miRTarBase - #MIRT066784


—
pre-miRNA Information
pre-miRNA hsa-mir-144   
Genomic Coordinates chr17: 28861533 - 28861618
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs947719319 4 dbSNP
rs917554219 5 dbSNP
rs1218721253 6 dbSNP
rs760366230 9 dbSNP
rs1293385306 15 dbSNP
rs1463482751 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARID1A   
Synonyms B120, BAF250, BAF250a, BM029, C1orf4, CSS2, ELD, MRD14, OSA1, P270, SMARCF1, hELD, hOSA1
Description AT-rich interaction domain 1A
Transcript NM_006015   
Other Transcripts NM_139135   
Expression
Putative miRNA Targets on ARID1A
3'UTR of ARID1A
(miRNA target sites are highlighted)		 
>ARID1A|NM_006015|3'UTR
   1 CAGCCGTGGGACACCTCCCCCCCCCGTGTGTGTGTGCGTGTGTGGAGAACTTAGAAACTGACTGTTGCCCTTTATTTATG
  81 CAAAACCACCTCAGAATCCAGTTTACCCTGTGCTGTCCAGCTTCTCCCTTGGGAAAAAGTCTCTCCTGTTTCTCTCTCCT
 161 CCTTCCACCTCCCCTCCCTCCATCACCTCACGCCTTTCTGTTCCTTGTCCTCACCTTACTCCCCTCAGGACCCTACCCCA
 241 CCCTCTTTGAAAAGACAAAGCTCTGCCTACATAGAAGACTTTTTTTATTTTAACCAAAGTTACTGTTGTTTACAGTGAGT
 321 TTGGGGAAAAAAAATAAAATAAAAATGGCTTTCCCAGTCCTTGCATCAACGGGATGCCACATTTCATAACTGTTTTTAAT
 401 GGTAAAAAAAAAAAAAAAAAATACAAAAAAAAATTCTGAAGGACAAAAAAGGTGACTGCTGAACTGTGTGTGGTTTATTG
 481 TTGTACATTCACAATCTTGCAGGAGCCAAGAAGTTCGCAGTTGTGAACAGACCCTGTTCACTGGAGAGGCCTGTGCAGTA
 561 GAGTGTAGACCCTTTCATGTACTGTACTGTACACCTGATACTGTAAACATACTGTAATAATAATGTCTCACATGGAAACA
 641 GAAAACGCTGGGTCAGCAGCAAGCTGTAGTTTTTAAAAATGTTTTTAGTTAAACGTTGAGGAGAAAAAAAAAAAAGGCTT
 721 TTCCCCCAAAGTATCATGTGTGAACCTACAACACCCTGACCTCTTTCTCTCCTCCTTGATTGTATGAATAACCCTGAGAT
 801 CACCTCTTAGAACTGGTTTTAACCTTTAGCTGCAGCGGCTACGCTGCCACGTGTGTATATATATGACGTTGTACATTGCA
 881 CATACCCTTGGATCCCCACAGTTTGGTCCTCCTCCCAGCTACCCCTTTATAGTATGACGAGTTAACAAGTTGGTGACCTG
 961 CACAAAGCGAGACACAGCTATTTAATCTCTTGCCAGATATCGCCCCTCTTGGTGCGATGCTGTACAGGTCTCTGTAAAAA
1041 GTCCTTGCTGTCTCAGCAGCCAATCAACTTATAGTTTATTTTTTTCTGGGTTTTTGTTTTGTTTTGTTTTCTTTCTAATC
1121 GAGGTGTGAAAAAGTTCTAGGTTCAGTTGAAGTTCTGATGAAGAAACACAATTGAGATTTTTTCAGTGATAAAATCTGCA
1201 TATTTGTATTTCAACAATGTAGCTAAAACTTGATGTAAATTCCTCCTTTTTTTCCTTTTTTGGCTTAATGAATATCATTT
1281 ATTCAGTATGAAATCTTTATACTATATGTTCCACGTGTTAAGAATAAATGTACATTAAATCTTGGTAAGACTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucAUG-UA-GUAGA-UAUGACAu 5'
            ||| :| || || ||||||| 
Target 5' tgTACTGTACACCTGATACTGTa 3'
 583 - 605 154.00 -12.30
2 
miRNA  3' ucauGUAGUA-GAUAUGACAu 5'
              | | :| | ||:|||| 
Target 5' ccctCTTGGTGCGATGCTGTa 3'
 1004 - 1024 128.00 -10.30
3 
miRNA  3' ucaUGUAGUAGAUAUGACAu 5'
             | ||| |:|||||| | 
Target 5' atgAAATC-TTTATACTATa 3'
 1288 - 1306 128.00 -6.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1192736 6 ClinVar
1197106 11 ClinVar
COSN31594347 6 COSMIC
COSN30468855 18 COSMIC
COSN30552090 25 COSMIC
COSN30548382 26 COSMIC
COSN20074011 38 COSMIC
COSN30097813 93 COSMIC
COSN25846364 140 COSMIC
COSN31541229 196 COSMIC
COSN31596748 270 COSMIC
COSN30170887 271 COSMIC
COSN31594795 335 COSMIC
COSN19365852 422 COSMIC
COSN30174930 526 COSMIC
COSN22872902 608 COSMIC
COSN19304313 621 COSMIC
COSN28578908 675 COSMIC
COSN27402416 716 COSMIC
COSN29066575 716 COSMIC
COSN31769385 737 COSMIC
COSN31532324 811 COSMIC
COSN31513608 847 COSMIC
COSN31960201 852 COSMIC
COSN31535903 856 COSMIC
COSN31484548 970 COSMIC
COSN31556897 990 COSMIC
COSN31565426 1002 COSMIC
COSN26509054 1009 COSMIC
COSN26677618 1013 COSMIC
COSN31523204 1029 COSMIC
COSN31593976 1063 COSMIC
COSN31523201 1074 COSMIC
COSN31769386 1183 COSMIC
COSN31568545 1185 COSMIC
COSN31769390 1187 COSMIC
COSN31769393 1191 COSMIC
COSN32061019 1198 COSMIC
COSN31606438 1272 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748607027 2 dbSNP
rs768407935 3 dbSNP
rs201289176 6 dbSNP
rs761262959 7 dbSNP
rs572794512 8 dbSNP
rs372029026 11 dbSNP
rs763359043 14 dbSNP
rs1371743129 16 dbSNP
rs1491421314 17 dbSNP
rs369896037 17 dbSNP
rs551176418 17 dbSNP
rs745390232 17 dbSNP
rs377238538 18 dbSNP
rs755516865 19 dbSNP
rs1263075449 21 dbSNP
rs774971536 21 dbSNP
rs377624643 22 dbSNP
rs760439531 22 dbSNP
rs763858866 23 dbSNP
rs778187938 23 dbSNP
rs200568725 24 dbSNP
rs776428236 24 dbSNP
rs1441882203 25 dbSNP
rs1491399260 25 dbSNP
rs201547182 26 dbSNP
rs3841356 26 dbSNP
rs750470371 26 dbSNP
rs199555039 27 dbSNP
rs1314517111 29 dbSNP
rs761352508 35 dbSNP
rs769273623 36 dbSNP
rs375168652 38 dbSNP
rs114615474 39 dbSNP
rs751971163 43 dbSNP
rs759773973 46 dbSNP
rs915071595 48 dbSNP
rs1387972191 55 dbSNP
rs994830363 59 dbSNP
rs1462055512 64 dbSNP
rs1328126265 69 dbSNP
rs1454399182 83 dbSNP
rs193200602 87 dbSNP
rs1028353479 99 dbSNP
rs1239740672 106 dbSNP
rs953605214 108 dbSNP
rs570966006 111 dbSNP
rs1288293349 113 dbSNP
rs1007771911 119 dbSNP
rs1264000698 129 dbSNP
rs1462893445 130 dbSNP
rs1019086140 134 dbSNP
rs965796800 140 dbSNP
rs1250317878 150 dbSNP
rs201874010 151 dbSNP
rs969224680 153 dbSNP
rs981247939 167 dbSNP
rs762599015 169 dbSNP
rs185013013 170 dbSNP
rs1479178017 179 dbSNP
rs1181304090 191 dbSNP
rs1205766877 192 dbSNP
rs751706703 193 dbSNP
rs1406403111 201 dbSNP
rs1470776155 204 dbSNP
rs989824139 207 dbSNP
rs377690379 213 dbSNP
rs928091627 217 dbSNP
rs939320870 220 dbSNP
rs1395579085 225 dbSNP
rs1036374197 233 dbSNP
rs868709218 234 dbSNP
rs1391892783 238 dbSNP
rs190650562 239 dbSNP
rs948598431 240 dbSNP
rs1408417706 241 dbSNP
rs1307887735 245 dbSNP
rs930879662 252 dbSNP
rs1235734781 255 dbSNP
rs1309946194 256 dbSNP
rs1320638749 263 dbSNP
rs928443330 266 dbSNP
rs757365605 268 dbSNP
rs566849047 269 dbSNP
rs1227680069 272 dbSNP
rs889275126 273 dbSNP
rs1481929277 275 dbSNP
rs766238144 280 dbSNP
rs939470085 280 dbSNP
rs1486603790 282 dbSNP
rs1044113 288 dbSNP
rs1223004626 300 dbSNP
rs1180113728 313 dbSNP
rs1411692272 320 dbSNP
rs1171345252 327 dbSNP
rs1284114092 327 dbSNP
rs369865650 327 dbSNP
rs1325901660 330 dbSNP
rs1392259519 331 dbSNP
rs550131155 331 dbSNP
rs1168337088 335 dbSNP
rs1376510290 336 dbSNP
rs897898640 342 dbSNP
rs1007749223 346 dbSNP
rs1301660848 353 dbSNP
rs1049058386 358 dbSNP
rs1382332074 360 dbSNP
rs144625506 371 dbSNP
rs1339653193 372 dbSNP
rs1481169558 375 dbSNP
rs1198014666 383 dbSNP
rs1187195724 387 dbSNP
rs1250042738 390 dbSNP
rs1188206844 391 dbSNP
rs1447878196 391 dbSNP
rs1396050280 393 dbSNP
rs1007784903 403 dbSNP
rs140784604 403 dbSNP
rs1174528243 404 dbSNP
rs1217268548 404 dbSNP
rs1372859595 404 dbSNP
rs531891434 404 dbSNP
rs533673675 404 dbSNP
rs71007893 404 dbSNP
rs71582803 404 dbSNP
rs879190726 404 dbSNP
rs1019140683 405 dbSNP
rs966221010 408 dbSNP
rs1429436211 413 dbSNP
rs1481204994 415 dbSNP
rs999017389 420 dbSNP
rs1188114808 421 dbSNP
rs140247425 422 dbSNP
rs879067977 423 dbSNP
rs1385781858 425 dbSNP
rs1424979331 425 dbSNP
rs201576837 425 dbSNP
rs957140373 425 dbSNP
rs990224567 425 dbSNP
rs1022551333 427 dbSNP
rs969962710 429 dbSNP
rs1036660091 437 dbSNP
rs981301637 438 dbSNP
rs1274019817 443 dbSNP
rs552617811 447 dbSNP
rs192390664 449 dbSNP
rs139737956 455 dbSNP
rs972587229 481 dbSNP
rs1303826808 482 dbSNP
rs919377839 485 dbSNP
rs1453530028 487 dbSNP
rs1219728139 489 dbSNP
rs1246460797 491 dbSNP
rs866265719 503 dbSNP
rs1184917444 509 dbSNP
rs1049101049 517 dbSNP
rs750577664 518 dbSNP
rs1164990786 520 dbSNP
rs1415411446 525 dbSNP
rs1295149514 534 dbSNP
rs1322530817 535 dbSNP
rs1030625284 540 dbSNP
rs1354846836 542 dbSNP
rs1411465866 557 dbSNP
rs1306038878 564 dbSNP
rs183673478 566 dbSNP
rs1230115951 572 dbSNP
rs1284851133 577 dbSNP
rs1264096542 578 dbSNP
rs943331229 578 dbSNP
rs1226801481 579 dbSNP
rs1289460947 580 dbSNP
rs1010767671 587 dbSNP
rs1207755836 588 dbSNP
rs1040674568 589 dbSNP
rs145352087 611 dbSNP
rs1189316316 615 dbSNP
rs1268970655 615 dbSNP
rs1471534613 619 dbSNP
rs1162241813 620 dbSNP
rs999468120 628 dbSNP
rs1431346731 629 dbSNP
rs1031799251 640 dbSNP
rs1260631745 647 dbSNP
rs1415289971 648 dbSNP
rs969606409 671 dbSNP
rs1336146483 675 dbSNP
rs1428849870 680 dbSNP
rs1342294407 685 dbSNP
rs1172224910 690 dbSNP
rs1445917538 694 dbSNP
rs892884880 695 dbSNP
rs573932625 696 dbSNP
rs1230974226 698 dbSNP
rs1272887783 699 dbSNP
rs1383216996 701 dbSNP
rs1423928995 702 dbSNP
rs1164141784 703 dbSNP
rs1011294855 704 dbSNP
rs1022606208 704 dbSNP
rs1212161198 704 dbSNP
rs760723895 704 dbSNP
rs1367469673 705 dbSNP
rs1428749539 720 dbSNP
rs969719142 736 dbSNP
rs981060933 737 dbSNP
rs1174211102 738 dbSNP
rs980644703 741 dbSNP
rs755982730 749 dbSNP
rs1333587077 751 dbSNP
rs779697055 762 dbSNP
rs1437514380 764 dbSNP
rs1295704549 766 dbSNP
rs972982682 766 dbSNP
rs960826442 768 dbSNP
rs546236808 770 dbSNP
rs1382588716 775 dbSNP
rs1343482452 778 dbSNP
rs749310830 781 dbSNP
rs1200457346 783 dbSNP
rs919252408 785 dbSNP
rs930659273 787 dbSNP
rs1465901163 794 dbSNP
rs1206385837 798 dbSNP
rs1454506677 804 dbSNP
rs930738590 804 dbSNP
rs1200715643 806 dbSNP
rs984895434 825 dbSNP
rs1477638772 833 dbSNP
rs985022973 835 dbSNP
rs910824315 838 dbSNP
rs943503949 842 dbSNP
rs1358365430 843 dbSNP
rs1388199644 844 dbSNP
rs1040553727 852 dbSNP
rs1303861925 856 dbSNP
rs902095027 860 dbSNP
rs900878195 864 dbSNP
rs1187969128 868 dbSNP
rs536545312 868 dbSNP
rs1052168297 869 dbSNP
rs1289548913 876 dbSNP
rs60798877 893 dbSNP
rs1226045973 895 dbSNP
rs1184076490 899 dbSNP
rs1010549686 901 dbSNP
rs1387049545 902 dbSNP
rs1488599804 905 dbSNP
rs1022141064 907 dbSNP
rs905118899 911 dbSNP
rs1264975363 912 dbSNP
rs893281882 914 dbSNP
rs778763188 915 dbSNP
rs1158452685 917 dbSNP
rs566545995 920 dbSNP
rs1414093032 922 dbSNP
rs1455533630 923 dbSNP
rs1473582132 928 dbSNP
rs1157021071 937 dbSNP
rs1411417459 939 dbSNP
rs1022699450 940 dbSNP
rs1388965067 944 dbSNP
rs1002408607 945 dbSNP
rs1334971301 947 dbSNP
rs1002535806 948 dbSNP
rs747678001 950 dbSNP
rs960857696 953 dbSNP
rs1352852079 960 dbSNP
rs572778412 969 dbSNP
rs1026425035 970 dbSNP
rs952002276 974 dbSNP
rs1246467690 975 dbSNP
rs1263340752 976 dbSNP
rs1355294489 979 dbSNP
rs1205622967 981 dbSNP
rs746879215 982 dbSNP
rs1317726068 996 dbSNP
rs1375287195 998 dbSNP
rs12685 999 dbSNP
rs1181420844 1000 dbSNP
rs1249887927 1002 dbSNP
rs1424496245 1003 dbSNP
rs910760044 1004 dbSNP
rs994071818 1005 dbSNP
rs1027296882 1009 dbSNP
rs943634804 1014 dbSNP
rs976778050 1016 dbSNP
rs1408513780 1023 dbSNP
rs188298594 1026 dbSNP
rs1460677655 1042 dbSNP
rs985282134 1046 dbSNP
rs1244800396 1051 dbSNP
rs923453125 1053 dbSNP
rs1310061934 1061 dbSNP
rs1339498312 1064 dbSNP
rs1468526124 1067 dbSNP
rs772969127 1073 dbSNP
rs1276480547 1078 dbSNP
rs1339867681 1078 dbSNP
rs964750452 1081 dbSNP
rs36117735 1086 dbSNP
rs1256548522 1087 dbSNP
rs747724215 1092 dbSNP
rs976087309 1092 dbSNP
rs1408722599 1105 dbSNP
rs1420966563 1110 dbSNP
rs1174480077 1111 dbSNP
rs1428252222 1112 dbSNP
rs528990173 1113 dbSNP
rs934925108 1115 dbSNP
rs1470448228 1121 dbSNP
rs760232227 1122 dbSNP
rs1299399036 1127 dbSNP
rs548634719 1131 dbSNP
rs544354417 1138 dbSNP
rs1301827326 1143 dbSNP
rs1313870762 1144 dbSNP
rs914796227 1146 dbSNP
rs1254308225 1158 dbSNP
rs762673189 1160 dbSNP
rs558794605 1166 dbSNP
rs1044541667 1169 dbSNP
rs555311641 1170 dbSNP
rs1280862191 1173 dbSNP
rs1322377873 1178 dbSNP
rs1426400378 1178 dbSNP
rs1435396043 1184 dbSNP
rs1223811004 1192 dbSNP
rs1264768228 1196 dbSNP
rs147234817 1201 dbSNP
rs1322061358 1216 dbSNP
rs904897761 1218 dbSNP
rs994223697 1218 dbSNP
rs1002119988 1219 dbSNP
rs1035378243 1223 dbSNP
rs1293862975 1224 dbSNP
rs567162533 1230 dbSNP
rs1481632983 1236 dbSNP
rs1197324707 1241 dbSNP
rs1322828742 1243 dbSNP
rs1229101269 1246 dbSNP
rs756317726 1246 dbSNP
rs866177135 1246 dbSNP
rs1463707738 1247 dbSNP
rs1428741691 1255 dbSNP
rs1480877517 1256 dbSNP
rs952603391 1259 dbSNP
rs1489685103 1260 dbSNP
rs1178860619 1263 dbSNP
rs1417742913 1264 dbSNP
rs1409773858 1265 dbSNP
rs1429209967 1266 dbSNP
rs537890755 1267 dbSNP
rs180769241 1269 dbSNP
rs1356760783 1273 dbSNP
rs1399732242 1275 dbSNP
rs77103907 1279 dbSNP
rs1165063956 1285 dbSNP
rs1351360742 1289 dbSNP
rs1434029488 1297 dbSNP
rs1018085560 1298 dbSNP
rs964802993 1298 dbSNP
rs1411656473 1305 dbSNP
rs547256040 1307 dbSNP
rs1300734152 1308 dbSNP
rs1290258585 1312 dbSNP
rs1327225341 1314 dbSNP
rs1223384334 1315 dbSNP
rs896302585 1316 dbSNP
rs1323815558 1329 dbSNP
rs976141554 1345 dbSNP
rs923333401 1349 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucauguAGUAGAUAUGACAu 5'
                |||  |:|||||| 
Target 5' acccuuUCA--UGUACUGUa 3'
 		1 - 18
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9 PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000324856.7 | 3UTR | ACCCUUUCAUGUACUGUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.783 3.0e-6 0.799 1.4e-6 24 Click to see details
GSE28260 Renal cortex and medulla 0.901 1.3e-5 0.802 4.9e-4 13 Click to see details
GSE21849 B cell lymphoma -0.517 2.0e-3 -0.248 9.7e-2 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.546 2.9e-3 -0.537 3.4e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.356 4.8e-2 0.018 4.7e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.331 7.7e-2 -0.580 3.7e-3 20 Click to see details
GSE19350 CNS germ cell tumors 0.347 1.3e-1 0.531 3.8e-2 12 Click to see details
GSE19783 ER- ER- breast cancer 0.11 1.7e-1 0.124 1.4e-1 79 Click to see details
GSE19536 Breast cancer 0.091 1.8e-1 0.108 1.4e-1 100 Click to see details
GSE17306 Multiple myeloma -0.117 2.1e-1 0.147 1.6e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.098 2.2e-1 -0.055 3.3e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.132 2.6e-1 0.201 1.7e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.101 2.9e-1 -0.127 2.4e-1 32 Click to see details
GSE17498 Multiple myeloma -0.085 3.0e-1 -0.091 2.9e-1 40 Click to see details
GSE21032 Prostate cancer -0.039 3.6e-1 -0.052 3.2e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.092 3.7e-1 -0.106 3.5e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.061 4.0e-1 -0.102 3.3e-1 20 Click to see details
GSE38226 Liver fibrosis -0.057 4.0e-1 -0.273 1.2e-1 21 Click to see details
GSE14794 Lymphoblastoid cells -0.024 4.1e-1 -0.006 4.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.043 4.2e-1 -0.173 2.0e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.012 4.9e-1 -0.100 4.4e-1 5 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.971 0.01 1.000 0.5 4 Click to see details
HNSC -0.331 0.02 -0.331 0.02 42 Click to see details
KIRP -0.348 0.03 -0.415 0.01 32 Click to see details
KIRC -0.185 0.07 -0.155 0.1 68 Click to see details
BRCA -0.175 0.07 -0.091 0.22 74 Click to see details
LIHC -0.215 0.07 -0.266 0.03 49 Click to see details
UCEC 0.362 0.07 0.348 0.08 18 Click to see details
PRAD 0.199 0.09 0.086 0.28 48 Click to see details
ESCA -0.412 0.1 -0.400 0.11 11 Click to see details
LUSC 0.185 0.13 0.151 0.18 38 Click to see details
KICH -0.131 0.27 -0.170 0.21 25 Click to see details
LUAD -0.162 0.31 -0.252 0.21 12 Click to see details
BLCA -0.122 0.33 -0.409 0.06 16 Click to see details
CESC -0.495 0.34 -0.500 0.33 3 Click to see details
THCA -0.053 0.35 -0.062 0.32 59 Click to see details
STAD 0.068 0.36 0.096 0.3 32 Click to see details
PCPG 0.419 0.36 0.500 0.33 3 Click to see details
CHOL 0.12 0.38 0.300 0.22 9 Click to see details
CHOL 0.12 0.38 0.300 0.22 9 Click to see details
CHOL 0.12 0.38 0.300 0.22 9 Click to see details
204 hsa-miR-144-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 PLAG1 zinc finger 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor beta 1 4 1
MIRT006872 MTOR mechanistic target of rapamycin kinase 7 3
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor, erythroid 2 like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 6 5
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT066720 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT066784 ARID1A AT-rich interaction domain 1A 2 2
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT068846 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT069657 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT071717 CCNK cyclin K 2 2
MIRT073564 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT080720 ZCCHC2 zinc finger CCHC-type containing 2 2 4
MIRT090617 PLS1 plastin 1 2 2
MIRT097062 TNPO1 transportin 1 2 4
MIRT102618 UBN2 ubinuclein 2 2 4
MIRT118769 FAM217B family with sequence similarity 217 member B 2 6
MIRT147282 KPNA2 karyopherin subunit alpha 2 2 10
MIRT159513 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT196438 TAOK1 TAO kinase 1 2 2
MIRT211238 FGF2 fibroblast growth factor 2 2 2
MIRT220422 MKLN1 muskelin 1 2 2
MIRT223668 FZD6 frizzled class receptor 6 2 6
MIRT223805 OXR1 oxidation resistance 1 2 2
MIRT238585 NLN neurolysin 2 2
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT247188 BTG2 BTG anti-proliferation factor 2 2 6
MIRT249185 AKIRIN1 akirin 1 2 8
MIRT252653 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT305624 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT315671 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 6
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT403294 ZNF207 zinc finger protein 207 2 2
MIRT405966 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT437437 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 1
MIRT438343 MET MET proto-oncogene, receptor tyrosine kinase 5 1
MIRT444395 ZNF480 zinc finger protein 480 2 2
MIRT445255 SEMA5A semaphorin 5A 2 2
MIRT445309 MLANA melan-A 2 2
MIRT449020 ANKRD12 ankyrin repeat domain 12 2 2
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT459438 PPIC peptidylprolyl isomerase C 2 2
MIRT460471 MMS22L MMS22 like, DNA repair protein 2 2
MIRT461294 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT462948 ZNF800 zinc finger protein 800 2 12
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT463846 WRN Werner syndrome RecQ like helicase 2 2
MIRT466183 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466882 STX16 syntaxin 16 2 2
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468259 SFXN4 sideroflexin 4 2 2
MIRT469660 RAC1 Rac family small GTPase 1 2 10
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT470552 COASY Coenzyme A synthase 2 2
MIRT472208 NGFRAP1 brain expressed X-linked 3 2 4
MIRT472555 NACC1 nucleus accumbens associated 1 2 4
MIRT473462 MCL1 MCL1, BCL2 family apoptosis regulator 2 2
MIRT473925 LYSMD3 LysM domain containing 3 2 4
MIRT474068 LMNB2 lamin B2 2 2
MIRT475079 ITSN2 intersectin 2 2 4
MIRT475286 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT477516 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478464 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478920 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479338 CERK ceramide kinase 2 2
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480915 BCL2L11 BCL2 like 11 4 3
MIRT481532 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT481724 APPBP2 amyloid beta precursor protein binding protein 2 2 6
MIRT481938 ANKRD11 ankyrin repeat domain 11 2 12
MIRT487099 C2orf44 WD repeat and coiled coil containing 2 2
MIRT489294 RBM8A RNA binding motif protein 8A 2 8
MIRT492255 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT494770 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT496257 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497713 ZNF645 zinc finger protein 645 2 2
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT499292 TSPYL1 TSPY like 1 2 2
MIRT500105 SLC46A3 solute carrier family 46 member 3 2 2
MIRT501020 SPATA2 spermatogenesis associated 2 2 6
MIRT501816 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502296 GNG12 G protein subunit gamma 12 2 6
MIRT502493 FAM122B family with sequence similarity 122B 2 8
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT504266 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504370 ARID1B AT-rich interaction domain 1B 2 6
MIRT505125 YOD1 YOD1 deubiquitinase 2 4
MIRT506052 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT506481 MYO5A myosin VA 2 6
MIRT506967 HOXA10 homeobox A10 2 6
MIRT507728 CLIC4 chloride intracellular channel 4 2 4
MIRT513081 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513570 FKBP14 FK506 binding protein 14 2 2
MIRT513631 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513692 RNF111 ring finger protein 111 2 2
MIRT513764 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT520786 TBX18 T-box 18 2 4
MIRT523402 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT527750 NANOGNB NANOG neighbor homeobox 2 2
MIRT532823 ZNF827 zinc finger protein 827 2 2
MIRT534603 RORA RAR related orphan receptor A 2 2
MIRT535762 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536346 LEFTY1 left-right determination factor 1 2 2
MIRT543081 APP amyloid beta precursor protein 2 2
MIRT544064 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545424 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT546324 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547539 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548062 GOLGA7 golgin A7 2 2
MIRT549248 ATXN1L ataxin 1 like 2 4
MIRT549250 ATXN1 ataxin 1 2 2
MIRT549467 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549937 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT551489 TMEM192 transmembrane protein 192 2 4
MIRT552564 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553688 TFAP4 transcription factor AP-4 2 4
MIRT553951 STAMBP STAM binding protein 2 2
MIRT554163 SLC7A2 solute carrier family 7 member 2 2 4
MIRT554477 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555003 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555109 PURB purine rich element binding protein B 2 2
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555535 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556092 MORC3 MORC family CW-type zinc finger 3 2 2
MIRT556571 LIFR LIF receptor alpha 2 2
MIRT556936 INO80D INO80 complex subunit D 2 4
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT558368 DIDO1 death inducer-obliterator 1 2 4
MIRT558464 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT559236 BICD2 BICD cargo adaptor 2 2 4
MIRT560099 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560725 ZNF749 zinc finger protein 749 2 2
MIRT561142 SPAG1 sperm associated antigen 1 2 2
MIRT561721 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562484 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT562681 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565068 USP25 ubiquitin specific peptidase 25 2 2
MIRT565184 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565946 RREB1 ras responsive element binding protein 1 2 2
MIRT566315 POU2F1 POU class 2 homeobox 1 2 2
MIRT566435 PHF3 PHD finger protein 3 2 2
MIRT566485 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566612 NR3C1 nuclear receptor subfamily 3 group C member 1 4 2
MIRT566761 MOB4 MOB family member 4, phocein 2 2
MIRT566867 LRRC1 leucine rich repeat containing 1 2 2
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT567245 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT570705 FAM69A family with sequence similarity 69 member A 2 2
MIRT570931 ZNF284 zinc finger protein 284 2 2
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT571647 SIX4 SIX homeobox 4 2 2
MIRT574274 ZNF350 zinc finger protein 350 2 2
MIRT574304 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT574843 CADM1 cell adhesion molecule 1 2 2
MIRT608128 TSC22D2 TSC22 domain family member 2 2 2
MIRT648849 WNT7A Wnt family member 7A 2 2
MIRT687559 MLEC malectin 2 2
MIRT696548 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701146 PANK1 pantothenate kinase 1 2 2
MIRT704284 DENND5B DENN domain containing 5B 2 2
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT707687 GPR50 G protein-coupled receptor 50 2 2
MIRT707810 TSPAN6 tetraspanin 6 2 2
MIRT710019 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712705 TEX9 testis expressed 9 2 2
MIRT731264 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT731606 SMAD4 SMAD family member 4 1 1
MIRT731688 MAP3K8 mitogen-activated protein kinase kinase kinase 8 3 1
MIRT731796 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT731798 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT732183 PTGS2 prostaglandin-endoperoxide synthase 2 3 1
MIRT732711 ADAM10 ADAM metallopeptidase domain 10 4 0
MIRT732936 HGF hepatocyte growth factor 1 0
MIRT733214 TLR2 toll like receptor 2 2 0
MIRT734500 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
MIRT734637 RPE ribulose-5-phosphate-3-epimerase 2 0
MIRT735650 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 0
MIRT736975 BCL6 B-cell CLL/lymphoma 6 3 0
MIRT737058 FBXW7 F-box and WD repeat domain containing 7 3 0
MIRT737435 CLK3 CDC like kinase 3 2 0
MIRT755765 FOXO1 forkhead box O1 3 1
MIRT755949 ONECUT2 one cut homeobox 2 7 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-144 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-144 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-144 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-144 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-144 XMD8-92 NULL 46843772 Microarray pancreatic ductal adenocarcinoma cell 24880079 2014 up-regulated
miR-144 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-144 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-144 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-144 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-144 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-144 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-144 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-144-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-144-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229, U251, LN18）
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Prostate Cancer tissue and cell line (PC-3, LNCap)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved resistant Low Cervical Cancer tissue
hsa-miR-144-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (SN12-PM6, 786-O)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Anaplastic Thyroid Cancer tissue
hsa-miR-144-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-144-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma cell line (SH-SY5Y, SK-N-SH)
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Neuroblastoma cell line (SK-N-SH, IMR-32)
hsa-miR-144-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-144-3p Pazopanib 10113978 NSC752782 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-144-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-144-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-144-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission