miRTarBase - #MIRT064260


—
pre-miRNA Information
pre-miRNA hsa-mir-216b   
Genomic Coordinates chr2: 56000714 - 56000795
Description Homo sapiens miR-216b stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-216b-5p
Sequence 11| AAAUCUCUGCAGGCAAAUGUGA |32
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746268253 9 dbSNP
rs777165632 10 dbSNP
rs528642031 11 dbSNP
rs1168114631 14 dbSNP
rs559876972 16 dbSNP
rs1415888803 17 dbSNP
rs756876970 18 dbSNP
rs930279879 18 dbSNP
rs777776673 19 dbSNP
rs1182789155 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B5PHM2 miR-216b Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma MiRNA qPCR analyses
Gene Information
Gene Symbol KIAA1804
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 84451.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000366624.3 | 3UTR | AUUUAAGGCCUGGGCCUAAUGUGCUGUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD 0.993 0.04 0.500 0.33 3 Click to see details
LIHC -0.192 0.11 -0.266 0.04 44 Click to see details
HNSC -0.462 0.15 -0.321 0.24 7 Click to see details
KIRP -0.666 0.17 -0.800 0.1 4 Click to see details
THCA 0.23 0.18 0.257 0.15 18 Click to see details
PRAD -0.325 0.18 -0.261 0.23 10 Click to see details
PAAD 0.828 0.19 1.000 0.5 3 Click to see details
KICH -0.373 0.27 -0.100 0.44 5 Click to see details
STAD 0.317 0.27 0.486 0.16 6 Click to see details
KIRC -0.268 0.3 -0.200 0.35 6 Click to see details
CHOL 0.176 0.37 0.657 0.08 6 Click to see details
LUSC -0.102 0.42 -0.314 0.27 6 Click to see details
UCEC 0.09 0.47 0.500 0.33 3 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
BLCA -0.052 0.47 0.400 0.3 4 Click to see details
129 hsa-miR-216b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006144 KRAS KRAS proto-oncogene, GTPase 3 1
MIRT007207 CSNK2A1 casein kinase 2 alpha 1 3 1
MIRT064260 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT169957 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 6
MIRT362970 CDK6 cyclin dependent kinase 6 2 2
MIRT437983 BECN1 beclin 1 3 2
MIRT443073 ABLIM1 actin binding LIM protein 1 2 2
MIRT443747 ZFAND5 zinc finger AN1-type containing 5 2 6
MIRT445488 KLF12 Kruppel like factor 12 2 2
MIRT447818 ZCCHC11 zinc finger CCHC-type containing 11 2 2
MIRT448753 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT460391 GUF1 GUF1 homolog, GTPase 2 2
MIRT466481 TECPR2 tectonin beta-propeller repeat containing 2 2 7
MIRT472205 NGFRAP1 brain expressed X-linked 3 2 4
MIRT473269 MID1 midline 1 2 2
MIRT489831 P2RY2 purinergic receptor P2Y2 2 2
MIRT497753 OXGR1 oxoglutarate receptor 1 2 2
MIRT502881 CDK4 cyclin dependent kinase 4 2 8
MIRT505904 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT506657 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510190 MON1B MON1 homolog B, secretory trafficking associated 2 4
MIRT512406 CD84 CD84 molecule 2 2
MIRT520342 UBXN2A UBX domain protein 2A 2 2
MIRT523602 FZD5 frizzled class receptor 5 2 2
MIRT529598 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT534444 SDR16C5 short chain dehydrogenase/reductase family 16C member 5 2 2
MIRT534739 RBM47 RNA binding motif protein 47 2 2
MIRT537285 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT546979 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT549862 MCM4 minichromosome maintenance complex component 4 2 2
MIRT552535 ZIC5 Zic family member 5 2 2
MIRT555322 PPP2CB protein phosphatase 2 catalytic subunit beta 2 2
MIRT555661 PGM3 phosphoglucomutase 3 2 2
MIRT559128 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT567802 DEK DEK proto-oncogene 2 2
MIRT567866 DCAF12 DDB1 and CUL4 associated factor 12 2 2
MIRT574661 KLHL15 kelch like family member 15 2 2
MIRT575029 Tecpr2 tectonin beta-propeller repeat containing 2 2 5
MIRT607227 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT609385 FAM216B family with sequence similarity 216 member B 2 4
MIRT612266 PDZD4 PDZ domain containing 4 2 2
MIRT617434 ANP32E acidic nuclear phosphoprotein 32 family member E 2 4
MIRT619453 NUP214 nucleoporin 214 2 2
MIRT620242 CCDC65 coiled-coil domain containing 65 2 2
MIRT620463 CENPN centromere protein N 2 2
MIRT620909 MUT methylmalonyl-CoA mutase 2 2
MIRT621006 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT621568 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT622059 SSBP2 single stranded DNA binding protein 2 2 2
MIRT622132 SP4 Sp4 transcription factor 2 2
MIRT623365 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT624370 CDK12 cyclin dependent kinase 12 2 2
MIRT627944 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT628228 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT630150 ZDHHC9 zinc finger DHHC-type containing 9 2 2
MIRT630237 SORD sorbitol dehydrogenase 2 2
MIRT631271 CENPM centromere protein M 2 2
MIRT637456 ZNF324B zinc finger protein 324B 2 2
MIRT637899 SLC19A3 solute carrier family 19 member 3 2 2
MIRT641610 CAPN7 calpain 7 2 2
MIRT643088 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643813 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT643911 TCEB2 elongin B 2 2
MIRT644900 ZBED1 zinc finger BED-type containing 1 2 2
MIRT645012 NGRN neugrin, neurite outgrowth associated 2 2
MIRT645521 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT646032 S100A7A S100 calcium binding protein A7A 2 2
MIRT646626 CENPL centromere protein L 2 2
MIRT646721 RHOG ras homolog family member G 2 2
MIRT647196 ZNF583 zinc finger protein 583 2 2
MIRT648010 ZNF431 zinc finger protein 431 2 2
MIRT648362 AKIP1 A-kinase interacting protein 1 2 2
MIRT648400 WRN Werner syndrome RecQ like helicase 2 2
MIRT648833 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT651870 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT652490 TMEM178B transmembrane protein 178B 2 2
MIRT652529 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT652536 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT652795 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT653379 SMAD1 SMAD family member 1 2 2
MIRT655568 P2RX7 purinergic receptor P2X 7 2 2
MIRT657235 IER5 immediate early response 5 2 2
MIRT657594 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT658037 FZD9 frizzled class receptor 9 2 2
MIRT658151 FGF10 fibroblast growth factor 10 2 2
MIRT658459 FAM117B family with sequence similarity 117 member B 2 2
MIRT658503 EXOC5 exocyst complex component 5 2 2
MIRT659420 COL4A4 collagen type IV alpha 4 chain 2 2
MIRT660023 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT660032 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT661206 MPPE1 metallophosphoesterase 1 2 2
MIRT661639 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT665303 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT668010 HCFC2 host cell factor C2 2 2
MIRT673436 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT673583 KDELC2 KDEL motif containing 2 2 2
MIRT673717 SLU7 SLU7 homolog, splicing factor 2 2
MIRT674315 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT675811 MED28 mediator complex subunit 28 2 2
MIRT686564 TPM3 tropomyosin 3 2 2
MIRT687134 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687463 NKD1 naked cuticle homolog 1 2 2
MIRT690226 C5orf45 MRN complex interacting protein 2 2
MIRT690532 ZNF566 zinc finger protein 566 2 2
MIRT693077 AS3MT arsenite methyltransferase 2 2
MIRT694083 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT695388 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT695638 SLC26A2 solute carrier family 26 member 2 2 2
MIRT696540 C3 complement C3 2 2
MIRT705522 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 2
MIRT711304 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711513 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711617 LHX5 LIM homeobox 5 2 2
MIRT711647 LIPG lipase G, endothelial type 2 2
MIRT711771 CCDC59 coiled-coil domain containing 59 2 2
MIRT713207 SOCS6 suppressor of cytokine signaling 6 2 2
MIRT715047 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT715620 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT717677 CDC42BPA CDC42 binding protein kinase alpha 2 2
MIRT718016 METTL15 methyltransferase like 15 2 2
MIRT721251 KIAA0922 transmembrane 131 like 2 2
MIRT721438 ARPC4 actin related protein 2/3 complex subunit 4 2 2
MIRT722193 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT723319 PRKCH protein kinase C eta 2 2
MIRT725299 NLRC5 NLR family CARD domain containing 5 2 2
MIRT731866 HDAC8 histone deacetylase 8 3 1
MIRT731987 PARP1 poly(ADP-ribose) polymerase 1 3 1
MIRT735558 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 3 0
MIRT735826 SMAD3 SMAD family member 3 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-216b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-216b 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-216b Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Quantitative real-time PCR human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-216b Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-216b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-216b Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-216b-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216b-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-216b-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, HCT8)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved sensitive Low Melanoma cell line (A375, G-361)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-216b-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-216b-5p Carboplatin 38904 NSC241240 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, NCI-H460)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, NCI-H460)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (MG-63, SaOS-2)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (A2780)
hsa-miR-216b-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-216b-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-216b-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-216b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-216b-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-216b-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission