pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6833 |
Genomic Coordinates | chr6: 32179816 - 32179876 |
Description | Homo sapiens miR-6833 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6833-5p | ||||||||||||
Sequence | 6| GUGUGGAAGAUGGGAGGAGAAA |27 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Meta-analysis | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SRP9 | ||||||||||||||||||||
Synonyms | ALURBP | ||||||||||||||||||||
Description | signal recognition particle 9 | ||||||||||||||||||||
Transcript | NM_001130440 | ||||||||||||||||||||
Other Transcripts | NM_003133 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SRP9 | |||||||||||||||||||||
3'UTR of SRP9 (miRNA target sites are highlighted) |
>SRP9|NM_001130440|3'UTR 1 ATAGCAGAGACTACAGTGTTTGGTGTATAAAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAAC 81 TAATGCGACTTATGGTAGCCAAGGAAGCCCGCAATGTTACCATGGAAACTGAGTGAATGGTTTGAAATGAAGACTTTGTC 161 GTGTACTTAGGAAGTAAATATCTTTTGAATTAGAGAAAGTGTTGGGACAGAAAGTACTTTATGTAACTAAGTGGGCTGTT 241 CAGAAGCTTAGAGGTCATTTTTTGTAATTTTCTTTTTAATTACTTTAGAGAGCTAGGGATGCAAATGTTTTCAGTTAGAA 321 AGCCTTTATTTACTTTTGGAAATTGAACAAGAAATGCATCTGTCTTAGAAACTGGAGATTATTTGATGTTAGGTAAAACA 401 TGTAATTGTTTCTCTGGCAAATTTGTATCAGTAATTTGAAAATGAGATATTAGGAAAAACCAATTCTTCTTAAATTTAGT 481 TCATCTTTCTTTAAAAGAACATTAAATGTAACCATTTTGTCAGATCCATGTATTTTGGAGCATAAAATGTATGCTGTTGT 561 GACCAATAAATATAAAATATGGTAATTGGAATTAACTCCACACCATAGTATGCATTGTTATACATACTGTGTACCTAATT 641 ATGTATAGCAGTGTAGTCTCAATTATATCTGAAAGTAATTGTGACTAACAAGTATGCTTTGCCTTATTTCCACATTTAAA 721 CTACCTGTTAATATAAGGGATTTGTAGTATCAGCTTGTTGAGCAATGACTTTGAATCTAGTTTTCAGTGATCAGAAGCAG 801 CAGTTATTTGAGTGTATGAATGGAATGATGATCACTGTGCTATAATGTACTGAAACCACCATATTACAGAAATATTTACT 881 ACATATTTTCCATCTGTAGTTTCTCAGAAGGGCTATGGATTAGTTTGAACTGTCAAATCCTTGCATACTTCTGTGACACC 961 CCTGCCCATTTTCTGTCTTTAATTAACCAAGGTGTTAGGTGTGACTGTCACAACTGTTATGTTTTCCAGTAAACTAGAAG 1041 TACGATATTTGATAATTATATTTGTATTTCACCACCTAAATGTAATGTTGATTCCTCAAGAATGAAATGAAGGCACTACA 1121 TTGAAATATGTTTTGTATAAATTTGTCATGTTGAACAGCATTTTAGCATGGTAAGTTCCCTTAGCTATATGAATTTTGGC 1201 ATGTTTCAGAGAGATCAGTAAATAAAATATTAGATAAAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000366838.1 | 3UTR | uaaagaagauugagaaauu |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000366838.1 | 3UTR | CCUUAUUUCCACAUUUAAACUACCUGUUAAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000366838.1 | 3UTR | CUUUGCCUUAUUUCCACAUUUAAACUACCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
85 hsa-miR-6833-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT055111 | SCD | stearoyl-CoA desaturase | 2 | 2 | ||||||||
MIRT056784 | ARID5B | AT-rich interaction domain 5B | 2 | 2 | ||||||||
MIRT063833 | SRP9 | signal recognition particle 9 | 2 | 6 | ||||||||
MIRT068906 | TPRG1L | tumor protein p63 regulated 1 like | 2 | 2 | ||||||||
MIRT087861 | CBY1 | chibby family member 1, beta catenin antagonist | 2 | 4 | ||||||||
MIRT102313 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | 2 | 10 | ||||||||
MIRT189645 | AKAP11 | A-kinase anchoring protein 11 | 2 | 2 | ||||||||
MIRT191247 | STYX | serine/threonine/tyrosine interacting protein | 2 | 2 | ||||||||
MIRT195912 | SRSF11 | serine and arginine rich splicing factor 11 | 2 | 4 | ||||||||
MIRT215291 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT219058 | TAF8 | TATA-box binding protein associated factor 8 | 2 | 4 | ||||||||
MIRT240350 | UBXN2B | UBX domain protein 2B | 2 | 2 | ||||||||
MIRT244626 | PLAG1 | PLAG1 zinc finger | 2 | 2 | ||||||||
MIRT271181 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT277519 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | 2 | 4 | ||||||||
MIRT284544 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | 2 | 2 | ||||||||
MIRT286223 | TMEM97 | transmembrane protein 97 | 2 | 4 | ||||||||
MIRT314185 | OCLN | occludin | 2 | 4 | ||||||||
MIRT336247 | SKI | SKI proto-oncogene | 2 | 4 | ||||||||
MIRT357689 | PAIP2 | poly(A) binding protein interacting protein 2 | 2 | 2 | ||||||||
MIRT447422 | MED21 | mediator complex subunit 21 | 2 | 2 | ||||||||
MIRT451274 | ZNF101 | zinc finger protein 101 | 2 | 2 | ||||||||
MIRT453571 | CRCP | CGRP receptor component | 2 | 2 | ||||||||
MIRT454361 | ASAH2 | N-acylsphingosine amidohydrolase 2 | 2 | 2 | ||||||||
MIRT460906 | POLQ | DNA polymerase theta | 2 | 2 | ||||||||
MIRT469362 | REST | RE1 silencing transcription factor | 2 | 6 | ||||||||
MIRT470269 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | 2 | 2 | ||||||||
MIRT471927 | NRAS | NRAS proto-oncogene, GTPase | 2 | 2 | ||||||||
MIRT474227 | LCLAT1 | lysocardiolipin acyltransferase 1 | 2 | 2 | ||||||||
MIRT480241 | C8orf58 | chromosome 8 open reading frame 58 | 2 | 2 | ||||||||
MIRT480543 | BZW1 | basic leucine zipper and W2 domains 1 | 2 | 2 | ||||||||
MIRT480924 | BCAT1 | branched chain amino acid transaminase 1 | 2 | 4 | ||||||||
MIRT497343 | RPP25L | ribonuclease P/MRP subunit p25 like | 2 | 2 | ||||||||
MIRT498824 | DNTTIP2 | deoxynucleotidyltransferase terminal interacting protein 2 | 2 | 8 | ||||||||
MIRT498928 | TMEM106B | transmembrane protein 106B | 2 | 8 | ||||||||
MIRT499584 | INTU | inturned planar cell polarity protein | 2 | 4 | ||||||||
MIRT500118 | ZNF106 | zinc finger protein 106 | 2 | 4 | ||||||||
MIRT500474 | ZC3H11A | zinc finger CCCH-type containing 11A | 2 | 2 | ||||||||
MIRT501717 | OVOL1 | ovo like transcriptional repressor 1 | 2 | 2 | ||||||||
MIRT501908 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | 2 | 4 | ||||||||
MIRT502197 | HSPB8 | heat shock protein family B (small) member 8 | 2 | 2 | ||||||||
MIRT505229 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | 2 | 2 | ||||||||
MIRT505945 | RAN | RAN, member RAS oncogene family | 2 | 6 | ||||||||
MIRT507971 | BCL2L13 | BCL2 like 13 | 2 | 4 | ||||||||
MIRT512251 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 6 | ||||||||
MIRT513024 | GPT2 | glutamic--pyruvic transaminase 2 | 2 | 2 | ||||||||
MIRT530791 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | 2 | 2 | ||||||||
MIRT533403 | TXLNG | taxilin gamma | 2 | 2 | ||||||||
MIRT546728 | RNF217 | ring finger protein 217 | 2 | 2 | ||||||||
MIRT554087 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | 2 | 2 | ||||||||
MIRT559924 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT560258 | TMEM236 | transmembrane protein 236 | 2 | 2 | ||||||||
MIRT560412 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | 2 | 2 | ||||||||
MIRT560420 | ANGPTL3 | angiopoietin like 3 | 2 | 2 | ||||||||
MIRT560495 | KCNJ10 | potassium voltage-gated channel subfamily J member 10 | 2 | 2 | ||||||||
MIRT560549 | SIGLEC14 | sialic acid binding Ig like lectin 14 | 2 | 2 | ||||||||
MIRT560802 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | 2 | 2 | ||||||||
MIRT560883 | SULT1B1 | sulfotransferase family 1B member 1 | 2 | 2 | ||||||||
MIRT560997 | C8orf37 | chromosome 8 open reading frame 37 | 2 | 2 | ||||||||
MIRT561090 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | 2 | 2 | ||||||||
MIRT561193 | LDHD | lactate dehydrogenase D | 2 | 2 | ||||||||
MIRT561835 | NREP | neuronal regeneration related protein | 2 | 2 | ||||||||
MIRT562393 | EIF4E | eukaryotic translation initiation factor 4E | 2 | 2 | ||||||||
MIRT568153 | CCDC6 | coiled-coil domain containing 6 | 2 | 2 | ||||||||
MIRT572725 | NUP188 | nucleoporin 188 | 2 | 2 | ||||||||
MIRT572886 | ADCY2 | adenylate cyclase 2 | 2 | 2 | ||||||||
MIRT575747 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | 2 | 2 | ||||||||
MIRT606770 | KIAA0040 | KIAA0040 | 2 | 5 | ||||||||
MIRT620360 | CD55 | CD55 molecule (Cromer blood group) | 2 | 2 | ||||||||
MIRT623579 | IREB2 | iron responsive element binding protein 2 | 2 | 2 | ||||||||
MIRT640726 | PHF13 | PHD finger protein 13 | 2 | 2 | ||||||||
MIRT651579 | WDR26 | WD repeat domain 26 | 2 | 2 | ||||||||
MIRT674927 | C1orf116 | chromosome 1 open reading frame 116 | 2 | 2 | ||||||||
MIRT687378 | NT5DC3 | 5'-nucleotidase domain containing 3 | 2 | 2 | ||||||||
MIRT687699 | KRR1 | KRR1, small subunit processome component homolog | 2 | 2 | ||||||||
MIRT693331 | E2F2 | E2F transcription factor 2 | 2 | 2 | ||||||||
MIRT695289 | TK1 | thymidine kinase 1 | 2 | 2 | ||||||||
MIRT697691 | WAC | WW domain containing adaptor with coiled-coil | 2 | 2 | ||||||||
MIRT699810 | SDHD | succinate dehydrogenase complex subunit D | 2 | 2 | ||||||||
MIRT702280 | LEPROT | leptin receptor overlapping transcript | 2 | 2 | ||||||||
MIRT708498 | FAM9C | family with sequence similarity 9 member C | 2 | 2 | ||||||||
MIRT710101 | HEY2 | hes related family bHLH transcription factor with YRPW motif 2 | 2 | 2 | ||||||||
MIRT717883 | GBP4 | guanylate binding protein 4 | 2 | 2 | ||||||||
MIRT719248 | MS4A1 | membrane spanning 4-domains A1 | 2 | 2 | ||||||||
MIRT719958 | SAMD15 | sterile alpha motif domain containing 15 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|