| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-519c |
| Genomic Coordinates | chr19: 53686469 - 53686555 |
| Description | Homo sapiens miR-519c stem-loop |
| Comment | The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-519c-3p | ||||||||||||||||||||||||||||
| Sequence | 54| AAAGUGCAUCUUUUUAGAGGAU |75 | ||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||
| Experiments | Array-cloned | ||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | RAB5B | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | RAB5B, member RAS oncogene family | ||||||||||||||||||||
| Transcript | NM_002868 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on RAB5B | |||||||||||||||||||||
| 3'UTR of RAB5B (miRNA target sites are highlighted) |
>RAB5B|NM_002868|3'UTR 1 GGGGGTGGCTAGCAGCAAACAAGTATGGAGCTAGCACAAGAGCTAAGAAATAACCTCCATCCCTACCCCTCAGCACACAA 81 CCCCTACGGTAACAGCACACTGAGCCCTGGCTCCCAAGGGCTGCCTCCTGACAGCTCCGTCATGGCACTTTTTAACGCTT 161 CAGCAACAAACACCAGGCAGCTGTTGCCACTGGCCTCCTACCCCCTACTCTGGGGCTTGGGGGTCAACTCCCCCCAGGAC 241 TTACCTTCCAAAACAAACTTTCTTCACTTTGTATTATAGGTACAAGACAGCGACTTACGTATCTTTTCTCCTCCTCCCTA 321 GTGTTCCTCCCCATTTTTTCAGAAAACACTTCTGACTCCTGTCCCTTCCCCTTCTGCTTTTGGTCAGTCCCTGTTCTTGA 401 GCCTCTTTTCTCCTCTCCCCAGGATGCAGAAAGTGGTGAACCCAGGAACTGAGGAAGGAGGTTTCCAGTTCATTTACATT 481 AAGGGCCCTGGGGGAGAATAAAGCTCAGAGCAGGAGGGAGTAAGGAAACATTTCCTTTTTGTTTTTATTTGGTTGGAGTT 561 TCTCATATTTGAAAACATTGCGGTATCCATGATTTGGCCTTGTGGAGGGTGTTCCTAGGTAGAGGTGAGAATGGGGAGGC 641 AAGATCTCAGGCACCAGGCAGGAGGTGCCTTGTAAGCTAACTGGGCGGAGGTGGAGGTGCAGTGTCAACTGTGGCTCTGT 721 AACTCTTCAAAGGCCCAGTTTCCCCTCACGCAGCCTCTTAGGTAGCGTTTCCCCTAATCGTGGGGGTTGGACCCCAGAGT 801 CTTCCAAAGAATTTTCACTGGTTGCCTGCATCTTTGGCTCTGCTGTGATCTGATTGGAGGAGGGACAGTTTCTGGTACCC 881 ATCCTCTGATTTATACATATGCATTTTTTCCCCTCTGGCCTTTAGATGGCCTCAGCCCCAGCCACCATATACCCCTGCAG 961 TTTGCACTTTAATTGATGGTAGTTCAGTTGGGGTACTTGTTTTATGGAAGTTTTGATTGATTTACTTGCCCTCCCACCTT 1041 CTTTTTAATTCAATGAAATCTGAGGTTAATGCGAGGTTCGAGGAGAGGTTATAGATAAAACTACCAGTGGCAGCTACTCA 1121 AGTCCTATCTCCACTGTTAGCTTCCTCCAACTCTAATTATTAACCTATATTCTTGCCAAGCTAACTATTGACTATAGGTT 1201 TGCCTTTCCTGGAGAATTAATTGAGCAATTGAGGAGTGTCTCAGGATAGCACAGGCCAAGGTAGGGGAGTAAAAAGGAGG 1281 TCAGGCAAAAGGGAGGAGTTTTCTGTCCTTTCCCAGGTTTCACACTCAATTTGATATCCATTACCATGTCTTTTCTACTT 1361 CCTTGTAAATAGGTATGATCTTTATTCCCACTGTACAGTCTGTTCTATCCTCTGCCTCCCATCAGGCCCTGTTTCTTTGT 1441 TCCTTTGTTAATATCTTGAATTTAGTCCCTCCATCCTTAATCCCCCCATCCCTCCCCATCATGCAACCAGTGGTTTAATC 1521 CATGTACCAATAGGGGCTAGTACCACAGAGGCCTCCTGTGGTGCCCTCGTATCATACCACCTGTTCCTGTGGAGAGGGAA 1601 TGACCGGCACTGAAGGTACCTTACAACTGGCTCATATTATCAGAGGACCTTGGTCCTTTCTAAATCTCTAGTCTCTCTTC 1681 ATATCCTTCATCAGGTGTTTTAAGATGTCTCTGAGAAGCCATCAAGGCAAAAGAGAACTTTAAGTTCCTTGTTCCAGCCC 1761 GGAGTTTTGGGAAAGAAAGAAAGGAAAGGTCACAGTGACCTAGGATTGGAACCTTCCTGCCCTTTTGGCTTGCAGACTGC 1841 CTTCTATCCCAGAACAGCTGAGAAATCTATGAAGCTGAGATTCTGAAGGACCCAGCTTAGGTTCTTCCACTTAGGCCTCA 1921 ATTCCCTTCCTTTTCCAGGGGCAGCCTTAGTTCCCATGGCCCTGAAACACACACATTTCCCCCTTCCTTTCCCAGAAGCC 2001 ACTGGCCCCCCATAGCACCCAGTGCATCCTTTTTACAAGTGGAAGAACTAGGATGGCTTTCCAAAGTCTTCTAGAAATGA 2081 AGTTCTTTCTCTGTGCAGCTTTCCCCCTTGGAGCAGGAGTGAAGATGTTTCATTATCTTGGGCCTGGGAAACCACTTCCC 2161 CAGGCTTCTCCCTCCCCCCACCCCCATAGGAACAGGATTTGGCCTTAGCTTCTGGGCCTATCGGCTGCCTTCCCTCTACT 2241 TCCTACCACCTCTTCTGCCTTCCTTTGAGCTCTGTTGGGCTTGGGGATCTTAGTTTTCTTTTGTTTATTTCCCAGCTCAT 2321 TTTTTTCTTCTGGTCAGTTTTTTTAAGGGGGGGTGTTGTGGTTTTTTGTTTTTGTTTTGCTTCTGAGAAAGCATTTGCCT 2401 TTCTTCCTCTCCCAACATAACAATCGTGGTAACAGAATGCGACTGCTGATTTACCGATGTATTTAATGTAAGTAAAAAAA 2481 GGAAAAAAAGAAAAGGGCATTGGAGTGTTGCTTTTTTTTATTTTATTGTTATTATTATTATTATTTTTGCTATTTGTCAG 2561 GTACTAGGAATTTGGAAGAAAGGATACCCAGTAATGTTCTACTGAATCAGAAACACACCTTTCCCTGCATCTTGATACAT 2641 CTTTATTCCCTTTAATCTTTTCTTAAACATCTAGTTTAGAAAATAGCCCTTCTATTGCTATTTAATCACCCCTCTTCTAA 2721 GGCCACTAGATTGTTCATCAAATCAAACCCTATTATATCTTTTTAGGCCCTCTTAACAGAATGTATATGTGTAGGGTATG 2801 GTCTGTGGATCTTTGGGCCCACTGATCAGATTAGAGAGAGGGGTGCTATTTGAAGTAGTATACAAAAATGTATGTGCATA 2881 TTTCTTTTTTTTTTTTTAATTGAGACGGAGTCTCTGTCGCTAGCCTGGAGTACAGTGGCACGATCTTGGCTCACAGCAAT 2961 CTCCGCCTCCTGAGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTAGGATTACAGGCACGCACCAACACACCCA 3041 GCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGTCAGGCTGGTCTTGAACTCCTGACCTCGTGATCCA 3121 CCCACCTTGGCCTCCCAAAGTGCTGGGATTACGGGCGTGAGCCACTGCGCCCGGCCGTATGTGCATATTTCTAGGATCCA 3201 TTTCTATATGTTTCTCAAAGGGGTCCATGACCCAAAGGTTGAAAAACATCACTGAGTTAGTTTTCTTGTAGCTTCCACCT 3281 CAACGGGAAAATTTCCTCTGGATCTGCTCTTGACTCCTAGTGTACTTCAAACCCTTCAGTCCACCACAGTCTAAAGGTCG 3361 AGGGAAGGGAAATGAAATAGGATTATGTGTGGTTGCAGTAGGCTTTAAATTCCAAAGAATCTGAAGGTGGATAGGAAAGA 3441 GGACTGGTGCCAGACAAATCTGACATTCTAGGCCTGTCTCTGTCAACTTAACCAGCTGTGGCCTTGATCAAGTTAGTTAG 3521 TGCCTTCCGCCTCGTTTCTTCATCTGTAAAGTAAAAGCTGAAGATTAAGGTCAATTATGTAAAGTATGTGTGTCACACAA 3601 AAGTAGATGACACTATTAGGAAGGAGGCTTTTAGATAGTCCCTAACTGACTTCTCTGTATCTTCCTTTGGCTGAGACTTT 3681 TTTTTTTTTAGGTTGAAGCTCGCTTTCTCTCTCTCTCCCTCTTTCTCCCTCTCTCTCTCTCTCTCACTCTCTCTCTCTCC 3761 ATATATATATACATATATATATATATATATATTTTTTTTTTAACAACTGGTAGGATAGGTTGGGCATTAGCCTTCTTCAG 3841 TGATTTGATTGTATACAGATTGAAATCCTTTCCATTTCCAAACACTTAAGAGCCAAAGCCAACTTGCCAACTTTTCACTG 3921 TCGGTTCCCTTACCTTATATCTCTTGGTAATACCCCCCACCCCCGTTCCCTGATTCCTGGTAAAAGCTCTAGTTGGAGAG 4001 CCGAAAGGAAAGGAAATGATCTTTCAAAATTAAAGGTGAACACCTTCACTTAAACTGATTAAAATTGCAGCTCCACCGTC 4081 CGGCCTCTAGAGGGCAGTGTATGGATACATTTGTCCAGATTGGGGGACTAGGTTTGATAAATTTTGTCCTGCATCAAATG 4161 ACAAAAGGGTAATAGGAAATGTATTATATTTATGCCCCTTACTTTGAGATAAGAGACTACAACCTTCATACTTCGGGGTG 4241 TTAAGCTGCCATTGCTCTTGTTAAGGGGCAGTTTGTTTTTTAAGAGATGGGGTCTTGCTCTGTTGTCCAGGCTGGAGTGC 4321 AGTGCCGCGATCTTGGCTCAGTGCAACCTCGAACTCCTGGGCTTAAGCGATCCTCCCGCCTCAGCCTCCCGAGTACTGGG 4401 ACTACAGGCGTGTGCCACCAAGGGGCGATTATTATTTTTTTTTTCTACGCAAAATAAAAGACGGCTATTCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 5869.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 5869.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAUUGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM714647 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repB |
| Location of target site | ENST00000553116.1 | 3UTR | AUAUACCCCUGCAGUUUGCACUUUAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000553116.1 | 3UTR | CCCCAGCCACCAUAUACCCCUGCAGUUUGCACUUUAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
325 hsa-miR-519c-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000496 | HIF1A | hypoxia inducible factor 1 alpha subunit |  |
|
|
|
4 | 1 | ||||
| MIRT000998 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | |
|
|
|
4 | 3 | ||||
| MIRT003732 | ELAVL1 | ELAV like RNA binding protein 1 | |
|
|
3 | 1 | |||||
| MIRT006639 | TIMP2 | TIMP metallopeptidase inhibitor 2 | |
|
|
3 | 1 | |||||
| MIRT006640 | PTEN | phosphatase and tensin homolog | |
|
|
3 | 1 | |||||
| MIRT006641 | CDKN1A | cyclin dependent kinase inhibitor 1A | |
|
|
3 | 1 | |||||
| MIRT055028 | TPRG1L | tumor protein p63 regulated 1 like | |
|
2 | 2 | ||||||
| MIRT055393 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 6 | ||||||
| MIRT056828 | REEP3 | receptor accessory protein 3 | |
|
2 | 2 | ||||||
| MIRT060504 | PPP6R3 | protein phosphatase 6 regulatory subunit 3 | |
|
2 | 2 | ||||||
| MIRT061796 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | |
|
2 | 10 | ||||||
| MIRT063354 | ETNK1 | ethanolamine kinase 1 | |
|
2 | 2 | ||||||
| MIRT064424 | ARID4B | AT-rich interaction domain 4B | |
|
2 | 2 | ||||||
| MIRT064719 | CCND2 | cyclin D2 | |
|
2 | 2 | ||||||
| MIRT064805 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 4 | ||||||
| MIRT065609 | DAZAP2 | DAZ associated protein 2 | |
|
2 | 10 | ||||||
| MIRT065622 | CLIC4 | chloride intracellular channel 4 | |
|
2 | 4 | ||||||
| MIRT065872 | GDF11 | growth differentiation factor 11 | |
|
2 | 2 | ||||||
| MIRT065892 | RAB5B | RAB5B, member RAS oncogene family | |
|
2 | 8 | ||||||
| MIRT068751 | RB1 | RB transcriptional corepressor 1 | |
|
2 | 2 | ||||||
| MIRT070050 | FANCM | Fanconi anemia complementation group M | |
|
2 | 2 | ||||||
| MIRT071004 | SMOC1 | SPARC related modular calcium binding 1 | |
|
2 | 2 | ||||||
| MIRT071334 | CMPK1 | cytidine/uridine monophosphate kinase 1 | |
|
2 | 6 | ||||||
| MIRT071912 | ZFYVE9 | zinc finger FYVE-type containing 9 | |
|
2 | 2 | ||||||
| MIRT072732 | GLCE | glucuronic acid epimerase | |
|
2 | 2 | ||||||
| MIRT076028 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | |
|
2 | 6 | ||||||
| MIRT076046 | PITPNA | phosphatidylinositol transfer protein alpha | |
|
2 | 2 | ||||||
| MIRT079353 | CCDC137 | coiled-coil domain containing 137 | |
|
2 | 2 | ||||||
| MIRT080227 | SMAD4 | SMAD family member 4 | |
|
2 | 6 | ||||||
| MIRT081122 | LDLR | low density lipoprotein receptor | |
|
2 | 8 | ||||||
| MIRT081205 | MIDN | midnolin | |
|
2 | 10 | ||||||
| MIRT085098 | IFNAR2 | interferon alpha and beta receptor subunit 2 | |
|
2 | 6 | ||||||
| MIRT085149 | SLC5A3 | solute carrier family 5 member 3 | |
|
2 | 4 | ||||||
| MIRT086436 | NABP1 | nucleic acid binding protein 1 | |
|
2 | 6 | ||||||
| MIRT088037 | UBXN2A | UBX domain protein 2A | |
|
2 | 2 | ||||||
| MIRT088132 | SEPT2 | septin 2 | |
|
2 | 4 | ||||||
| MIRT088343 | MAPRE3 | microtubule associated protein RP/EB family member 3 | |
|
2 | 8 | ||||||
| MIRT090645 | U2SURP | U2 snRNP associated SURP domain containing | |
|
2 | 6 | ||||||
| MIRT090805 | MBNL1 | muscleblind like splicing regulator 1 | |
|
2 | 4 | ||||||
| MIRT091692 | TGFBR2 | transforming growth factor beta receptor 2 | |
|
2 | 4 | ||||||
| MIRT092689 | C3ORF38 | chromosome 3 open reading frame 38 | |
|
2 | 8 | ||||||
| MIRT093954 | SLAIN2 | SLAIN motif family member 2 | |
|
2 | 2 | ||||||
| MIRT095727 | ANKH | ANKH inorganic pyrophosphate transport regulator | |
|
2 | 8 | ||||||
| MIRT097158 | FCHO2 | FCH domain only 2 | |
|
2 | 2 | ||||||
| MIRT099319 | QKI | QKI, KH domain containing RNA binding | |
|
2 | 4 | ||||||
| MIRT099835 | SOX4 | SRY-box 4 | |
|
2 | 10 | ||||||
| MIRT100773 | ENPP4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) | |
|
2 | 2 | ||||||
| MIRT100955 | CENPQ | centromere protein Q | |
|
2 | 4 | ||||||
| MIRT102229 | HBP1 | HMG-box transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT102299 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | |
|
2 | 10 | ||||||
| MIRT102621 | UBN2 | ubinuclein 2 | |
|
2 | 8 | ||||||
| MIRT103780 | PURB | purine rich element binding protein B | |
|
2 | 2 | ||||||
| MIRT104168 | PHTF2 | putative homeodomain transcription factor 2 | |
|
2 | 6 | ||||||
| MIRT107279 | FAM73B | mitoguardin 2 | |
|
2 | 2 | ||||||
| MIRT107945 | TMEM2 | transmembrane protein 2 | |
|
2 | 2 | ||||||
| MIRT108265 | HABP4 | hyaluronan binding protein 4 | |
|
2 | 2 | ||||||
| MIRT124812 | BICD2 | BICD cargo adaptor 2 | |
|
2 | 2 | ||||||
| MIRT138707 | MPP5 | membrane palmitoylated protein 5 | |
|
2 | 2 | ||||||
| MIRT139880 | BTF3L4 | basic transcription factor 3 like 4 | |
|
2 | 6 | ||||||
| MIRT144312 | NFAT5 | nuclear factor of activated T-cells 5 | |
|
2 | 8 | ||||||
| MIRT145605 | LASP1 | LIM and SH3 protein 1 | |
|
2 | 2 | ||||||
| MIRT153350 | MAVS | mitochondrial antiviral signaling protein | |
|
2 | 4 | ||||||
| MIRT153986 | PRNP | prion protein | |
|
2 | 2 | ||||||
| MIRT159129 | NRBP1 | nuclear receptor binding protein 1 | |
|
2 | 2 | ||||||
| MIRT164533 | MSMO1 | methylsterol monooxygenase 1 | |
|
2 | 2 | ||||||
| MIRT165912 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT170858 | TAX1BP1 | Tax1 binding protein 1 | |
|
2 | 4 | ||||||
| MIRT172157 | FZD6 | frizzled class receptor 6 | |
|
2 | 8 | ||||||
| MIRT173701 | PRPF4 | pre-mRNA processing factor 4 | |
|
2 | 2 | ||||||
| MIRT175003 | ZBTB5 | zinc finger and BTB domain containing 5 | |
|
2 | 4 | ||||||
| MIRT175400 | ACSL4 | acyl-CoA synthetase long chain family member 4 | |
|
2 | 2 | ||||||
| MIRT178069 | SAMD8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT178675 | FAM102B | family with sequence similarity 102 member B | |
|
2 | 2 | ||||||
| MIRT180847 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 4 | ||||||
| MIRT194911 | RBBP6 | RB binding protein 6, ubiquitin ligase | |
|
2 | 8 | ||||||
| MIRT195755 | ATMIN | ATM interactor | |
|
2 | 6 | ||||||
| MIRT196623 | TAOK1 | TAO kinase 1 | |
|
2 | 6 | ||||||
| MIRT205286 | STK11IP | serine/threonine kinase 11 interacting protein | |
|
2 | 2 | ||||||
| MIRT206051 | PPARA | peroxisome proliferator activated receptor alpha | |
|
2 | 2 | ||||||
| MIRT206198 | RAB10 | RAB10, member RAS oncogene family | |
|
2 | 4 | ||||||
| MIRT208980 | SKIL | SKI like proto-oncogene | |
|
2 | 10 | ||||||
| MIRT223637 | ATP6V1C1 | ATPase H+ transporting V1 subunit C1 | |
|
2 | 4 | ||||||
| MIRT224757 | DPYSL2 | dihydropyrimidinase like 2 | |
|
2 | 2 | ||||||
| MIRT227995 | NFIB | nuclear factor I B | |
|
2 | 4 | ||||||
| MIRT230973 | PRRG4 | proline rich and Gla domain 4 | |
|
2 | 2 | ||||||
| MIRT238183 | ANKRD33B | ankyrin repeat domain 33B | |
|
2 | 10 | ||||||
| MIRT242425 | HAS3 | hyaluronan synthase 3 | |
|
2 | 2 | ||||||
| MIRT242666 | SALL3 | spalt like transcription factor 3 | |
|
2 | 4 | ||||||
| MIRT242765 | FNBP1L | formin binding protein 1 like | |
|
2 | 6 | ||||||
| MIRT243095 | LCLAT1 | lysocardiolipin acyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT243437 | PAK2 | p21 (RAC1) activated kinase 2 | |
|
2 | 2 | ||||||
| MIRT243964 | MAP1B | microtubule associated protein 1B | |
|
2 | 2 | ||||||
| MIRT244776 | RABGAP1 | RAB GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT246630 | TMEM109 | transmembrane protein 109 | |
|
2 | 2 | ||||||
| MIRT246968 | TSKU | tsukushi, small leucine rich proteoglycan | |
|
2 | 2 | ||||||
| MIRT266055 | FJX1 | four jointed box 1 | |
|
2 | 4 | ||||||
| MIRT266858 | SLC25A44 | solute carrier family 25 member 44 | |
|
2 | 2 | ||||||
| MIRT283184 | C16ORF52 | chromosome 16 open reading frame 52 | |
|
2 | 2 | ||||||
| MIRT286955 | SOCS7 | suppressor of cytokine signaling 7 | |
|
2 | 2 | ||||||
| MIRT293651 | PVR | poliovirus receptor | |
|
2 | 4 | ||||||
| MIRT295178 | ZNF317 | zinc finger protein 317 | |
|
2 | 4 | ||||||
| MIRT302453 | CLIP4 | CAP-Gly domain containing linker protein family member 4 | |
|
2 | 2 | ||||||
| MIRT303499 | NAGK | N-acetylglucosamine kinase | |
|
2 | 6 | ||||||
| MIRT368755 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT383207 | APH1A | aph-1 homolog A, gamma-secretase subunit | |
|
2 | 2 | ||||||
| MIRT383610 | POU2F1 | POU class 2 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT396102 | CASP2 | caspase 2 | |
|
2 | 2 | ||||||
| MIRT441419 | FAM9C | family with sequence similarity 9 member C | |
|
2 | 2 | ||||||
| MIRT446818 | C5orf30 | chromosome 5 open reading frame 30 | |
|
2 | 2 | ||||||
| MIRT448307 | WNK3 | WNK lysine deficient protein kinase 3 | |
|
2 | 2 | ||||||
| MIRT461781 | MPDU1 | mannose-P-dolichol utilization defect 1 | |
|
2 | 2 | ||||||
| MIRT462816 | NTN1 | netrin 1 | |
|
2 | 2 | ||||||
| MIRT463613 | ZBTB34 | zinc finger and BTB domain containing 34 | |
|
2 | 2 | ||||||
| MIRT464560 | UBTF | upstream binding transcription factor, RNA polymerase I | |
|
2 | 2 | ||||||
| MIRT464842 | RPS27A | ribosomal protein S27a | |
|
2 | 12 | ||||||
| MIRT465225 | TRIP10 | thyroid hormone receptor interactor 10 | |
|
2 | 2 | ||||||
| MIRT466446 | TFAM | transcription factor A, mitochondrial | |
|
2 | 8 | ||||||
| MIRT466836 | STX6 | syntaxin 6 | |
|
2 | 6 | ||||||
| MIRT467185 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | |
|
2 | 2 | ||||||
| MIRT468179 | SGMS1 | sphingomyelin synthase 1 | |
|
2 | 2 | ||||||
| MIRT469850 | PXK | PX domain containing serine/threonine kinase like | |
|
2 | 8 | ||||||
| MIRT471612 | PAQR5 | progestin and adipoQ receptor family member 5 | |
|
2 | 19 | ||||||
| MIRT472008 | NR1D2 | nuclear receptor subfamily 1 group D member 2 | |
|
2 | 2 | ||||||
| MIRT472159 | NIN | ninein | |
|
2 | 4 | ||||||
| MIRT472336 | NETO2 | neuropilin and tolloid like 2 | |
|
2 | 4 | ||||||
| MIRT473162 | MLLT1 | MLLT1, super elongation complex subunit | |
|
2 | 2 | ||||||
| MIRT473623 | MARK2 | microtubule affinity regulating kinase 2 | |
|
2 | 2 | ||||||
| MIRT473682 | MAPKBP1 | mitogen-activated protein kinase binding protein 1 | |
|
2 | 2 | ||||||
| MIRT473805 | MAP3K2 | mitogen-activated protein kinase kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT474416 | KLHL28 | kelch like family member 28 | |
|
2 | 8 | ||||||
| MIRT474736 | KIF13A | kinesin family member 13A | |
|
2 | 6 | ||||||
| MIRT474966 | KCTD10 | potassium channel tetramerization domain containing 10 | |
|
2 | 4 | ||||||
| MIRT475464 | HSPA8 | heat shock protein family A (Hsp70) member 8 | |
|
2 | 6 | ||||||
| MIRT476120 | GPR157 | G protein-coupled receptor 157 | |
|
2 | 2 | ||||||
| MIRT476203 | GNS | glucosamine (N-acetyl)-6-sulfatase | |
|
2 | 6 | ||||||
| MIRT477180 | F3 | coagulation factor III, tissue factor | |
|
2 | 8 | ||||||
| MIRT478103 | DLG5 | discs large MAGUK scaffold protein 5 | |
|
2 | 6 | ||||||
| MIRT478713 | CSNK1A1 | casein kinase 1 alpha 1 | |
|
2 | 6 | ||||||
| MIRT479055 | CNOT6L | CCR4-NOT transcription complex subunit 6 like | |
|
2 | 8 | ||||||
| MIRT480008 | CAPRIN2 | caprin family member 2 | |
|
2 | 4 | ||||||
| MIRT480519 | C11orf30 | EMSY, BRCA2 interacting transcriptional repressor | |
|
2 | 10 | ||||||
| MIRT480822 | BLCAP | bladder cancer associated protein | |
|
2 | 10 | ||||||
| MIRT480944 | BBX | BBX, HMG-box containing | |
|
2 | 8 | ||||||
| MIRT481336 | ATL3 | atlastin GTPase 3 | |
|
2 | 2 | ||||||
| MIRT481598 | ARHGAP1 | Rho GTPase activating protein 1 | |
|
2 | 6 | ||||||
| MIRT481877 | ANKRD50 | ankyrin repeat domain 50 | |
|
2 | 2 | ||||||
| MIRT482471 | ADAR | adenosine deaminase, RNA specific | |
|
2 | 4 | ||||||
| MIRT484875 | ZNF652 | zinc finger protein 652 | |
|
2 | 2 | ||||||
| MIRT485090 | SLC30A1 | solute carrier family 30 member 1 | |
|
2 | 4 | ||||||
| MIRT485579 | FOXQ1 | forkhead box Q1 | |
|
2 | 2 | ||||||
| MIRT485618 | FBXL5 | F-box and leucine rich repeat protein 5 | |
|
2 | 10 | ||||||
| MIRT486751 | CNOT4 | CCR4-NOT transcription complex subunit 4 | |
|
2 | 6 | ||||||
| MIRT489599 | ZDHHC20 | zinc finger DHHC-type containing 20 | |
|
2 | 10 | ||||||
| MIRT489889 | MPLKIP | M-phase specific PLK1 interacting protein | |
|
2 | 2 | ||||||
| MIRT491654 | PDRG1 | p53 and DNA damage regulated 1 | |
|
2 | 10 | ||||||
| MIRT492038 | TSG101 | tumor susceptibility 101 | |
|
2 | 4 | ||||||
| MIRT492361 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | |
|
2 | 2 | ||||||
| MIRT492776 | PDGFB | platelet derived growth factor subunit B | |
|
2 | 2 | ||||||
| MIRT493336 | LAPTM4A | lysosomal protein transmembrane 4 alpha | |
|
2 | 12 | ||||||
| MIRT493611 | HMGB3 | high mobility group box 3 | |
|
2 | 6 | ||||||
| MIRT497468 | DDR2 | discoidin domain receptor tyrosine kinase 2 | |
|
2 | 2 | ||||||
| MIRT498059 | SNX5 | sorting nexin 5 | |
|
2 | 6 | ||||||
| MIRT499901 | KIAA1191 | KIAA1191 | |
|
2 | 4 | ||||||
| MIRT500489 | ZBTB4 | zinc finger and BTB domain containing 4 | |
|
2 | 6 | ||||||
| MIRT500685 | TRIM37 | tripartite motif containing 37 | |
|
2 | 2 | ||||||
| MIRT500760 | TMEM127 | transmembrane protein 127 | |
|
2 | 6 | ||||||
| MIRT501456 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | |
|
2 | 8 | ||||||
| MIRT501559 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | |
|
2 | 2 | ||||||
| MIRT501983 | MAPK1 | mitogen-activated protein kinase 1 | |
|
2 | 10 | ||||||
| MIRT502000 | MAP7 | microtubule associated protein 7 | |
|
2 | 8 | ||||||
| MIRT502049 | LAMTOR1 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 | |
|
2 | 6 | ||||||
| MIRT502423 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | |
|
2 | 2 | ||||||
| MIRT503044 | CAMSAP2 | calmodulin regulated spectrin associated protein family member 2 | |
|
2 | 2 | ||||||
| MIRT503821 | TMEM242 | transmembrane protein 242 | |
|
2 | 4 | ||||||
| MIRT504290 | PARP1 | poly(ADP-ribose) polymerase 1 | |
|
2 | 6 | ||||||
| MIRT504560 | ZNF417 | zinc finger protein 417 | |
|
2 | 6 | ||||||
| MIRT505054 | ZNF202 | zinc finger protein 202 | |
|
2 | 6 | ||||||
| MIRT505486 | SRSF2 | serine and arginine rich splicing factor 2 | |
|
2 | 4 | ||||||
| MIRT505836 | POLR1B | RNA polymerase I subunit B | |
|
2 | 4 | ||||||
| MIRT506372 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 4 | ||||||
| MIRT506451 | NACC2 | NACC family member 2 | |
|
2 | 4 | ||||||
| MIRT506673 | LZIC | leucine zipper and CTNNBIP1 domain containing | |
|
2 | 4 | ||||||
| MIRT506834 | KIF23 | kinesin family member 23 | |
|
2 | 4 | ||||||
| MIRT506880 | KIAA0101 | PCNA clamp associated factor | |
|
2 | 6 | ||||||
| MIRT507359 | FAM129A | family with sequence similarity 129 member A | |
|
2 | 6 | ||||||
| MIRT507957 | BNIP2 | BCL2 interacting protein 2 | |
|
2 | 6 | ||||||
| MIRT509433 | MCM7 | minichromosome maintenance complex component 7 | |
|
2 | 6 | ||||||
| MIRT510872 | RAN | RAN, member RAS oncogene family | |
|
2 | 8 | ||||||
| MIRT511078 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | |
|
2 | 4 | ||||||
| MIRT511254 | KLHL36 | kelch like family member 36 | |
|
2 | 6 | ||||||
| MIRT513699 | RBM20 | RNA binding motif protein 20 | |
|
2 | 4 | ||||||
| MIRT513742 | PKNOX1 | PBX/knotted 1 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT513981 | CEP97 | centrosomal protein 97 | |
|
2 | 2 | ||||||
| MIRT514092 | EPS15L1 | epidermal growth factor receptor pathway substrate 15 like 1 | |
|
2 | 6 | ||||||
| MIRT515928 | MFAP2 | microfibril associated protein 2 | |
|
2 | 4 | ||||||
| MIRT519574 | ZNFX1 | zinc finger NFX1-type containing 1 | |
|
2 | 4 | ||||||
| MIRT521297 | RRAGD | Ras related GTP binding D | |
|
2 | 4 | ||||||
| MIRT521348 | RPP14 | ribonuclease P/MRP subunit p14 | |
|
2 | 2 | ||||||
| MIRT521693 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 8 | ||||||
| MIRT521778 | PPIG | peptidylprolyl isomerase G | |
|
2 | 8 | ||||||
| MIRT522191 | NR2C2 | nuclear receptor subfamily 2 group C member 2 | |
|
2 | 6 | ||||||
| MIRT524696 | BTG3 | BTG anti-proliferation factor 3 | |
|
2 | 8 | ||||||
| MIRT525663 | NHSL2 | NHS like 2 | |
|
2 | 2 | ||||||
| MIRT527252 | TMEM196 | transmembrane protein 196 | |
|
2 | 2 | ||||||
| MIRT527466 | CLEC12B | C-type lectin domain family 12 member B | |
|
2 | 2 | ||||||
| MIRT529535 | ICMT | isoprenylcysteine carboxyl methyltransferase | |
|
2 | 2 | ||||||
| MIRT530146 | HADHB | hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit | |
|
2 | 2 | ||||||
| MIRT530851 | RAG1 | recombination activating 1 | |
|
2 | 4 | ||||||
| MIRT531109 | PEX13 | peroxisomal biogenesis factor 13 | |
|
2 | 2 | ||||||
| MIRT534263 | SLC12A7 | solute carrier family 12 member 7 | |
|
2 | 2 | ||||||
| MIRT534756 | RASGEF1A | RasGEF domain family member 1A | |
|
2 | 2 | ||||||
| MIRT535175 | PLEKHB2 | pleckstrin homology domain containing B2 | |
|
2 | 2 | ||||||
| MIRT535246 | PIGA | phosphatidylinositol glycan anchor biosynthesis class A | |
|
2 | 4 | ||||||
| MIRT535401 | PER1 | period circadian clock 1 | |
|
2 | 2 | ||||||
| MIRT536036 | MCUR1 | mitochondrial calcium uniporter regulator 1 | |
|
2 | 2 | ||||||
| MIRT536347 | LEFTY1 | left-right determination factor 1 | |
|
2 | 2 | ||||||
| MIRT536413 | KREMEN1 | kringle containing transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT536437 | KMT2B | lysine methyltransferase 2B | |
|
2 | 6 | ||||||
| MIRT536604 | IRF2 | interferon regulatory factor 2 | |
|
2 | 2 | ||||||
| MIRT536642 | INO80D | INO80 complex subunit D | |
|
2 | 2 | ||||||
| MIRT536860 | HIVEP2 | human immunodeficiency virus type I enhancer binding protein 2 | |
|
2 | 2 | ||||||
| MIRT537241 | GALNT3 | polypeptide N-acetylgalactosaminyltransferase 3 | |
|
2 | 2 | ||||||
| MIRT537728 | ELAVL2 | ELAV like RNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT537988 | DPP8 | dipeptidyl peptidase 8 | |
|
2 | 2 | ||||||
| MIRT538037 | DNAJB6 | DnaJ heat shock protein family (Hsp40) member B6 | |
|
2 | 2 | ||||||
| MIRT538255 | CUL3 | cullin 3 | |
|
2 | 4 | ||||||
| MIRT538525 | CLCN3 | chloride voltage-gated channel 3 | |
|
2 | 2 | ||||||
| MIRT538659 | CCSAP | centriole, cilia and spindle associated protein | |
|
2 | 2 | ||||||
| MIRT538779 | C7orf60 | base methyltransferase of 25S rRNA 2 homolog | |
|
2 | 4 | ||||||
| MIRT538849 | BTG1 | BTG anti-proliferation factor 1 | |
|
2 | 2 | ||||||
| MIRT538923 | BRI3BP | BRI3 binding protein | |
|
2 | 6 | ||||||
| MIRT539114 | ARL10 | ADP ribosylation factor like GTPase 10 | |
|
2 | 2 | ||||||
| MIRT539454 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | |
|
2 | 2 | ||||||
| MIRT541085 | RLIM | ring finger protein, LIM domain interacting | |
|
2 | 2 | ||||||
| MIRT543117 | SKA2 | spindle and kinetochore associated complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT543181 | FICD | FIC domain containing | |
|
2 | 2 | ||||||
| MIRT543575 | RPF2 | ribosome production factor 2 homolog | |
|
2 | 4 | ||||||
| MIRT544113 | IPMK | inositol polyphosphate multikinase | |
|
2 | 2 | ||||||
| MIRT544625 | CSDE1 | cold shock domain containing E1 | |
|
2 | 2 | ||||||
| MIRT544699 | ZNF224 | zinc finger protein 224 | |
|
2 | 4 | ||||||
| MIRT544992 | MFF | mitochondrial fission factor | |
|
2 | 4 | ||||||
| MIRT546248 | TNFRSF21 | TNF receptor superfamily member 21 | |
|
2 | 2 | ||||||
| MIRT546282 | TMEM30A | transmembrane protein 30A | |
|
2 | 4 | ||||||
| MIRT546290 | TMEM200C | transmembrane protein 200C | |
|
2 | 4 | ||||||
| MIRT546558 | SATB2 | SATB homeobox 2 | |
|
2 | 2 | ||||||
| MIRT546815 | RAP2C | RAP2C, member of RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT547046 | POGZ | pogo transposable element derived with ZNF domain | |
|
2 | 2 | ||||||
| MIRT547474 | MBNL3 | muscleblind like splicing regulator 3 | |
|
2 | 4 | ||||||
| MIRT547761 | KATNAL1 | katanin catalytic subunit A1 like 1 | |
|
2 | 2 | ||||||
| MIRT547892 | HSPA13 | heat shock protein family A (Hsp70) member 13 | |
|
2 | 2 | ||||||
| MIRT548315 | EPHA4 | EPH receptor A4 | |
|
2 | 2 | ||||||
| MIRT548383 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | |
|
2 | 4 | ||||||
| MIRT548460 | EGLN3 | egl-9 family hypoxia inducible factor 3 | |
|
2 | 2 | ||||||
| MIRT548579 | DNAJB14 | DnaJ heat shock protein family (Hsp40) member B14 | |
|
2 | 2 | ||||||
| MIRT548858 | CERCAM | cerebral endothelial cell adhesion molecule | |
|
2 | 2 | ||||||
| MIRT548896 | CHEK2 | checkpoint kinase 2 | |
|
2 | 4 | ||||||
| MIRT549319 | ARHGAP12 | Rho GTPase activating protein 12 | |
|
2 | 4 | ||||||
| MIRT550302 | ZNF681 | zinc finger protein 681 | |
|
2 | 2 | ||||||
| MIRT551120 | ZNF107 | zinc finger protein 107 | |
|
2 | 2 | ||||||
| MIRT551406 | DCTPP1 | dCTP pyrophosphatase 1 | |
|
2 | 2 | ||||||
| MIRT552173 | DAD1 | defender against cell death 1 | |
|
2 | 2 | ||||||
| MIRT552856 | WIPF2 | WAS/WASL interacting protein family member 2 | |
|
2 | 2 | ||||||
| MIRT552892 | WASL | Wiskott-Aldrich syndrome like | |
|
2 | 4 | ||||||
| MIRT553075 | UEVLD | UEV and lactate/malate dehyrogenase domains | |
|
2 | 2 | ||||||
| MIRT553668 | TFAP4 | transcription factor AP-4 | |
|
2 | 4 | ||||||
| MIRT553700 | TCF7L2 | transcription factor 7 like 2 | |
|
2 | 2 | ||||||
| MIRT554608 | RPS6KA5 | ribosomal protein S6 kinase A5 | |
|
2 | 2 | ||||||
| MIRT554860 | RDH11 | retinol dehydrogenase 11 (all-trans/9-cis/11-cis) | |
|
2 | 2 | ||||||
| MIRT556157 | MECP2 | methyl-CpG binding protein 2 | |
|
2 | 2 | ||||||
| MIRT556179 | MCC | mutated in colorectal cancers | |
|
2 | 2 | ||||||
| MIRT556529 | LIN52 | lin-52 DREAM MuvB core complex component | |
|
2 | 2 | ||||||
| MIRT556723 | KLHL21 | kelch like family member 21 | |
|
2 | 4 | ||||||
| MIRT557054 | HOXB3 | homeobox B3 | |
|
2 | 2 | ||||||
| MIRT557587 | GNPTAB | N-acetylglucosamine-1-phosphate transferase alpha and beta subunits | |
|
2 | 2 | ||||||
| MIRT557661 | GATA6 | GATA binding protein 6 | |
|
2 | 2 | ||||||
| MIRT557753 | FRS2 | fibroblast growth factor receptor substrate 2 | |
|
2 | 2 | ||||||
| MIRT557881 | FEM1B | fem-1 homolog B | |
|
2 | 4 | ||||||
| MIRT558215 | EFCAB14 | EF-hand calcium binding domain 14 | |
|
2 | 4 | ||||||
| MIRT558264 | DYNC1LI2 | dynein cytoplasmic 1 light intermediate chain 2 | |
|
2 | 2 | ||||||
| MIRT558327 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | |
|
2 | 4 | ||||||
| MIRT558766 | CFL2 | cofilin 2 | |
|
2 | 2 | ||||||
| MIRT561037 | ASB6 | ankyrin repeat and SOCS box containing 6 | |
|
2 | 2 | ||||||
| MIRT561324 | ZBTB37 | zinc finger and BTB domain containing 37 | |
|
2 | 2 | ||||||
| MIRT561641 | RUNX3 | runt related transcription factor 3 | |
|
2 | 2 | ||||||
| MIRT562555 | CCDC71L | coiled-coil domain containing 71 like | |
|
2 | 4 | ||||||
| MIRT562961 | LRPAP1 | LDL receptor related protein associated protein 1 | |
|
2 | 2 | ||||||
| MIRT564680 | ZNF35 | zinc finger protein 35 | |
|
2 | 2 | ||||||
| MIRT565694 | SESN3 | sestrin 3 | |
|
2 | 2 | ||||||
| MIRT565910 | SCAMP2 | secretory carrier membrane protein 2 | |
|
2 | 2 | ||||||
| MIRT566141 | RACGAP1 | Rac GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT567047 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT567076 | KBTBD2 | kelch repeat and BTB domain containing 2 | |
|
2 | 2 | ||||||
| MIRT567539 | FGFR1OP | FGFR1 oncogene partner | |
|
2 | 2 | ||||||
| MIRT567624 | FAM210A | family with sequence similarity 210 member A | |
|
2 | 2 | ||||||
| MIRT570321 | ZNF70 | zinc finger protein 70 | |
|
2 | 2 | ||||||
| MIRT571759 | PSD3 | pleckstrin and Sec7 domain containing 3 | |
|
2 | 2 | ||||||
| MIRT571857 | NKIRAS1 | NFKB inhibitor interacting Ras like 1 | |
|
2 | 2 | ||||||
| MIRT573372 | LIMA1 | LIM domain and actin binding 1 | |
|
2 | 2 | ||||||
| MIRT574561 | NR2F2 | nuclear receptor subfamily 2 group F member 2 | |
|
2 | 2 | ||||||
| MIRT614729 | ATAT1 | alpha tubulin acetyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT617877 | ESR1 | estrogen receptor 1 | |
|
2 | 2 | ||||||
| MIRT624421 | CBX8 | chromobox 8 | |
|
2 | 2 | ||||||
| MIRT625865 | SLC35C2 | solute carrier family 35 member C2 | |
|
2 | 2 | ||||||
| MIRT630703 | DICER1 | dicer 1, ribonuclease III | |
|
2 | 4 | ||||||
| MIRT632514 | PTPN9 | protein tyrosine phosphatase, non-receptor type 9 | |
|
2 | 2 | ||||||
| MIRT641797 | USP32 | ubiquitin specific peptidase 32 | |
|
2 | 2 | ||||||
| MIRT663625 | SEC23B | Sec23 homolog B, coat complex II component | |
|
2 | 2 | ||||||
| MIRT680135 | ADRBK2 | G protein-coupled receptor kinase 3 | |
|
2 | 2 | ||||||
| MIRT702388 | KLF10 | Kruppel like factor 10 | |
|
2 | 2 | ||||||
| MIRT707830 | TMEM133 | transmembrane protein 133 | |
|
2 | 2 | ||||||
| MIRT708885 | MOCS2 | molybdenum cofactor synthesis 2 | |
|
2 | 2 | ||||||
| MIRT709122 | C3orf18 | chromosome 3 open reading frame 18 | |
|
2 | 2 | ||||||
| MIRT709635 | KBTBD6 | kelch repeat and BTB domain containing 6 | |
|
2 | 2 | ||||||
| MIRT710596 | CDCA4 | cell division cycle associated 4 | |
|
2 | 2 | ||||||
| MIRT710802 | IFNLR1 | interferon lambda receptor 1 | |
|
2 | 2 | ||||||
| MIRT711782 | RFXAP | regulatory factor X associated protein | |
|
2 | 2 | ||||||
| MIRT713344 | KLRD1 | killer cell lectin like receptor D1 | |
|
2 | 2 | ||||||
| MIRT713640 | MED8 | mediator complex subunit 8 | |
|
2 | 2 | ||||||
| MIRT713916 | IGF2R | insulin like growth factor 2 receptor | |
|
2 | 2 | ||||||
| MIRT715068 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | |
|
2 | 2 | ||||||
| MIRT715206 | FKTN | fukutin | |
|
2 | 2 | ||||||
| MIRT717819 | FAM114A1 | family with sequence similarity 114 member A1 | |
|
2 | 2 | ||||||
| MIRT720543 | CHERP | calcium homeostasis endoplasmic reticulum protein | |
|
2 | 2 | ||||||
| MIRT720636 | ELF5 | E74 like ETS transcription factor 5 | |
|
2 | 2 | ||||||
| MIRT721703 | ISY1 | ISY1 splicing factor homolog | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|