>ESPL1|NM_012291|3'UTR
   1 CCCCATGGAGCTGTCTTATTGATGCTAGAAGCCTCATAACTGTTCTACCTCCAAGGTTAGATTTAATCCTTAGGATAACT
  81 CTTTTAAAGTGATTTTCCCCAGTGTTTTATATGAAACATTTCCTTTTGATTTAACCTCAGTATAATAAAGATACATCATT
 161 TAAACCCTGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uucuUUGAU--GAUGGAGu 5' ||||: ||||||| Target 5' tcatAACTGTTCTACCTCc 3'	34 - 52	151.00	-11.80
2	miRNA 3' uucuuugaugaUGGAGu 5' ||||| Target 5' cttttgatttaACCTCa 3'	123 - 139	100.00	-7.50
3	miRNA 3' uucuuugaUGAUGGAGu 5' :||::||: Target 5' cccatggaGCTGTCTTa 3'	2 - 18	93.00	-7.00

Mutant ID	Mutant Position	Mutant Source
COSN30117584	37	COSMIC
COSN31509841	52	COSMIC
COSN13404083	70	COSMIC
COSN30159623	92	COSMIC
COSN30527057	92	COSMIC
COSN30534393	119	COSMIC
COSN30178198	128	COSMIC
rs1056692	130	GWAS

Mutant ID	Mutant Position	Mutant Source
rs199711854	2	dbSNP
rs773173835	5	dbSNP
rs746971297	6	dbSNP
rs1436071059	23	dbSNP
rs1186156644	24	dbSNP
rs373318470	26	dbSNP
rs776073708	29	dbSNP
rs759092519	33	dbSNP
rs1408845650	37	dbSNP
rs764813630	41	dbSNP
rs749500786	43	dbSNP
rs775146256	46	dbSNP
rs762134127	50	dbSNP
rs755141864	57	dbSNP
rs1487197855	59	dbSNP
rs768092593	69	dbSNP
rs1243514606	75	dbSNP
rs146497037	113	dbSNP
rs1487843997	118	dbSNP
rs931482805	123	dbSNP
rs879899750	129	dbSNP
rs1056692	130	dbSNP
rs1236462094	139	dbSNP
rs748479182	142	dbSNP
rs1409301576	156	dbSNP
rs949064966	158	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.