miRTarBase - #MIRT065418


—
pre-miRNA Information
pre-miRNA hsa-mir-144   
Genomic Coordinates chr17: 28861533 - 28861618
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs947719319 4 dbSNP
rs917554219 5 dbSNP
rs1218721253 6 dbSNP
rs760366230 9 dbSNP
rs1293385306 15 dbSNP
rs1463482751 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMBIM6   
Synonyms BAXI1, BI-1, TEGT
Description transmembrane BAX inhibitor motif containing 6
Transcript NM_001098576   
Other Transcripts NM_003217   
Expression
Putative miRNA Targets on TMBIM6
3'UTR of TMBIM6
(miRNA target sites are highlighted)		 
>TMBIM6|NM_001098576|3'UTR
   1 AGTGACCATCCAGCCTTTCCCAATTAGACTTCCTCTCCTTCCACCCCTCATTTCCTTTTTGCACACATTACAGGTGGTGT
  81 GTTCTGTGATAATGAAAAGCATCAGAAAAGCTTTTGTACTTTGTGGTTTCCTCTATTTTGAATTTTTTGATCAAAAAACT
 161 GATTAGCAGAATATAGTTTGGAGTTTGGCTTCATCTTCCTGGGGTTCCCCTCACTCCCTTTTTTGTCAACCCCATCTGTA
 241 GCCTCTTCCTCTACTCAGGCAGTCGACCCGCCACGATGAGAAGTGGGACCAGCAGAGGGCGCCAACTTCAGGAGTCCGCT
 321 TTCCCACCAGGCTTCATTCACCCAGTGGACCTGAACTGTTTGGTAGAGCCACCCGGCCCTTCCTTCCTCATTGTTGTTTG
 401 GTATGCGCACAGTTCCTGTGGGACTGGGCCGTGAGTTTTCCATTGGAAAGAAGTTCAGTGGTCCCATTGTTAACTCAGCC
 481 TCAAATCTCAACTGTCAGGCCCTACAAAGAAAATGGAGAGCCTCTTCTGGTGGATGCTTTGCTCCCTCTGAGCTGCCCAT
 561 GCTGGTCTGGCAAACACACCTTTCTGCTTTGCCTTCACAAAAGTAATGTGTTCCCTTTCCCACCCCTTGCCTGACCCTCA
 641 GGGAGTCAGCCTGCTTCCATCCATGGGTGGGAAGACTTCAGCACAAAGGAAAGACTAATTCTTGTCAGGCATTTTTGAAA
 721 AGGCTGATTATGTGTATCAAGGTACAGCATCGTAGGGTTCCCCTAAACTTGCCCTGTTTTTGTTTTTTTAGTTTGTTATC
 801 CCCTTACTGAGCGGCCTCTACTAGGTGGCTGTGATTAAATGTCCCAAGCAAGGATAGGGAAGGGGAATGGTTGAGCCTCT
 881 GGAGATCATTGTAACCAATCCTGCCAGACCTGTTTGGGGCAGTGGGGAGCAAACCTAGATAAGGACCTGTTTGGGGCAGC
 961 AGGGAGCAAAATCTCCTTTAACAACCAAGCAGTTCCTCATTCACATCAACAGAGCGAGGCTGTGATAACTTAGGAGGCAG
1041 CAATCCTAATAGTCCTTCAGTGCATTTTAGTCTGTCTCCAACTGGACACCAGTAGGTAGTGTCAAGCCAGAGATTCGGGG
1121 CAGTAGATAAATGTTCATTTTACTGATGCACTTTAGTTTTTGGTCTGTTACCTGTTTTCCAGAAATTTGTGGCCTTTTAG
1201 GCGGGAGTTAGGCGACCAAACCAGTGAGAGCCCCAATCCCTGCAGTTTTGTGGCTTCAAGTGTGGGTGGACAGTCCTAAT
1281 GGGGATCTCCAGCTCCTTCCTGTGGGCTGCCACAGACAGCTACCCCCAGAAGGGTCAATGTTGGGAGTGGTTGTGGCTCT
1361 GAGCTGCTCTACAGAGCTTCAGTGTGAGAGGATCGAGCCATTGAAAGCTCATTACCAGTAGGACATAATTTTTGGCTCTC
1441 CCTATTCACAACCAGTGCACAGTTTGACACAGTGGCCTCAGGTTCACAGTGCACCATGTCACTGTGCTATCCTACGAAAT
1521 CATTTGTTTCTAAGTTGTGTTTATTCCTGGAGTGACATGCCACCCCGAATGGCTCACTTTCACTGAGGATGCTGTCCTCT
1601 GATTTAGCTGCTGCCTCCAGCCTCTGGCTTGAGAACTTACTAAAGGCACTTCCTTCCTGTTAAACCCCTGTTAACTCTCC
1681 ATAAATTTGGTGATTCTCTGCTAGGCCTAAGATTTTGAGTTAACATCTCTTGAAGCCAAACTCCACCTTCTGTGCTTTTT
1761 GCTTGGGATAATGGAGTTTTTCTTTAGAAACAGTGCCAAGAATGACAAGATATTAAAAAAAAAAAAGAAAGAAAAAAAAA
1841 AAAACACCTACTTTTAAAGAAAATACCTAACAGATTTTTAATATAGTTATCTCTACCACTTTCTTTTCTAGTTTCTTGAT
1921 TTTCAGCTCAGGCTGCATTCTAACTCATACTGTGAAGACAAAGGTGTTTTTGATTCAGAAATATATGAAATCTGCATAGT
2001 CTTAATTTGTAAAAAATAAAGAAAATTCCTTAACCTTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucAUGUA--GUAGA-UAUGACAu 5'
            |:|||  :| || ||||||| 
Target 5' gcTGCATTCTAACTCATACTGTg 3'
 1932 - 1954 156.00 -9.80
2 
miRNA  3' ucaUGUAGUAGA----UAUGACAu 5'
             || |:  ||    ||:|||| 
Target 5' ctcACTTTCACTGAGGATGCTGTc 3'
 1573 - 1596 127.00 -6.20
3 
miRNA  3' ucAUGU--AGUAGAUAUGACAu 5'
            ||||  | :| |:| |||| 
Target 5' atTACAGGTGGTGTGTTCTGTg 3'
 67 - 88 112.00 -8.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26574151 7 COSMIC
COSN30476933 38 COSMIC
COSN30484838 56 COSMIC
COSN30503568 181 COSMIC
COSN30196542 480 COSMIC
COSN19079035 814 COSMIC
COSN1575560 855 COSMIC
COSN1575561 868 COSMIC
COSN20109549 1301 COSMIC
COSN20109550 1761 COSMIC
COSN24544451 1824 COSMIC
COSN7373020 1828 COSMIC
COSN18880343 1832 COSMIC
COSN31550068 1834 COSMIC
COSN20343009 1866 COSMIC
COSN29516671 1985 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757804497 3 dbSNP
rs1265100477 5 dbSNP
rs1439380306 6 dbSNP
rs1220465306 7 dbSNP
rs1182192253 8 dbSNP
rs1232066179 12 dbSNP
rs781633038 14 dbSNP
rs745385517 15 dbSNP
rs1418020351 19 dbSNP
rs370807894 20 dbSNP
rs1460413872 21 dbSNP
rs113280849 24 dbSNP
rs541981821 27 dbSNP
rs774851770 33 dbSNP
rs368576424 35 dbSNP
rs768385751 36 dbSNP
rs1408298737 38 dbSNP
rs1333129556 43 dbSNP
rs1301679783 44 dbSNP
rs754060331 44 dbSNP
rs774227524 44 dbSNP
rs1295292007 46 dbSNP
rs761478739 50 dbSNP
rs371163791 51 dbSNP
rs562249578 55 dbSNP
rs1308088650 64 dbSNP
rs1411194634 72 dbSNP
rs528037654 78 dbSNP
rs28932169 80 dbSNP
rs1015841671 87 dbSNP
rs1379089233 95 dbSNP
rs1430741676 100 dbSNP
rs899959941 105 dbSNP
rs1194510519 111 dbSNP
rs1368455801 112 dbSNP
rs1490245190 116 dbSNP
rs961393398 143 dbSNP
rs995611990 144 dbSNP
rs1165908553 150 dbSNP
rs1436100406 154 dbSNP
rs1048948344 155 dbSNP
rs1220250512 163 dbSNP
rs570462555 165 dbSNP
rs919898773 175 dbSNP
rs773354341 184 dbSNP
rs1287724714 200 dbSNP
rs1004203101 205 dbSNP
rs1383484146 207 dbSNP
rs1308219741 209 dbSNP
rs1024950882 210 dbSNP
rs112133089 210 dbSNP
rs376714994 210 dbSNP
rs17123947 213 dbSNP
rs1381991826 214 dbSNP
rs11540522 218 dbSNP
rs1243443647 219 dbSNP
rs74087196 230 dbSNP
rs1034196902 234 dbSNP
rs958778442 235 dbSNP
rs989953456 236 dbSNP
rs1173945323 239 dbSNP
rs1056331231 243 dbSNP
rs1021773925 244 dbSNP
rs1259252558 246 dbSNP
rs375526408 249 dbSNP
rs535649050 250 dbSNP
rs1205846848 257 dbSNP
rs1232367807 257 dbSNP
rs977067892 261 dbSNP
rs912205773 262 dbSNP
rs1033229596 265 dbSNP
rs957890352 267 dbSNP
rs149823084 270 dbSNP
rs145793344 271 dbSNP
rs891323225 272 dbSNP
rs1278436532 275 dbSNP
rs561092199 277 dbSNP
rs1444800151 278 dbSNP
rs193229068 294 dbSNP
rs931456458 302 dbSNP
rs1048503683 304 dbSNP
rs1389017356 306 dbSNP
rs1161102772 307 dbSNP
rs1454861472 307 dbSNP
rs887204438 316 dbSNP
rs1288969494 318 dbSNP
rs940063719 319 dbSNP
rs1182490734 325 dbSNP
rs1015748219 330 dbSNP
rs961636779 334 dbSNP
rs1046437652 337 dbSNP
rs11540521 340 dbSNP
rs906501775 342 dbSNP
rs1465750939 343 dbSNP
rs756337260 344 dbSNP
rs1262863717 345 dbSNP
rs577186951 355 dbSNP
rs1214170124 362 dbSNP
rs148039038 362 dbSNP
rs995726517 368 dbSNP
rs11540524 375 dbSNP
rs377472837 376 dbSNP
rs1312298505 379 dbSNP
rs1011810084 380 dbSNP
rs986312442 384 dbSNP
rs1365926969 386 dbSNP
rs1021426613 388 dbSNP
rs1305106380 390 dbSNP
rs1344411321 391 dbSNP
rs758287644 391 dbSNP
rs7688 393 dbSNP
rs1426790331 397 dbSNP
rs1383398113 401 dbSNP
rs1019247964 402 dbSNP
rs746928453 408 dbSNP
rs975728622 409 dbSNP
rs376195970 410 dbSNP
rs562348470 412 dbSNP
rs1247665270 417 dbSNP
rs1222700726 422 dbSNP
rs931553895 427 dbSNP
rs527866919 431 dbSNP
rs757217150 432 dbSNP
rs780627389 435 dbSNP
rs940097923 438 dbSNP
rs1342759152 443 dbSNP
rs1457591087 444 dbSNP
rs745362216 452 dbSNP
rs541739077 463 dbSNP
rs776254207 463 dbSNP
rs1360930281 464 dbSNP
rs937989378 467 dbSNP
rs3782324 469 dbSNP
rs1364017687 472 dbSNP
rs1159119303 482 dbSNP
rs1302591889 482 dbSNP
rs1427992639 487 dbSNP
rs532966401 491 dbSNP
rs1467834844 492 dbSNP
rs1043621009 493 dbSNP
rs925005972 505 dbSNP
rs1011466236 508 dbSNP
rs11540523 516 dbSNP
rs932297026 524 dbSNP
rs1043283897 526 dbSNP
rs902989966 530 dbSNP
rs998594865 535 dbSNP
rs549751405 538 dbSNP
rs1202133751 539 dbSNP
rs1019319291 544 dbSNP
rs769478257 545 dbSNP
rs890890644 551 dbSNP
rs1375738568 554 dbSNP
rs965044222 558 dbSNP
rs1392195910 559 dbSNP
rs1282654057 562 dbSNP
rs775154572 565 dbSNP
rs1283676895 576 dbSNP
rs1321506162 580 dbSNP
rs748891900 584 dbSNP
rs138542934 588 dbSNP
rs897290359 597 dbSNP
rs953079774 601 dbSNP
rs1307454988 607 dbSNP
rs529039057 615 dbSNP
rs1296586591 616 dbSNP
rs908746648 616 dbSNP
rs1461918905 620 dbSNP
rs774770768 624 dbSNP
rs1360292521 629 dbSNP
rs548786076 631 dbSNP
rs188209222 634 dbSNP
rs762283660 636 dbSNP
rs1479633549 640 dbSNP
rs995800562 640 dbSNP
rs961537182 641 dbSNP
rs1027644700 646 dbSNP
rs534487502 657 dbSNP
rs759373952 659 dbSNP
rs1252030989 661 dbSNP
rs1193639330 663 dbSNP
rs982218735 666 dbSNP
rs928018755 674 dbSNP
rs938078894 675 dbSNP
rs140221298 680 dbSNP
rs1182445554 685 dbSNP
rs1263727776 686 dbSNP
rs1205502396 691 dbSNP
rs1267806118 693 dbSNP
rs566829279 699 dbSNP
rs1240014609 700 dbSNP
rs1035665988 702 dbSNP
rs960120254 707 dbSNP
rs915204587 710 dbSNP
rs1390944917 711 dbSNP
rs1383650957 713 dbSNP
rs1429864562 714 dbSNP
rs1409326813 717 dbSNP
rs769821742 725 dbSNP
rs1468703231 730 dbSNP
rs947299343 743 dbSNP
rs1167987897 745 dbSNP
rs1160444978 748 dbSNP
rs1453990175 752 dbSNP
rs1042946980 753 dbSNP
rs1356071962 758 dbSNP
rs768043631 761 dbSNP
rs1462369148 779 dbSNP
rs1185288177 780 dbSNP
rs988815749 781 dbSNP
rs1242300848 783 dbSNP
rs1302769345 791 dbSNP
rs773201944 791 dbSNP
rs571169929 795 dbSNP
rs879062090 799 dbSNP
rs1238644360 804 dbSNP
rs998627335 813 dbSNP
rs966508033 814 dbSNP
rs77031795 821 dbSNP
rs1319354077 822 dbSNP
rs1384320562 824 dbSNP
rs145607842 829 dbSNP
rs932562064 838 dbSNP
rs576020279 842 dbSNP
rs1049875303 844 dbSNP
rs912196853 864 dbSNP
rs1165008201 879 dbSNP
rs1442670060 885 dbSNP
rs1242511282 886 dbSNP
rs1308432192 887 dbSNP
rs943773037 888 dbSNP
rs1290541775 890 dbSNP
rs996570358 891 dbSNP
rs1490591397 896 dbSNP
rs1294033706 900 dbSNP
rs1224012104 901 dbSNP
rs931457578 903 dbSNP
rs997175657 907 dbSNP
rs148057357 913 dbSNP
rs1001758423 916 dbSNP
rs1399011296 916 dbSNP
rs1365854984 923 dbSNP
rs1304411555 926 dbSNP
rs535589055 931 dbSNP
rs555558279 935 dbSNP
rs1036101283 936 dbSNP
rs572622942 940 dbSNP
rs1476359854 944 dbSNP
rs550787678 948 dbSNP
rs754130110 952 dbSNP
rs1162742919 953 dbSNP
rs961564671 967 dbSNP
rs966540555 973 dbSNP
rs982289011 979 dbSNP
rs1490194411 986 dbSNP
rs979693610 989 dbSNP
rs928090777 990 dbSNP
rs565162499 994 dbSNP
rs1338095053 996 dbSNP
rs541232316 998 dbSNP
rs1269950185 1003 dbSNP
rs766233742 1016 dbSNP
rs959722078 1017 dbSNP
rs1303763736 1020 dbSNP
rs569422961 1023 dbSNP
rs1402723663 1026 dbSNP
rs1348735889 1027 dbSNP
rs1329014158 1030 dbSNP
rs915262239 1034 dbSNP
rs1411586840 1035 dbSNP
rs184002835 1040 dbSNP
rs1169665152 1042 dbSNP
rs1042976685 1044 dbSNP
rs954108107 1046 dbSNP
rs1197450554 1047 dbSNP
rs1480238516 1049 dbSNP
rs1233523788 1057 dbSNP
rs1184133220 1059 dbSNP
rs985357796 1060 dbSNP
rs924545256 1065 dbSNP
rs188543212 1071 dbSNP
rs1261676986 1076 dbSNP
rs550713077 1077 dbSNP
rs1366547548 1081 dbSNP
rs1279600067 1088 dbSNP
rs1443804090 1090 dbSNP
rs1333497914 1097 dbSNP
rs544116927 1100 dbSNP
rs1040859258 1107 dbSNP
rs1245652579 1117 dbSNP
rs900972219 1118 dbSNP
rs1174089416 1119 dbSNP
rs932429490 1123 dbSNP
rs539942980 1133 dbSNP
rs1160539622 1140 dbSNP
rs181888694 1144 dbSNP
rs1237647985 1146 dbSNP
rs1184687683 1149 dbSNP
rs1290235719 1154 dbSNP
rs528870261 1160 dbSNP
rs1241678599 1162 dbSNP
rs905990244 1165 dbSNP
rs371280494 1166 dbSNP
rs1284458670 1167 dbSNP
rs1225144627 1170 dbSNP
rs373885498 1173 dbSNP
rs1307910170 1176 dbSNP
rs1453264446 1180 dbSNP
rs1384960568 1182 dbSNP
rs117948747 1188 dbSNP
rs551243245 1189 dbSNP
rs1393387303 1202 dbSNP
rs897428900 1203 dbSNP
rs757191414 1204 dbSNP
rs1035193167 1208 dbSNP
rs1383156384 1214 dbSNP
rs1446286642 1215 dbSNP
rs571109254 1217 dbSNP
rs959559331 1229 dbSNP
rs991351450 1231 dbSNP
rs111798126 1234 dbSNP
rs1487135988 1237 dbSNP
rs968480974 1241 dbSNP
rs550446144 1244 dbSNP
rs1312785758 1254 dbSNP
rs978083340 1260 dbSNP
rs1227677617 1261 dbSNP
rs569744587 1263 dbSNP
rs1362326731 1266 dbSNP
rs1290475598 1270 dbSNP
rs1346258721 1277 dbSNP
rs535453055 1286 dbSNP
rs555845944 1296 dbSNP
rs1363823174 1297 dbSNP
rs904629806 1297 dbSNP
rs1164604477 1298 dbSNP
rs3832814 1299 dbSNP
rs573092648 1303 dbSNP
rs1185210612 1317 dbSNP
rs1385429893 1318 dbSNP
rs923904521 1319 dbSNP
rs934587623 1320 dbSNP
rs572401399 1321 dbSNP
rs1263184178 1324 dbSNP
rs878987790 1327 dbSNP
rs1297417337 1328 dbSNP
rs185233746 1333 dbSNP
rs1221538268 1339 dbSNP
rs370768170 1341 dbSNP
rs1363725692 1350 dbSNP
rs1049973172 1352 dbSNP
rs1293072637 1354 dbSNP
rs7297617 1360 dbSNP
rs1329702468 1362 dbSNP
rs1202950223 1371 dbSNP
rs190500256 1374 dbSNP
rs972403947 1378 dbSNP
rs1465398507 1381 dbSNP
rs1462469213 1383 dbSNP
rs918220251 1386 dbSNP
rs544153688 1394 dbSNP
rs941062570 1395 dbSNP
rs755644398 1396 dbSNP
rs983883290 1402 dbSNP
rs563941758 1419 dbSNP
rs779472145 1426 dbSNP
rs1480904917 1439 dbSNP
rs1252949426 1441 dbSNP
rs927486600 1445 dbSNP
rs1317000512 1450 dbSNP
rs575791440 1452 dbSNP
rs1225562743 1457 dbSNP
rs368008253 1458 dbSNP
rs1057338722 1459 dbSNP
rs917518568 1460 dbSNP
rs1003831463 1471 dbSNP
rs1469416409 1481 dbSNP
rs1375662515 1483 dbSNP
rs1035274795 1487 dbSNP
rs946272861 1488 dbSNP
rs1174891454 1489 dbSNP
rs1407283977 1492 dbSNP
rs1409008614 1493 dbSNP
rs1179117097 1494 dbSNP
rs1396947100 1497 dbSNP
rs904494196 1500 dbSNP
rs1375628471 1503 dbSNP
rs895327908 1506 dbSNP
rs1328645058 1510 dbSNP
rs1174941614 1514 dbSNP
rs768282075 1516 dbSNP
rs779193301 1517 dbSNP
rs1176638094 1520 dbSNP
rs1050527822 1542 dbSNP
rs1439571736 1545 dbSNP
rs1205371740 1550 dbSNP
rs889649063 1562 dbSNP
rs1006708227 1567 dbSNP
rs542215097 1568 dbSNP
rs1280994087 1572 dbSNP
rs1307248629 1575 dbSNP
rs755596000 1577 dbSNP
rs748511321 1582 dbSNP
rs559405735 1584 dbSNP
rs528224667 1598 dbSNP
rs1384238677 1605 dbSNP
rs1339081709 1606 dbSNP
rs11540519 1607 dbSNP
rs1030995948 1612 dbSNP
rs551448292 1614 dbSNP
rs1301830986 1632 dbSNP
rs1428694047 1635 dbSNP
rs1454006073 1638 dbSNP
rs1365012678 1639 dbSNP
rs752640648 1649 dbSNP
rs966017011 1655 dbSNP
rs772281679 1657 dbSNP
rs1156371690 1662 dbSNP
rs994044912 1663 dbSNP
rs1385837893 1665 dbSNP
rs1025351783 1668 dbSNP
rs1440417198 1669 dbSNP
rs952403662 1677 dbSNP
rs564774135 1678 dbSNP
rs1283933641 1694 dbSNP
rs1239581309 1695 dbSNP
rs1360287600 1697 dbSNP
rs7297969 1699 dbSNP
rs1317725902 1702 dbSNP
rs927044412 1713 dbSNP
rs932534753 1723 dbSNP
rs958677028 1725 dbSNP
rs1382428774 1726 dbSNP
rs1272042190 1728 dbSNP
rs1436226275 1730 dbSNP
rs544874901 1734 dbSNP
rs150562807 1740 dbSNP
rs1365668476 1741 dbSNP
rs909664850 1747 dbSNP
rs1367673487 1756 dbSNP
rs3832813 1756 dbSNP
rs386376459 1756 dbSNP
rs1197416420 1763 dbSNP
rs1432036207 1766 dbSNP
rs941095302 1772 dbSNP
rs550485249 1777 dbSNP
rs1467026969 1782 dbSNP
rs567189440 1791 dbSNP
rs1193685618 1795 dbSNP
rs535851909 1800 dbSNP
rs1430500422 1801 dbSNP
rs966085622 1807 dbSNP
rs1394773196 1810 dbSNP
rs1412051343 1812 dbSNP
rs1309445266 1813 dbSNP
rs549155324 1814 dbSNP
rs1325032314 1815 dbSNP
rs1362787493 1815 dbSNP
rs1389987376 1815 dbSNP
rs3210523 1815 dbSNP
rs917382791 1815 dbSNP
rs1403751870 1816 dbSNP
rs1466956402 1819 dbSNP
rs1193143901 1821 dbSNP
rs1280836468 1821 dbSNP
rs1271135714 1822 dbSNP
rs1271521676 1822 dbSNP
rs1480919262 1822 dbSNP
rs77091058 1822 dbSNP
rs1196892954 1823 dbSNP
rs1274261626 1823 dbSNP
rs1198085933 1824 dbSNP
rs555664960 1824 dbSNP
rs878997390 1824 dbSNP
rs1332698604 1825 dbSNP
rs534839621 1825 dbSNP
rs1233886546 1826 dbSNP
rs1342465279 1826 dbSNP
rs777476590 1826 dbSNP
rs370800854 1827 dbSNP
rs67548374 1827 dbSNP
rs1063466 1828 dbSNP
rs796338406 1828 dbSNP
rs1184588681 1829 dbSNP
rs1337189874 1829 dbSNP
rs1237927962 1830 dbSNP
rs1280251810 1830 dbSNP
rs1462955266 1830 dbSNP
rs140131076 1831 dbSNP
rs1292621134 1832 dbSNP
rs1360711904 1832 dbSNP
rs1413898693 1832 dbSNP
rs1453032852 1832 dbSNP
rs1491293118 1832 dbSNP
rs58387198 1832 dbSNP
rs1036772273 1833 dbSNP
rs199853731 1833 dbSNP
rs1160579059 1834 dbSNP
rs1275586626 1834 dbSNP
rs1380174027 1835 dbSNP
rs1490258032 1835 dbSNP
rs199875731 1836 dbSNP
rs796917689 1836 dbSNP
rs1271142746 1838 dbSNP
rs1236097805 1839 dbSNP
rs1207567262 1840 dbSNP
rs1433908491 1842 dbSNP
rs938979794 1842 dbSNP
rs1041950460 1843 dbSNP
rs1193082012 1843 dbSNP
rs77128574 1843 dbSNP
rs1057146581 1844 dbSNP
rs1246625097 1845 dbSNP
rs895412917 1845 dbSNP
rs1012874398 1846 dbSNP
rs1447539886 1848 dbSNP
rs1346068886 1850 dbSNP
rs1300307020 1856 dbSNP
rs1043908644 1860 dbSNP
rs1359987566 1864 dbSNP
rs1164712419 1865 dbSNP
rs1049986 1866 dbSNP
rs544239127 1872 dbSNP
rs1370737338 1874 dbSNP
rs759900274 1884 dbSNP
rs1472245314 1891 dbSNP
rs1263394148 1892 dbSNP
rs1050968805 1899 dbSNP
rs1423618883 1900 dbSNP
rs1486983032 1900 dbSNP
rs1222213940 1912 dbSNP
rs1284700093 1912 dbSNP
rs1031028502 1926 dbSNP
rs1300672962 1935 dbSNP
rs889226704 1938 dbSNP
rs1008949807 1941 dbSNP
rs1040900392 1942 dbSNP
rs966048240 1947 dbSNP
rs537605405 1962 dbSNP
rs1280268316 1976 dbSNP
rs61401764 1979 dbSNP
rs182479619 1980 dbSNP
rs1398401745 1981 dbSNP
rs1339915508 1983 dbSNP
rs1392256381 1984 dbSNP
rs997542021 1985 dbSNP
rs3210539 1986 dbSNP
rs187055776 1992 dbSNP
rs1029383746 1993 dbSNP
rs1426237635 1996 dbSNP
rs543305737 1997 dbSNP
rs1195320390 1998 dbSNP
rs994117586 2001 dbSNP
rs552737309 2002 dbSNP
rs1025553115 2012 dbSNP
rs1489188120 2014 dbSNP
rs952506564 2016 dbSNP
rs1005236095 2018 dbSNP
rs1034402170 2019 dbSNP
rs572784294 2034 dbSNP
rs1259820370 2036 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucAUGUA--GUAGA-UAUGACAu 5'
            |:|||  :| || ||||||| 
Target 5' gcUGCAUUCUAACUCAUACUGUg 3'
 		14 - 36
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7009.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucAUGUA--GUAGA-UAUGACAu 5'
            |:|||  :| || ||||||| 
Target 5' gcUGCAUUCUAACUCAUACUGUg 3'
 		13 - 35
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6 PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177626. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_4 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000423828.1 | 3UTR | AUUUUCAGCUCAGGCUGCAUUCUAACUCAUACUGUGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000423828.1 | 3UTR | UUUUCAGCUCAGGCUGCAUUCUAACUCAUACUGUGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells -0.601 9.5e-4 -0.551 2.6e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.572 4.2e-3 0.699 3.0e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.51 4.6e-3 -0.570 1.5e-3 25 Click to see details
GSE28544 Breast cancer 0.477 9.2e-3 0.571 1.8e-3 24 Click to see details
GSE27834 Pluripotent stem cells -0.512 2.1e-2 -0.506 2.3e-2 16 Click to see details
GSE21687 Ependynoma primary tumors -0.206 5.1e-2 -0.209 4.9e-2 64 Click to see details
GSE14794 Lymphoblastoid cells 0.156 7.1e-2 0.105 1.6e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.398 8.9e-2 -0.571 2.1e-2 13 Click to see details
GSE21032 Prostate cancer 0.134 1.1e-1 0.124 1.3e-1 83 Click to see details
GSE21849 B cell lymphoma 0.12 2.7e-1 0.386 1.9e-2 29 Click to see details
GSE19783 ER- ER- breast cancer -0.064 2.9e-1 0.012 4.6e-1 79 Click to see details
GSE32688 Pancreatic cancer -0.082 3.3e-1 -0.099 2.9e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.088 3.6e-1 0.065 3.9e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.216 3.6e-1 0.000 5.0e-1 5 Click to see details
GSE19536 Breast cancer -0.032 3.8e-1 -0.008 4.7e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.059 3.9e-1 0.057 4.0e-1 23 Click to see details
GSE38226 Liver fibrosis 0.062 3.9e-1 0.383 4.3e-2 21 Click to see details
GSE17306 Multiple myeloma -0.03 4.2e-1 0.299 1.8e-2 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.01 4.8e-1 0.152 2.3e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.002 5.0e-1 0.119 3.6e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.519 0 0.499 0 32 Click to see details
ESCA 0.479 0.07 0.336 0.16 11 Click to see details
UCEC 0.365 0.07 0.364 0.07 18 Click to see details
THCA -0.187 0.08 -0.211 0.05 59 Click to see details
PRAD 0.197 0.09 0.245 0.05 48 Click to see details
LIHC -0.182 0.11 -0.126 0.19 49 Click to see details
LUAD -0.384 0.11 -0.357 0.13 12 Click to see details
KIRC -0.139 0.13 -0.128 0.15 68 Click to see details
PCPG -0.873 0.16 -1.000 0.5 3 Click to see details
CHOL -0.331 0.19 -0.283 0.23 9 Click to see details
HNSC -0.122 0.22 -0.184 0.12 42 Click to see details
KICH 0.122 0.28 0.242 0.12 25 Click to see details
LUSC 0.07 0.34 -0.026 0.44 38 Click to see details
CESC -0.3 0.4 0.500 0.33 3 Click to see details
KIRP -0.039 0.42 0.000 0.5 32 Click to see details
PAAD -0.158 0.42 0.200 0.4 4 Click to see details
BLCA 0.038 0.44 0.218 0.21 16 Click to see details
BRCA -0.004 0.49 0.029 0.4 74 Click to see details
BRCA -0.004 0.49 0.029 0.4 74 Click to see details
BRCA -0.004 0.49 0.029 0.4 74 Click to see details
204 hsa-miR-144-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 PLAG1 zinc finger 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor beta 1 4 1
MIRT006872 MTOR mechanistic target of rapamycin kinase 7 3
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor, erythroid 2 like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 6 5
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT066720 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT066784 ARID1A AT-rich interaction domain 1A 2 2
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT068846 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT069657 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT071717 CCNK cyclin K 2 2
MIRT073564 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT080720 ZCCHC2 zinc finger CCHC-type containing 2 2 4
MIRT090617 PLS1 plastin 1 2 2
MIRT097062 TNPO1 transportin 1 2 4
MIRT102618 UBN2 ubinuclein 2 2 4
MIRT118769 FAM217B family with sequence similarity 217 member B 2 6
MIRT147282 KPNA2 karyopherin subunit alpha 2 2 10
MIRT159513 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT196438 TAOK1 TAO kinase 1 2 2
MIRT211238 FGF2 fibroblast growth factor 2 2 2
MIRT220422 MKLN1 muskelin 1 2 2
MIRT223668 FZD6 frizzled class receptor 6 2 6
MIRT223805 OXR1 oxidation resistance 1 2 2
MIRT238585 NLN neurolysin 2 2
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT247188 BTG2 BTG anti-proliferation factor 2 2 6
MIRT249185 AKIRIN1 akirin 1 2 8
MIRT252653 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT305624 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT315671 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 6
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT403294 ZNF207 zinc finger protein 207 2 2
MIRT405966 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT437437 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 1
MIRT438343 MET MET proto-oncogene, receptor tyrosine kinase 5 1
MIRT444395 ZNF480 zinc finger protein 480 2 2
MIRT445255 SEMA5A semaphorin 5A 2 2
MIRT445309 MLANA melan-A 2 2
MIRT449020 ANKRD12 ankyrin repeat domain 12 2 2
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT459438 PPIC peptidylprolyl isomerase C 2 2
MIRT460471 MMS22L MMS22 like, DNA repair protein 2 2
MIRT461294 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT462948 ZNF800 zinc finger protein 800 2 12
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT463846 WRN Werner syndrome RecQ like helicase 2 2
MIRT466183 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466882 STX16 syntaxin 16 2 2
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468259 SFXN4 sideroflexin 4 2 2
MIRT469660 RAC1 Rac family small GTPase 1 2 10
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT470552 COASY Coenzyme A synthase 2 2
MIRT472208 NGFRAP1 brain expressed X-linked 3 2 4
MIRT472555 NACC1 nucleus accumbens associated 1 2 4
MIRT473462 MCL1 MCL1, BCL2 family apoptosis regulator 2 2
MIRT473925 LYSMD3 LysM domain containing 3 2 4
MIRT474068 LMNB2 lamin B2 2 2
MIRT475079 ITSN2 intersectin 2 2 4
MIRT475286 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT477516 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478464 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478920 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479338 CERK ceramide kinase 2 2
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480915 BCL2L11 BCL2 like 11 4 3
MIRT481532 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT481724 APPBP2 amyloid beta precursor protein binding protein 2 2 6
MIRT481938 ANKRD11 ankyrin repeat domain 11 2 12
MIRT487099 C2orf44 WD repeat and coiled coil containing 2 2
MIRT489294 RBM8A RNA binding motif protein 8A 2 8
MIRT492255 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT494770 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT496257 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497713 ZNF645 zinc finger protein 645 2 2
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT499292 TSPYL1 TSPY like 1 2 2
MIRT500105 SLC46A3 solute carrier family 46 member 3 2 2
MIRT501020 SPATA2 spermatogenesis associated 2 2 6
MIRT501816 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502296 GNG12 G protein subunit gamma 12 2 6
MIRT502493 FAM122B family with sequence similarity 122B 2 8
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT504266 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504370 ARID1B AT-rich interaction domain 1B 2 6
MIRT505125 YOD1 YOD1 deubiquitinase 2 4
MIRT506052 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT506481 MYO5A myosin VA 2 6
MIRT506967 HOXA10 homeobox A10 2 6
MIRT507728 CLIC4 chloride intracellular channel 4 2 4
MIRT513081 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513570 FKBP14 FK506 binding protein 14 2 2
MIRT513631 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513692 RNF111 ring finger protein 111 2 2
MIRT513764 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT520786 TBX18 T-box 18 2 4
MIRT523402 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT527750 NANOGNB NANOG neighbor homeobox 2 2
MIRT532823 ZNF827 zinc finger protein 827 2 2
MIRT534603 RORA RAR related orphan receptor A 2 2
MIRT535762 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536346 LEFTY1 left-right determination factor 1 2 2
MIRT543081 APP amyloid beta precursor protein 2 2
MIRT544064 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545424 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT546324 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547539 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548062 GOLGA7 golgin A7 2 2
MIRT549248 ATXN1L ataxin 1 like 2 4
MIRT549250 ATXN1 ataxin 1 2 2
MIRT549467 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549937 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT551489 TMEM192 transmembrane protein 192 2 4
MIRT552564 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553688 TFAP4 transcription factor AP-4 2 4
MIRT553951 STAMBP STAM binding protein 2 2
MIRT554163 SLC7A2 solute carrier family 7 member 2 2 4
MIRT554477 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555003 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555109 PURB purine rich element binding protein B 2 2
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555535 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556092 MORC3 MORC family CW-type zinc finger 3 2 2
MIRT556571 LIFR LIF receptor alpha 2 2
MIRT556936 INO80D INO80 complex subunit D 2 4
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT558368 DIDO1 death inducer-obliterator 1 2 4
MIRT558464 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT559236 BICD2 BICD cargo adaptor 2 2 4
MIRT560099 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560725 ZNF749 zinc finger protein 749 2 2
MIRT561142 SPAG1 sperm associated antigen 1 2 2
MIRT561721 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562484 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT562681 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565068 USP25 ubiquitin specific peptidase 25 2 2
MIRT565184 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565946 RREB1 ras responsive element binding protein 1 2 2
MIRT566315 POU2F1 POU class 2 homeobox 1 2 2
MIRT566435 PHF3 PHD finger protein 3 2 2
MIRT566485 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566612 NR3C1 nuclear receptor subfamily 3 group C member 1 4 2
MIRT566761 MOB4 MOB family member 4, phocein 2 2
MIRT566867 LRRC1 leucine rich repeat containing 1 2 2
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT567245 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT570705 FAM69A family with sequence similarity 69 member A 2 2
MIRT570931 ZNF284 zinc finger protein 284 2 2
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT571647 SIX4 SIX homeobox 4 2 2
MIRT574274 ZNF350 zinc finger protein 350 2 2
MIRT574304 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT574843 CADM1 cell adhesion molecule 1 2 2
MIRT608128 TSC22D2 TSC22 domain family member 2 2 2
MIRT648849 WNT7A Wnt family member 7A 2 2
MIRT687559 MLEC malectin 2 2
MIRT696548 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701146 PANK1 pantothenate kinase 1 2 2
MIRT704284 DENND5B DENN domain containing 5B 2 2
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT707687 GPR50 G protein-coupled receptor 50 2 2
MIRT707810 TSPAN6 tetraspanin 6 2 2
MIRT710019 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712705 TEX9 testis expressed 9 2 2
MIRT731264 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT731606 SMAD4 SMAD family member 4 1 1
MIRT731688 MAP3K8 mitogen-activated protein kinase kinase kinase 8 3 1
MIRT731796 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT731798 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT732183 PTGS2 prostaglandin-endoperoxide synthase 2 3 1
MIRT732711 ADAM10 ADAM metallopeptidase domain 10 4 0
MIRT732936 HGF hepatocyte growth factor 1 0
MIRT733214 TLR2 toll like receptor 2 2 0
MIRT734500 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
MIRT734637 RPE ribulose-5-phosphate-3-epimerase 2 0
MIRT735650 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 0
MIRT736975 BCL6 B-cell CLL/lymphoma 6 3 0
MIRT737058 FBXW7 F-box and WD repeat domain containing 7 3 0
MIRT737435 CLK3 CDC like kinase 3 2 0
MIRT755765 FOXO1 forkhead box O1 3 1
MIRT755949 ONECUT2 one cut homeobox 2 7 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-144 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-144 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-144 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-144 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-144 XMD8-92 NULL 46843772 Microarray pancreatic ductal adenocarcinoma cell 24880079 2014 up-regulated
miR-144 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-144 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-144 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-144 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-144 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-144 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-144 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-144-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-144-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229, U251, LN18）
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Prostate Cancer tissue and cell line (PC-3, LNCap)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved resistant Low Cervical Cancer tissue
hsa-miR-144-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (SN12-PM6, 786-O)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Anaplastic Thyroid Cancer tissue
hsa-miR-144-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-144-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma cell line (SH-SY5Y, SK-N-SH)
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Neuroblastoma cell line (SK-N-SH, IMR-32)
hsa-miR-144-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-144-3p Pazopanib 10113978 NSC752782 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-144-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-144-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-144-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission