miRTarBase - #MIRT066415


—
pre-miRNA Information
pre-miRNA hsa-mir-1185-1   
Genomic Coordinates chr14: 101042977 - 101043062
Synonyms MIRN1185-1, hsa-mir-1185-1, MIR1185-1
Description Homo sapiens miR-1185-1 stem-loop
Comment This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1185-1-3p
Sequence 53| AUAUACAGGGGGAGACUCUUAU |74
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101043033 29233923 MiREDiBase
A-to-I 7 14 + 101043035 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749794228 1 dbSNP
rs369414498 4 dbSNP
rs771096180 5 dbSNP
rs774958411 7 dbSNP
rs1226171972 11 dbSNP
rs1449899083 14 dbSNP
rs761183893 16 dbSNP
rs1380874583 20 dbSNP
rs771625921 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBK1   
Synonyms FTDALS4, NAK, T2K
Description TANK binding kinase 1
Transcript NM_013254   
Expression
Putative miRNA Targets on TBK1
3'UTR of TBK1
(miRNA target sites are highlighted)		 
>TBK1|NM_013254|3'UTR
   1 CTTTCTAATAGAAGTTTAAGAAAAGTTTCCGTTTGCACAAGAAAATAACGCTTGGGCATTAAATGAATGCCTTTATAGAT
  81 AGTCACTTGTTTCTACAATTCAGTATTTGATGTGGTCGTGTAAATATGTACAATATTGTAAATACATAAAAAATATACAA
 161 ATTTTTGGCTGCTGTGAAGATGTAATTTTATCTTTTAACATTTATAATTATATGAGGAAATTTGACCTCAGTGATCACGA
 241 GAAGAAAGCCATGACCGACCAATATGTTGACATACTGATCCTCTACTCTGAGTGGGGCTAAATAAGTTATTTTCTCTGAC
 321 CGCCTACTGGAAATATTTTTAAGTGGAACCAAAATAGGCATCCTTACAAATCAGGAAGACTGACTTGACACGTTTGTAAA
 401 TGGTAGAACGGTGGCTACTGTGAGTGGGGAGCAGAACCGCACCACTGTTATACTGGGATAACAATTTTTTTGAGAAGGAT
 481 AAAGTGGCATTATTTTATTTTACAAGGTGCCCAGATCCCAGTTATCCTTGTATCCATGTAATTTCAGATGAATTATTAAG
 561 CAAACATTTTAAAGTGAATTCATTATTAAAAACTATTCATTTTTTTCCTTTGGCCATAAATGTGTAATTGTCATTAAAAT
 641 TCTAAGGTCATTTCAACTGTTTTAAGCTGTATATTTCTTTAATTCTGCTTACTATTTCATGGAAAAAAATAAATTTCTCA
 721 ATTTTAATGTAAAGAGTTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaUUCUCAGAGGGGGACAUAUa 5'
            ||  ||:|:   ||||||| 
Target 5' tcAACTGTTTTAAGCTGTATAt 3'
 653 - 674 152.00 -9.50
2 
miRNA  3' uauucUCAGAGGGGGACAUAua 5'
               ||| | :||:|||||  
Target 5' atcccAGT-TATCCTTGTATcc 3'
 515 - 535 124.00 -10.70
3 
miRNA  3' uauUCUCAGAG-GGGGAC-AUAUa 5'
             |||  | | || ||| |||| 
Target 5' agcAGAACCGCACCACTGTTATAc 3'
 430 - 453 123.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30132774 25 COSMIC
COSN30478905 30 COSMIC
COSN26998030 32 COSMIC
COSN19667979 42 COSMIC
COSN18737226 51 COSMIC
COSN30165692 56 COSMIC
COSN30147170 66 COSMIC
COSN30485590 72 COSMIC
COSN31518759 131 COSMIC
COSN30180890 147 COSMIC
COSN31487253 317 COSMIC
COSN5949626 365 COSMIC
COSN30539047 507 COSMIC
COSN31515007 563 COSMIC
COSN30173731 608 COSMIC
COSN30173582 655 COSMIC
COSN15692872 656 COSMIC
COSN30164140 656 COSMIC
COSN20109774 674 COSMIC
COSN21949735 699 COSMIC
COSN31487232 720 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1158171722 1 dbSNP
rs948691211 2 dbSNP
rs759205309 3 dbSNP
rs1442828863 4 dbSNP
rs1443794808 8 dbSNP
rs1044387018 9 dbSNP
rs1366798002 12 dbSNP
rs1384832475 13 dbSNP
rs201408461 14 dbSNP
rs909900216 17 dbSNP
rs1040750761 18 dbSNP
rs752428546 19 dbSNP
rs759279413 20 dbSNP
rs777425295 23 dbSNP
rs1248569357 26 dbSNP
rs1267900086 29 dbSNP
rs1419934044 31 dbSNP
rs760335307 31 dbSNP
rs200639097 32 dbSNP
rs757322300 34 dbSNP
rs1292042204 39 dbSNP
rs1247783500 41 dbSNP
rs41292029 42 dbSNP
rs1488421952 43 dbSNP
rs1333645527 49 dbSNP
rs377729542 50 dbSNP
rs768072937 50 dbSNP
rs1043545690 51 dbSNP
rs1391472264 61 dbSNP
rs1375367573 64 dbSNP
rs1301281404 70 dbSNP
rs1423763311 71 dbSNP
rs1050809456 77 dbSNP
rs1164425685 77 dbSNP
rs763115028 81 dbSNP
rs1362312846 86 dbSNP
rs1158388924 88 dbSNP
rs1419757129 95 dbSNP
rs1254572774 111 dbSNP
rs1001946978 112 dbSNP
rs889553616 115 dbSNP
rs1007081472 116 dbSNP
rs1021958554 118 dbSNP
rs546050408 119 dbSNP
rs1033415399 129 dbSNP
rs1259799218 135 dbSNP
rs1239123284 138 dbSNP
rs1318270830 141 dbSNP
rs1281268611 143 dbSNP
rs1381018828 147 dbSNP
rs896168740 149 dbSNP
rs1346095820 154 dbSNP
rs1013264075 157 dbSNP
rs376089824 161 dbSNP
rs1380316538 162 dbSNP
rs903551602 169 dbSNP
rs1336571946 177 dbSNP
rs1158267126 186 dbSNP
rs1454368301 201 dbSNP
rs1414330836 205 dbSNP
rs1000418016 212 dbSNP
rs1232930506 213 dbSNP
rs1291707296 216 dbSNP
rs1201392517 230 dbSNP
rs1031886195 238 dbSNP
rs559269116 239 dbSNP
rs528257070 240 dbSNP
rs1229150612 252 dbSNP
rs992968929 253 dbSNP
rs972302153 257 dbSNP
rs1024454385 258 dbSNP
rs1203256583 260 dbSNP
rs1027864886 261 dbSNP
rs1324101624 262 dbSNP
rs970095691 263 dbSNP
rs541191846 265 dbSNP
rs910651419 270 dbSNP
rs944766541 273 dbSNP
rs980635200 284 dbSNP
rs909878345 286 dbSNP
rs1334706227 288 dbSNP
rs1469368015 294 dbSNP
rs1407463447 302 dbSNP
rs1174899961 309 dbSNP
rs1473361686 310 dbSNP
rs945327194 314 dbSNP
rs941367673 322 dbSNP
rs972639475 323 dbSNP
rs937832381 336 dbSNP
rs1461424398 339 dbSNP
rs1280644617 347 dbSNP
rs1194043665 351 dbSNP
rs767370266 354 dbSNP
rs918526534 356 dbSNP
rs1367549390 368 dbSNP
rs1013713731 385 dbSNP
rs14090 393 dbSNP
rs1406978717 394 dbSNP
rs1414603130 395 dbSNP
rs1336697073 408 dbSNP
rs1408664285 410 dbSNP
rs1050903047 411 dbSNP
rs530047586 414 dbSNP
rs1168785489 415 dbSNP
rs1432028346 420 dbSNP
rs1311426264 425 dbSNP
rs549753254 439 dbSNP
rs371108229 440 dbSNP
rs1444681112 444 dbSNP
rs1392109096 448 dbSNP
rs1238750515 452 dbSNP
rs1306397237 456 dbSNP
rs575630029 465 dbSNP
rs942457528 465 dbSNP
rs1315158494 478 dbSNP
rs1289827597 480 dbSNP
rs182670869 485 dbSNP
rs1236834648 487 dbSNP
rs1043875011 496 dbSNP
rs760336024 502 dbSNP
rs999615134 513 dbSNP
rs1348479491 517 dbSNP
rs187328557 518 dbSNP
rs1440114810 520 dbSNP
rs532646066 525 dbSNP
rs892033435 530 dbSNP
rs1277920771 536 dbSNP
rs1412060008 540 dbSNP
rs1014482245 546 dbSNP
rs1162508014 547 dbSNP
rs1424846583 559 dbSNP
rs1415517385 562 dbSNP
rs763833378 563 dbSNP
rs552388613 564 dbSNP
rs74504898 574 dbSNP
rs1177374825 593 dbSNP
rs1184314572 594 dbSNP
rs1249245712 597 dbSNP
rs970666354 607 dbSNP
rs753347770 613 dbSNP
rs142422346 622 dbSNP
rs1396268425 625 dbSNP
rs1322481372 633 dbSNP
rs913945341 643 dbSNP
rs758386634 645 dbSNP
rs779330208 656 dbSNP
rs1412277589 657 dbSNP
rs1344195202 664 dbSNP
rs1302856569 665 dbSNP
rs1437647449 670 dbSNP
rs34194131 670 dbSNP
rs35517559 670 dbSNP
rs869036118 670 dbSNP
rs199833264 672 dbSNP
rs71092974 673 dbSNP
rs925217279 674 dbSNP
rs1297785985 679 dbSNP
rs1408145531 683 dbSNP
rs1160776808 695 dbSNP
rs1479394099 703 dbSNP
rs1371421273 711 dbSNP
rs1428519940 722 dbSNP
rs937907664 731 dbSNP
rs972742061 734 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uauucucagaggggGACAUAUa 5'
                        ||||||| 
Target 5' ---------uuaagCUGUAUAu 3'
 		1 - 13
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29110.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000331710.5 | 3UTR | UUAAGCUGUAUAUUUCUUUAAUUCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000331710.5 | 3UTR | UUAAGCUGUAUAUUUCUUUAAUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000331710.5 | 3UTR | UUAAGCUGUAUAUUUCUUUAAUUCUGCUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
114 hsa-miR-1185-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066415 TBK1 TANK binding kinase 1 2 4
MIRT073567 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT074516 USP1 ubiquitin specific peptidase 1 2 4
MIRT080576 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT086539 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086547 MOB4 MOB family member 4, phocein 2 2
MIRT088684 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT090811 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT095500 PURA purine rich element binding protein A 2 2
MIRT109530 KLHL15 kelch like family member 15 2 6
MIRT109807 ZFX zinc finger protein, X-linked 2 2
MIRT117888 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT120273 GSK3B glycogen synthase kinase 3 beta 2 4
MIRT149892 LDLR low density lipoprotein receptor 2 2
MIRT178475 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT193445 RORA RAR related orphan receptor A 2 2
MIRT198527 DSG2 desmoglein 2 2 2
MIRT226427 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT227669 SET SET nuclear proto-oncogene 2 2
MIRT320405 HOXA9 homeobox A9 2 2
MIRT407774 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT439228 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT439312 VAT1L vesicle amine transport 1 like 1 1
MIRT439421 TMOD1 tropomodulin 1 1 1
MIRT439446 TMEM104 transmembrane protein 104 1 1
MIRT439524 STIM2 stromal interaction molecule 2 1 1
MIRT439612 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT439997 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440017 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT440131 NCOA4 nuclear receptor coactivator 4 1 1
MIRT440311 LRRC1 leucine rich repeat containing 1 1 1
MIRT440475 IAPP islet amyloid polypeptide 1 1
MIRT440511 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440617 FOXA2 forkhead box A2 1 1
MIRT440666 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440705 ERO1LB endoplasmic reticulum oxidoreductase 1 beta 1 1
MIRT441007 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441018 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT441062 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT441209 ARCN1 archain 1 1 1
MIRT449461 HAT1 histone acetyltransferase 1 2 2
MIRT467104 SRI sorcin 2 2
MIRT468060 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT468476 SESN3 sestrin 3 2 4
MIRT473533 MAX MYC associated factor X 2 2
MIRT473852 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474711 KIF13A kinesin family member 13A 2 6
MIRT481665 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT485120 SF3B3 splicing factor 3b subunit 3 2 2
MIRT493055 MTFR1 mitochondrial fission regulator 1 2 2
MIRT504258 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504361 ARID1B AT-rich interaction domain 1B 2 4
MIRT505748 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT506298 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT508442 ZNF608 zinc finger protein 608 2 4
MIRT512782 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT520447 TSPAN2 tetraspanin 2 2 4
MIRT522133 NRBF2 nuclear receptor binding factor 2 2 6
MIRT522395 MYADM myeloid associated differentiation marker 2 4
MIRT523397 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523938 E2F8 E2F transcription factor 8 2 4
MIRT524349 CREB1 cAMP responsive element binding protein 1 2 2
MIRT524711 BRMS1L breast cancer metastasis-suppressor 1 like 2 4
MIRT525134 ZNF256 zinc finger protein 256 2 2
MIRT525710 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT531264 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT538844 BTG1 BTG anti-proliferation factor 1 2 2
MIRT541366 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT542093 KCNK10 potassium two pore domain channel subfamily K member 10 2 6
MIRT543770 RBM12B RNA binding motif protein 12B 2 4
MIRT543940 NCOA7 nuclear receptor coactivator 7 2 2
MIRT545150 GABRG1 gamma-aminobutyric acid type A receptor gamma1 subunit 2 2
MIRT545842 ZNF264 zinc finger protein 264 2 4
MIRT548057 GOLGA7 golgin A7 2 2
MIRT549242 ATXN1L ataxin 1 like 2 4
MIRT551829 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT552484 ZNF136 zinc finger protein 136 2 2
MIRT553663 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT554988 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555760 PCTP phosphatidylcholine transfer protein 2 2
MIRT556923 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT564991 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT566458 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT566538 PANK3 pantothenate kinase 3 2 2
MIRT567732 DLX2 distal-less homeobox 2 2 2
MIRT570081 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 2
MIRT571735 RNF11 ring finger protein 11 2 2
MIRT573529 MDM2 MDM2 proto-oncogene 2 2
MIRT574459 RPS16 ribosomal protein S16 2 2
MIRT574992 Phka1 phosphorylase kinase alpha 1 2 3
MIRT576349 Pxdn peroxidasin 2 2
MIRT610196 CD99 CD99 molecule (Xg blood group) 2 4
MIRT612920 GPRIN3 GPRIN family member 3 2 2
MIRT615021 DUSP6 dual specificity phosphatase 6 2 2
MIRT623573 IRS1 insulin receptor substrate 1 2 2
MIRT624437 CASD1 CAS1 domain containing 1 2 2
MIRT628714 ZNF585A zinc finger protein 585A 2 2
MIRT639565 PCK1 phosphoenolpyruvate carboxykinase 1 2 4
MIRT641485 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT641657 PAPOLG poly(A) polymerase gamma 2 2
MIRT642210 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT653010 STX7 syntaxin 7 2 2
MIRT656130 MSH6 mutS homolog 6 2 2
MIRT656893 KIAA2018 upstream transcription factor family member 3 2 2
MIRT660130 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT660855 AFAP1 actin filament associated protein 1 2 2
MIRT676843 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 3
MIRT681473 DIP2A disco interacting protein 2 homolog A 2 2
MIRT682253 RS1 retinoschisin 1 2 2
MIRT694296 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT694401 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
MIRT705277 BACH1 BTB domain and CNC homolog 1 2 2
MIRT720833 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT735713 SIRT1 sirtuin 1 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-1185-1-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1185-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1185-1-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission