>LRIG3|NM_001136051|3'UTR
   1 ACTGAATGAGACCAAAGGAAAAGCTTAACATACTACCTCAAGTGAACTTTTATTTAAAAGAGAGAGAATCTTATGTTTTT
  81 TAAATGGAGTTATGAATTTTAAAAGGATAAAAATGCTTTATTTATACAGATGAACCAAAATTACAAAAAGTTATGAAAAT
 161 TTTTATACTGGGAATGATGCTCATATAAGAATACCTTTTTAAACTATTTTTTAACTTTGTTTTATGCAAAAAAGTATCTT
 241 ACGTAAATTAATGATATAAATCATGATTATTTTATGTATTTTTATAATGCCAGATTTCTTTTTATGGAAAATGAGTTACT
 321 AAAGCATTTTAAATAATACCTGCCTTGTACCATTTTTTAAATAGAAGTTACTTCATTATATTTTGCACATTATATTTAAT
 401 AAAATGTGTCAATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aggACCU--ACGUUUAAAAu 5' |||| | ::|||||| Target 5' aaaTGGAGTTATGAATTTTa 3'	82 - 101	137.00	-6.00

Mutant ID	Mutant Position	Mutant Source
COSN30102476	44	COSMIC
COSN1578179	61	COSMIC
COSN31581343	76	COSMIC
COSN31574480	80	COSMIC
COSN31524925	99	COSMIC
COSN20349866	104	COSMIC
COSN29698329	125	COSMIC
COSN30166589	132	COSMIC
COSN31524932	132	COSMIC
COSN7617462	242	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs11172788	2	dbSNP
rs758609811	9	dbSNP
rs750688300	12	dbSNP
rs1243023772	14	dbSNP
rs374448338	15	dbSNP
rs757310360	17	dbSNP
rs753757308	22	dbSNP
rs759224586	23	dbSNP
rs763950077	25	dbSNP
rs373493932	28	dbSNP
rs1351599928	29	dbSNP
rs1388289324	30	dbSNP
rs1169890146	33	dbSNP
rs760478825	34	dbSNP
rs553285810	36	dbSNP
rs767478421	37	dbSNP
rs1175058041	41	dbSNP
rs376864418	42	dbSNP
rs921580381	42	dbSNP
rs1257283363	47	dbSNP
rs759233561	49	dbSNP
rs534887098	55	dbSNP
rs1258144245	58	dbSNP
rs1044799609	62	dbSNP
rs767553072	68	dbSNP
rs1438518064	71	dbSNP
rs577192576	73	dbSNP
rs1369901537	74	dbSNP
rs1473490030	75	dbSNP
rs965844829	76	dbSNP
rs1320817985	79	dbSNP
rs1383520725	82	dbSNP
rs909644544	85	dbSNP
rs984931446	89	dbSNP
rs528820606	93	dbSNP
rs11172787	104	dbSNP
rs569806057	116	dbSNP
rs1404914075	120	dbSNP
rs1378773334	126	dbSNP
rs951491667	127	dbSNP
rs546262067	131	dbSNP
rs548421701	134	dbSNP
rs1336718329	144	dbSNP
rs1286656855	151	dbSNP
rs966068451	154	dbSNP
rs1176010295	164	dbSNP
rs1025903325	165	dbSNP
rs1452983241	168	dbSNP
rs1482197010	171	dbSNP
rs1199802168	172	dbSNP
rs1019386850	179	dbSNP
rs1483903060	180	dbSNP
rs995734812	182	dbSNP
rs1410722434	183	dbSNP
rs1480574333	185	dbSNP
rs1177527843	191	dbSNP
rs898511317	199	dbSNP
rs1448997020	200	dbSNP
rs1172490351	203	dbSNP
rs986220835	205	dbSNP
rs953435795	207	dbSNP
rs1200891539	212	dbSNP
rs1412029794	213	dbSNP
rs1306597645	217	dbSNP
rs1022356750	219	dbSNP
rs1350042550	219	dbSNP
rs1204689404	238	dbSNP
rs1303766174	242	dbSNP
rs1010657804	243	dbSNP
rs536425979	255	dbSNP
rs1231917124	258	dbSNP
rs1346906981	274	dbSNP
rs1298007095	280	dbSNP
rs1202705525	281	dbSNP
rs577180684	290	dbSNP
rs1250814668	298	dbSNP
rs557029355	307	dbSNP
rs1490391071	308	dbSNP
rs892310828	311	dbSNP
rs1192563825	314	dbSNP
rs1264895969	316	dbSNP
rs1229294661	317	dbSNP
rs1170581030	318	dbSNP
rs1030870955	319	dbSNP
rs896609771	333	dbSNP
rs1432194749	344	dbSNP
rs1167029904	364	dbSNP
rs566067670	370	dbSNP
rs543919046	373	dbSNP
rs547796943	379	dbSNP
rs1365809716	385	dbSNP
rs1056944721	393	dbSNP
rs1298456942	398	dbSNP
rs1396115563	408	dbSNP
rs1367204887	411	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.