>CCT2|NM_006431|3'UTR
   1 GCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTG
  81 GAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATT
 161 TGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAAC
 241 AATTACTTGGTTAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' caAUAUCUAGACCUAAACUUg 5' || | || ||||||| Target 5' atTA-AAATAAAAATTTGAAc 3'	221 - 240	142.00	-6.30
2	miRNA 3' caAUAUC---UAGACCUAAACUUg 5' | ||| | :|| :|||||| Target 5' ttTCTAGCAAAGTTGTGTTTGAAa 3'	33 - 56	139.00	-5.90
3	miRNA 3' caAUAUCUAGACCUAAACUUg 5' |||| :| :||||:| Target 5' atTATATCCTTAAGTTTGGAt 3'	101 - 121	119.00	-5.72

Mutant ID	Mutant Position	Mutant Source
COSN30086857	11	COSMIC
COSN30575640	12	COSMIC
COSN30105489	41	COSMIC
COSN30106117	54	COSMIC
COSN30540457	75	COSMIC
COSN30133638	166	COSMIC
COSN19658526	169	COSMIC
COSN8586602	197	COSMIC
COSN31571402	235	COSMIC
COSN28801225	243	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs113199707	2	dbSNP
rs1235324090	2	dbSNP
rs751365773	10	dbSNP
rs372245852	11	dbSNP
rs202070849	12	dbSNP
rs11541106	19	dbSNP
rs769828000	20	dbSNP
rs189188802	23	dbSNP
rs1301080522	26	dbSNP
rs749846279	30	dbSNP
rs1242631170	33	dbSNP
rs774579072	37	dbSNP
rs1353009698	41	dbSNP
rs746181374	42	dbSNP
rs368292476	45	dbSNP
rs373408454	46	dbSNP
rs553344506	48	dbSNP
rs761524040	49	dbSNP
rs376151663	50	dbSNP
rs762330653	61	dbSNP
rs772834774	62	dbSNP
rs572546075	66	dbSNP
rs1259438887	68	dbSNP
rs766273143	72	dbSNP
rs867000966	75	dbSNP
rs751327227	77	dbSNP
rs1456881503	78	dbSNP
rs906621409	79	dbSNP
rs1293267978	80	dbSNP
rs1005410188	90	dbSNP
rs545262108	92	dbSNP
rs760420977	94	dbSNP
rs1013956616	95	dbSNP
rs190694264	100	dbSNP
rs752960445	101	dbSNP
rs899183424	103	dbSNP
rs756311009	105	dbSNP
rs1315000518	109	dbSNP
rs1319823882	114	dbSNP
rs777891722	116	dbSNP
rs749319191	117	dbSNP
rs994833797	120	dbSNP
rs1295433527	122	dbSNP
rs1217371107	123	dbSNP
rs905821341	128	dbSNP
rs1312933355	132	dbSNP
rs1413696306	133	dbSNP
rs1399602465	135	dbSNP
rs183030818	136	dbSNP
rs542682396	137	dbSNP
rs746247590	138	dbSNP
rs1461535679	139	dbSNP
rs957461602	140	dbSNP
rs764754417	144	dbSNP
rs1188745733	145	dbSNP
rs772752640	146	dbSNP
rs1422754946	147	dbSNP
rs1254273643	149	dbSNP
rs1164626329	150	dbSNP
rs1424980344	152	dbSNP
rs1197801445	154	dbSNP
rs747866522	165	dbSNP
rs187932920	166	dbSNP
rs7200	169	dbSNP
rs762468705	177	dbSNP
rs1453706105	178	dbSNP
rs936349510	180	dbSNP
rs987418518	182	dbSNP
rs1294508628	188	dbSNP
rs1314942242	191	dbSNP
rs35900139	195	dbSNP
rs1435695216	196	dbSNP
rs1281225127	200	dbSNP
rs1343752062	206	dbSNP
rs1338203416	213	dbSNP
rs1308630112	221	dbSNP
rs10506567	222	dbSNP
rs1395371672	233	dbSNP
rs756660861	236	dbSNP
rs1329033333	239	dbSNP
rs3177122	243	dbSNP
rs973727429	244	dbSNP
rs1339025122	245	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.