT512286 | ARHGDIA | Rho GDP dissociation inhibitor alpha | |
|
2 | 6 | ||||||
| MIRT512641 | CPEB3 | cytoplasmic polyadenylation element binding protein 3 | |
|
2 | 4 | ||||||
| MIRT513858 | JARID2 | jumonji and AT-rich interaction domain containing 2 | |
|
2 | 8 | ||||||
| MIRT514019 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | |
|
2 | 4 | ||||||
| MIRT514046 | ATG14 | autophagy related 14 | |
|
2 | 2 | ||||||
| MIRT518090 | TRIM35 | tripartite motif containing 35 | |
|
2 | 2 | ||||||
| MIRT518529 | FLCN | folliculin | |
|
2 | 6 | ||||||
| MIRT518993 | NNT | nicotinamide nucleotide transhydrogenase | |
|
2 | 4 | ||||||
| MIRT521051 | SLC2A3 | solute carrier family 2 member 3 | |
|
2 | 4 | ||||||
| MIRT521202 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 6 | ||||||
| MIRT521815 | POM121C | POM121 transmembrane nucleoporin C | |
|
2 | 2 | ||||||
| MIRT522099 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 4 | ||||||
| MIRT522774 | LAMP2 | lysosomal associated membrane protein 2 | |
|
2 | 6 | ||||||
| MIRT537818 | EFNB2 | ephrin B2 | |
|
2 | 4 | ||||||
| MIRT539898 | RPL14 | ribosomal protein L14 | |
|
2 | 4 | ||||||
| MIRT540842 | GNAT1 | G protein subunit alpha transducin 1 | |
|
2 | 4 | ||||||
| MIRT541218 | HOXA10 | homeobox A10 | |
|
2 | 2 | ||||||
| MIRT541433 | CBX4 | chromobox 4 | |
|
2 | 2 | ||||||
| MIRT542811 | PHC3 | polyhomeotic homolog 3 | |
|
2 | 2 | ||||||
| MIRT542838 | PDCD1 | programmed cell death 1 | |
|
2 | 7 | ||||||
| MIRT543058 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | |
|
2 | 2 | ||||||
| MIRT543078 | APP | amyloid beta precursor protein | |
|
2 | 2 | ||||||
| MIRT543305 | ZNF585B | zinc finger protein 585B | |
|
2 | 2 | ||||||
| MIRT543407 | ANAPC13 | anaphase promoting complex subunit 13 | |
|
2 | 2 | ||||||
| MIRT543524 | PRSS21 | protease, serine 21 | |
|
2 | 2 | ||||||
| MIRT543796 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | |
|
2 | 4 | ||||||
| MIRT543834 | GSG1 | germ cell associated 1 | |
|
2 | 2 | ||||||
| MIRT544570 | POLDIP3 | DNA polymerase delta interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT544588 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | |
|
2 | 4 | ||||||
| MIRT544911 | CLSPN | claspin | |
|
2 | 2 | ||||||
| MIRT544964 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | |
|
2 | 2 | ||||||
| MIRT545185 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
|
2 | 4 | ||||||
| MIRT545346 | CCDC83 | coiled-coil domain containing 83 | |
|
2 | 2 | ||||||
| MIRT545681 | DECR1 | 2,4-dienoyl-CoA reductase 1 | |
|
2 | 2 | ||||||
| MIRT545957 | ZBTB10 | zinc finger and BTB domain containing 10 | |
|
2 | 2 | ||||||
| MIRT545975 | YWHAQ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta | |
|
2 | 2 | ||||||
| MIRT546113 | USP48 | ubiquitin specific peptidase 48 | |
|
2 | 4 | ||||||
| MIRT546609 | SALL1 | spalt like transcription factor 1 | |
|||||||||