pre-miRNA Information
pre-miRNA hsa-mir-144   
Genomic Coordinates chr17: 28861533 - 28861618
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs947719319 4 dbSNP
rs917554219 5 dbSNP
rs1218721253 6 dbSNP
rs760366230 9 dbSNP
rs1293385306 15 dbSNP
rs1463482751 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCT2   
Synonyms 99D8.1, CCT-beta, CCTB, HEL-S-100n, PRO1633, TCP-1-beta
Description chaperonin containing TCP1 subunit 2
Transcript NM_006431   
Expression
Putative miRNA Targets on CCT2
3'UTR of CCT2
(miRNA target sites are highlighted)
>CCT2|NM_006431|3'UTR
   1 GCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTG
  81 GAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATT
 161 TGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAAC
 241 AATTACTTGGTTAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucAUGUAGUAGA-UAUGACAu 5'
            | |||: ||| ||||||| 
Target 5' agTTCATT-TCTCATACTGTg 3'
200 - 219 157.00 -13.30
2
miRNA  3' ucaUGUAGUAG-AUAUGACAu 5'
             :|||:  |  :|:|||| 
Target 5' ---GCATTCCCACGTGCTGTc 3'
1 - 18 113.00 -5.90
3
miRNA  3' ucAUGUAGUAG----AUAUGACAu 5'
            |||  :||:     | ||||| 
Target 5' gaTACTCTATTAAAGAAGACTGTg 3'
57 - 80 112.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30086857 11 COSMIC
COSN30575640 12 COSMIC
COSN30105489 41 COSMIC
COSN30106117 54 COSMIC
COSN30540457 75 COSMIC
COSN30133638 166 COSMIC
COSN19658526 169 COSMIC
COSN8586602 197 COSMIC
COSN31571402 235 COSMIC
COSN28801225 243 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs113199707 2 dbSNP
rs1235324090 2 dbSNP
rs751365773 10 dbSNP
rs372245852 11 dbSNP
rs202070849 12 dbSNP
rs11541106 19 dbSNP
rs769828000 20 dbSNP
rs189188802 23 dbSNP
rs1301080522 26 dbSNP
rs749846279 30 dbSNP
rs1242631170 33 dbSNP
rs774579072 37 dbSNP
rs1353009698 41 dbSNP
rs746181374 42 dbSNP
rs368292476 45 dbSNP
rs373408454 46 dbSNP
rs553344506 48 dbSNP
rs761524040 49 dbSNP
rs376151663 50 dbSNP
rs762330653 61 dbSNP
rs772834774 62 dbSNP
rs572546075 66 dbSNP
rs1259438887 68 dbSNP
rs766273143 72 dbSNP
rs867000966 75 dbSNP
rs751327227 77 dbSNP
rs1456881503 78 dbSNP
rs906621409 79 dbSNP
rs1293267978 80 dbSNP
rs1005410188 90 dbSNP
rs545262108 92 dbSNP
rs760420977 94 dbSNP
rs1013956616 95 dbSNP
rs190694264 100 dbSNP
rs752960445 101 dbSNP
rs899183424 103 dbSNP
rs756311009 105 dbSNP
rs1315000518 109 dbSNP
rs1319823882 114 dbSNP
rs777891722 116 dbSNP
rs749319191 117 dbSNP
rs994833797 120 dbSNP
rs1295433527 122 dbSNP
rs1217371107 123 dbSNP
rs905821341 128 dbSNP
rs1312933355 132 dbSNP
rs1413696306 133 dbSNP
rs1399602465 135 dbSNP
rs183030818 136 dbSNP
rs542682396 137 dbSNP
rs746247590 138 dbSNP
rs1461535679 139 dbSNP
rs957461602 140 dbSNP
rs764754417 144 dbSNP
rs1188745733 145 dbSNP
rs772752640 146 dbSNP
rs1422754946 147 dbSNP
rs1254273643 149 dbSNP
rs1164626329 150 dbSNP
rs1424980344 152 dbSNP
rs1197801445 154 dbSNP
rs747866522 165 dbSNP
rs187932920 166 dbSNP
rs7200 169 dbSNP
rs762468705 177 dbSNP
rs1453706105 178 dbSNP
rs936349510 180 dbSNP
rs987418518 182 dbSNP
rs1294508628 188 dbSNP
rs1314942242 191 dbSNP
rs35900139 195 dbSNP
rs1435695216 196 dbSNP
rs1281225127 200 dbSNP
rs1343752062 206 dbSNP
rs1338203416 213 dbSNP
rs1308630112 221 dbSNP
rs10506567 222 dbSNP
rs1395371672 233 dbSNP
rs756660861 236 dbSNP
rs1329033333 239 dbSNP
rs3177122 243 dbSNP
rs973727429 244 dbSNP
rs1339025122 245 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10576.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000299300.6 | 3UTR | UUCAUUUCUCAUACUGUGCAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000299300.6 | 3UTR | UUCAUUUCUCAUACUGUGCAUUAAAAUAAAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000299300.6 | 3UTR | UUCAUUUCUCAUACUGUGCAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000299300.6 | 3UTR | UCAUUUCUCAUACUGUGCAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000299300.6 | 3UTR | UUCAUUUCUCAUACUGUGCAUUAAAAUAAAAAUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.639 9.4e-3 0.549 2.6e-2 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.517 9.8e-3 0.693 3.5e-4 20 Click to see details
GSE14794 Lymphoblastoid cells -0.236 1.3e-2 -0.271 4.9e-3 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.465 1.9e-2 -0.254 1.4e-1 20 Click to see details
GSE19536 Breast cancer -0.155 6.2e-2 -0.264 4.0e-3 100 Click to see details
GSE28544 Breast cancer -0.265 1.1e-1 -0.422 2.0e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.258 1.1e-1 0.211 1.6e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.362 1.2e-1 0.399 9.9e-2 12 Click to see details
GSE38226 Liver fibrosis -0.248 1.4e-1 -0.525 7.3e-3 21 Click to see details
GSE27834 Pluripotent stem cells -0.261 1.6e-1 -0.038 4.4e-1 16 Click to see details
GSE21849 B cell lymphoma -0.122 2.6e-1 0.116 2.7e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.113 3.0e-1 0.414 2.0e-2 25 Click to see details
GSE17498 Multiple myeloma 0.084 3.0e-1 0.023 4.4e-1 40 Click to see details
GSE17306 Multiple myeloma -0.06 3.4e-1 0.203 8.1e-2 49 Click to see details
GSE21032 Prostate cancer 0.045 3.4e-1 -0.015 4.5e-1 83 Click to see details
GSE19783 ER- ER- breast cancer -0.042 3.6e-1 -0.102 1.9e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.073 3.6e-1 0.184 1.9e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.034 3.9e-1 -0.112 1.9e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.143 4.1e-1 -0.100 4.4e-1 5 Click to see details
GSE32688 Pancreatic cancer 0.038 4.2e-1 -0.036 4.2e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.013 4.8e-1 -0.015 4.7e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.234 0.03 -0.195 0.06 68 Click to see details
LUSC -0.278 0.05 -0.252 0.06 38 Click to see details
PRAD -0.218 0.07 -0.204 0.08 48 Click to see details
BLCA 0.372 0.08 0.332 0.1 16 Click to see details
UCEC 0.31 0.11 0.284 0.13 18 Click to see details
PCPG -0.823 0.19 -0.500 0.33 3 Click to see details
THCA -0.112 0.2 -0.110 0.2 59 Click to see details
LIHC -0.104 0.24 -0.106 0.23 49 Click to see details
STAD -0.117 0.26 -0.070 0.35 32 Click to see details
CHOL 0.243 0.26 -0.083 0.42 9 Click to see details
KIRP 0.109 0.28 0.040 0.41 32 Click to see details
PAAD 0.445 0.28 0.200 0.4 4 Click to see details
ESCA -0.16 0.32 -0.091 0.4 11 Click to see details
KICH 0.079 0.35 0.212 0.15 25 Click to see details
LUAD -0.104 0.37 -0.098 0.38 12 Click to see details
HNSC 0.044 0.39 0.154 0.17 42 Click to see details
CESC -0.25 0.42 -0.500 0.33 3 Click to see details
BRCA -0.018 0.44 0.002 0.49 74 Click to see details
BRCA -0.018 0.44 0.002 0.49 74 Click to see details
BRCA -0.018 0.44 0.002 0.49 74 Click to see details
204 hsa-miR-144-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 PLAG1 zinc finger 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor beta 1 4 1
MIRT006872 MTOR mechanistic target of rapamycin kinase 7 3
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor, erythroid 2 like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 6 5
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT066720 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT066784 ARID1A AT-rich interaction domain 1A 2 2
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT068846 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT069657 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT071717 CCNK cyclin K 2 2
MIRT073564 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT080720 ZCCHC2 zinc finger CCHC-type containing 2 2 4
MIRT090617 PLS1 plastin 1 2 2
MIRT097062 TNPO1 transportin 1 2 4
MIRT102618 UBN2 ubinuclein 2 2 4
MIRT118769 FAM217B family with sequence similarity 217 member B 2 6
MIRT147282 KPNA2 karyopherin subunit alpha 2 2 10
MIRT159513 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT196438 TAOK1 TAO kinase 1 2 2
MIRT211238 FGF2 fibroblast growth factor 2 2 2
MIRT220422 MKLN1 muskelin 1 2 2
MIRT223668 FZD6 frizzled class receptor 6 2 6
MIRT223805 OXR1 oxidation resistance 1 2 2
MIRT238585 NLN neurolysin 2 2
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT247188 BTG2 BTG anti-proliferation factor 2 2 6
MIRT249185 AKIRIN1 akirin 1 2 8
MIRT252653 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT305624 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT315671 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 6
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT403294 ZNF207 zinc finger protein 207 2 2
MIRT405966 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT437437 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 1
MIRT438343 MET MET proto-oncogene, receptor tyrosine kinase 5 1
MIRT444395 ZNF480 zinc finger protein 480 2 2
MIRT445255 SEMA5A semaphorin 5A 2 2
MIRT445309 MLANA melan-A 2 2
MIRT449020 ANKRD12 ankyrin repeat domain 12 2 2
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT459438 PPIC peptidylprolyl isomerase C 2 2
MIRT460471 MMS22L MMS22 like, DNA repair protein 2 2
MIRT461294 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT462948 ZNF800 zinc finger protein 800 2 12
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT463846 WRN Werner syndrome RecQ like helicase 2 2
MIRT466183 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466882 STX16 syntaxin 16 2 2
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468259 SFXN4 sideroflexin 4 2 2
MIRT469660 RAC1 Rac family small GTPase 1 2 10
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT470552 COASY Coenzyme A synthase 2 2
MIRT472208 NGFRAP1 brain expressed X-linked 3 2 4
MIRT472555 NACC1 nucleus accumbens associated 1 2 4
MIRT473462 MCL1 MCL1, BCL2 family apoptosis regulator 2 2
MIRT473925 LYSMD3 LysM domain containing 3 2 4
MIRT474068 LMNB2 lamin B2 2 2
MIRT475079 ITSN2 intersectin 2 2 4
MIRT475286 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT477516 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478464 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478920 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479338 CERK ceramide kinase 2 2
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480915 BCL2L11 BCL2 like 11 4 3
MIRT481532 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT481724 APPBP2 amyloid beta precursor protein binding protein 2 2 6
MIRT481938 ANKRD11 ankyrin repeat domain 11 2 12
MIRT487099 C2orf44 WD repeat and coiled coil containing 2 2
MIRT489294 RBM8A RNA binding motif protein 8A 2 8
MIRT492255 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT494770 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT496257 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497713 ZNF645 zinc finger protein 645 2 2
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT499292 TSPYL1 TSPY like 1 2 2
MIRT500105 SLC46A3 solute carrier family 46 member 3 2 2
MIRT501020 SPATA2 spermatogenesis associated 2 2 6
MIRT501816 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502296 GNG12 G protein subunit gamma 12 2 6
MIRT502493 FAM122B family with sequence similarity 122B 2 8
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT504266 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504370 ARID1B AT-rich interaction domain 1B 2 6
MIRT505125 YOD1 YOD1 deubiquitinase 2 4
MIRT506052 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT506481 MYO5A myosin VA 2 6
MIRT506967 HOXA10 homeobox A10 2 6
MIRT507728 CLIC4 chloride intracellular channel 4 2 4
MIRT513081 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513570 FKBP14 FK506 binding protein 14 2 2
MIRT513631 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513692 RNF111 ring finger protein 111 2 2
MIRT513764 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT520786 TBX18 T-box 18 2 4
MIRT523402 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT527750 NANOGNB NANOG neighbor homeobox 2 2
MIRT532823 ZNF827 zinc finger protein 827 2 2
MIRT534603 RORA RAR related orphan receptor A 2 2
MIRT535762 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536346 LEFTY1 left-right determination factor 1 2 2
MIRT543081 APP amyloid beta precursor protein 2 2
MIRT544064 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545424 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT546324 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547539 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548062 GOLGA7 golgin A7 2 2
MIRT549248 ATXN1L ataxin 1 like 2 4
MIRT549250 ATXN1 ataxin 1 2 2
MIRT549467 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549937 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT551489 TMEM192 transmembrane protein 192 2 4
MIRT552564 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553688 TFAP4 transcription factor AP-4 2 4
MIRT553951 STAMBP STAM binding protein 2 2
MIRT554163 SLC7A2 solute carrier family 7 member 2 2 4
MIRT554477 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555003 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555109 PURB purine rich element binding protein B 2 2
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555535 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556092 MORC3 MORC family CW-type zinc finger 3 2 2
MIRT556571 LIFR LIF receptor alpha 2 2
MIRT556936 INO80D INO80 complex subunit D 2 4
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT558368 DIDO1 death inducer-obliterator 1 2 4
MIRT558464 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT559236 BICD2 BICD cargo adaptor 2 2 4
MIRT560099 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560725 ZNF749 zinc finger protein 749 2 2
MIRT561142 SPAG1 sperm associated antigen 1 2 2
MIRT561721 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562484 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT562681 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565068 USP25 ubiquitin specific peptidase 25 2 2
MIRT565184 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565946 RREB1 ras responsive element binding protein 1 2 2
MIRT566315 POU2F1 POU class 2 homeobox 1 2 2
MIRT566435 PHF3 PHD finger protein 3 2 2
MIRT566485 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566612 NR3C1 nuclear receptor subfamily 3 group C member 1 4 2
MIRT566761 MOB4 MOB family member 4, phocein 2 2
MIRT566867 LRRC1 leucine rich repeat containing 1 2 2
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT567245 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT570705 FAM69A family with sequence similarity 69 member A 2 2
MIRT570931 ZNF284 zinc finger protein 284 2 2
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT571647 SIX4 SIX homeobox 4 2 2
MIRT574274 ZNF350 zinc finger protein 350 2 2
MIRT574304 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT574843 CADM1 cell adhesion molecule 1 2 2
MIRT608128 TSC22D2 TSC22 domain family member 2 2 2
MIRT648849 WNT7A Wnt family member 7A 2 2
MIRT687559 MLEC malectin 2 2
MIRT696548 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701146 PANK1 pantothenate kinase 1 2 2
MIRT704284 DENND5B DENN domain containing 5B 2 2
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT707687 GPR50 G protein-coupled receptor 50 2 2
MIRT707810 TSPAN6 tetraspanin 6 2 2
MIRT710019 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712705 TEX9 testis expressed 9 2 2
MIRT731264 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT731606 SMAD4 SMAD family member 4 1 1
MIRT731688 MAP3K8 mitogen-activated protein kinase kinase kinase 8 3 1
MIRT731796 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT731798 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT732183 PTGS2 prostaglandin-endoperoxide synthase 2 3 1
MIRT732711 ADAM10 ADAM metallopeptidase domain 10 4 0
MIRT732936 HGF hepatocyte growth factor 1 0
MIRT733214 TLR2 toll like receptor 2 2 0
MIRT734500 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
MIRT734637 RPE ribulose-5-phosphate-3-epimerase 2 0
MIRT735650 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 0
MIRT736975 BCL6 B-cell CLL/lymphoma 6 3 0
MIRT737058 FBXW7 F-box and WD repeat domain containing 7 3 0
MIRT737435 CLK3 CDC like kinase 3 2 0
MIRT755765 FOXO1 forkhead box O1 3 1
MIRT755949 ONECUT2 one cut homeobox 2 7 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-144 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-144 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-144 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-144 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-144 XMD8-92 NULL 46843772 Microarray pancreatic ductal adenocarcinoma cell 24880079 2014 up-regulated
miR-144 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-144 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-144 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-144 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-144 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-144 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-144 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-144-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-144-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229, U251, LN18)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Prostate Cancer tissue and cell line (PC-3, LNCap)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved resistant Low Cervical Cancer tissue
hsa-miR-144-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (SN12-PM6, 786-O)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Anaplastic Thyroid Cancer tissue
hsa-miR-144-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-144-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma cell line (SH-SY5Y, SK-N-SH)
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Neuroblastoma cell line (SK-N-SH, IMR-32)
hsa-miR-144-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-144-3p Pazopanib 10113978 NSC752782 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-144-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-144-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-144-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission