miRTarBase - #MIRT068548


—
pre-miRNA Information
pre-miRNA hsa-mir-202   
Genomic Coordinates chr10: 133247511 - 133247620
Synonyms MIRN202, hsa-mir-202, MIR202
Description Homo sapiens miR-202 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-202-3p
Sequence 64| AGAGGUAUAGGGCAUGGGAA |83
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs926369945 1 dbSNP
rs771209501 6 dbSNP
rs764929236 8 dbSNP
rs980911784 10 dbSNP
rs1184126421 12 dbSNP
rs1417531131 16 dbSNP
rs1237822757 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NHLRC3   
Synonyms -
Description NHL repeat containing 3
Transcript NM_001012754   
Other Transcripts NM_001017370   
Expression
Putative miRNA Targets on NHLRC3
3'UTR of NHLRC3
(miRNA target sites are highlighted)		 
>NHLRC3|NM_001012754|3'UTR
   1 TGTTTCTTTCCTGGGAATATTTCAAGTGGCAGTTCAGATTCTCAATTCACTAAGTGCTTAAAAATGATGTTCAAGCACAA
  81 GAATTTATTTTTCTAGTATAAAAGATCTAGTATCAGAAAGATTTGTTTTTGTATCATTAAGAATCTTATATTTTGTTGCC
 161 CTCTTGGGACTTAGTTTTATTTGTAAGTGCATAAGGATATTTTAATGAAAGGAAAGTAACTAAAAAATGGGGTTGGGAAG
 241 AGGGACTAAGGTGGTAACCTCATTATTTGCCCTGGTAGACTGATTCTCCCTGGGTAAAAAAAATGGGAATAAAAATGAGC
 321 TTGCATGATAATTTATTAAATTTCATGTGAAGAACTCCAGACCTCCAGATTGTGCAACTAACATAAAATGAGCTGCTTGA
 401 GAGATTGTAAATAAGATGAACTATTGATTAATTTGAGTACCCACAGAGTGCTGTGTCTTGACGACTTAAAAATGAAAAAG
 481 CAGGATTGCCTTTTGAGTAGCTTGCAGTCTAGTGGGGAGACAAGCAGGCAAACAGTCACAACACAGCAAAAGCGACCTTG
 561 GAGCATAGTGGGACTTTTGGAGTAGGAGTGCTGCATTTGACTGAGGGAATCATGGATACTTCGCAGGAGAAGTGAATTTG
 641 AGCTCAGACTTGAAAACTGAGGAGGAGCTTACCAAGGGACAAGGAGGAGAAAACAATAATTTCCAAGTAAAGAAGGTATA
 721 AAAAGTTAGAAGTGTACTGTAAACTTTGATAGGCTTTTAGGCCTTTTTTAAAGCCCAACTTGGCTTCTGTCCATTACCTA
 801 TAAGATATTTAATGTCAGTCAGCCTTTAAATGTAGGAATAAAATGGCTGGCATCTAAGCACTTTAGTAAAAGAGGTTTTT
 881 ACAAATAACTAAGGATTGTAGAGCTTCCTTCTCTTTTTTTTTCTTTTTCTTTCTTTTGTTTTACATGAACTCAACTTATT
 961 CCTAACATTTGTCTACCTCAAAGAAATTTCAAGATTATTTAGATAACATGGATATGTGCCAAATCCTTTGAGCTGTTAAG
1041 ATGATAATTTCCTGCTTTCCTCCTACATCTTCTCCTCCCACTCCCTCCTTTGGTGTGAATATTGGCTTCCCAATTAAGAC
1121 CTTTTTTTTTTTTTTTCCAGTTTGTTTTAGCTTATTATAGGTTTTGGAGGAACTTTGCCATTTTGTAATCTTTCAAATCA
1201 TTCTTCACCCTTCCTCACATCAGCTTCCTGCTTTTCCCAGTGTTTTACTGTAAATTGTGTAGCATATGACAAATCTTGAG
1281 CTGACTTTCCTCTTCACCTGTTATGGCTGGAGTATTTTCCAGACCTGAAGGGACTCACACTTGTTTTGATACTTGGATCA
1361 CATCTCCGTGAGGTTAGGAAGGTAAATCTACCAACAGGAAGCCCTGTACTCTGTATTCCAAGGCCATTGGTAAATGTGTT
1441 GGTGCCACTGATCGGACTGTATGACCTTAAACAAGTCACCTTAGTTTTCAGTGAAATGGGAATATCATTGTCTCCTCTTT
1521 CATGAATGCTGTGAGAATCAGATGTGCAACAGGTACAGACTTGCCCTTTGAAATCTATACCTCTGGATACATTAGAGGCA
1601 TTTTATTAACAAAGGCCCTTCTAAATGTGCTATTTATTTGACAATAACTATCAGATTTGCCTTAATTTTGTGTTTATAGC
1681 ATTTATCAAAACGTATCCTCATAGACTTTATGCAGATTAATATGGTCAATTGATTTGGATAAAAGAAAGTAATTTCAGGG
1761 TTTGTTTTTAAGCCAGGACAAGAAGTGCAAATGCCTCTTTGAAGCAATTTAGGCTAAACTGATTTTGAAATTTCAAAATG
1841 TTTTATTTTACTTTGTTTTATTAAGCCAGGACAAGAAGTGCAAATGCCTCTTTGAAGCAATTCAGGCTAGGTAAACCGAT
1921 TTTGCCATTTCAAAACGTTTTATTTTACTTTGTTTTATATCAGAGTCTTATAAAACCTGCTGCAAATATTTCTGAATGTC
2001 TTTGTAAAAGTGTTTGTTAGTGTACCTGTGATTATAGTACTTCACTTTTTTCCTTTGGATTAATTGGTTAAATGAATGAG
2081 AAATGTGTTATGTTTTTTACTAAAAAGTATAAATTAAAATTTTGGAAAGAAAAGGCAATATTATCTGGCTCCCCAATTAA
2161 AGTTTGATTTTATTGTCACAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaGGGUAC--GGGAUAUGGAGa 5'
            ||: ||   :||||||||| 
Target 5' gcCCTTTGAAATCTATACCTCt 3'
 1563 - 1584 156.00 -22.10
2 
miRNA  3' aagGGUACGGGAUAUGGAGa 5'
             :||||    ||||:|| 
Target 5' gaaTCATG---GATACTTCg 3'
 607 - 623 130.00 -9.80
3 
miRNA  3' aagggUACGGGAUAUGGAGa 5'
               :|| |  ||:|||| 
Target 5' aagaaGTG-CAAATGCCTCt 3'
 1780 - 1798 126.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30130376 7 COSMIC
COSN6624144 13 COSMIC
COSN30523976 38 COSMIC
COSN30487796 42 COSMIC
COSN26986489 59 COSMIC
COSN31495859 73 COSMIC
COSN31601738 76 COSMIC
COSN30120464 121 COSMIC
COSN31610252 199 COSMIC
COSN7401080 412 COSMIC
COSN32061253 682 COSMIC
COSN7401081 777 COSMIC
COSN1609085 780 COSMIC
COSN31960902 855 COSMIC
COSN24297057 923 COSMIC
COSN31595937 960 COSMIC
COSN31591508 967 COSMIC
COSN20210429 1046 COSMIC
COSN31518024 1053 COSMIC
COSN20110623 1137 COSMIC
COSN20110624 1137 COSMIC
COSN28709878 1428 COSMIC
COSN6228683 1446 COSMIC
COSN7401082 1478 COSMIC
COSN7401083 1507 COSMIC
COSN32141291 1542 COSMIC
COSN32057937 1559 COSMIC
COSN20092761 2067 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318572248 12 dbSNP
rs772746364 12 dbSNP
rs9532318 13 dbSNP
rs201037532 14 dbSNP
rs540296742 18 dbSNP
rs576865180 22 dbSNP
rs751060001 24 dbSNP
rs1478541110 26 dbSNP
rs756996258 29 dbSNP
rs372614878 30 dbSNP
rs1193434684 36 dbSNP
rs745487060 42 dbSNP
rs906381031 43 dbSNP
rs377293280 44 dbSNP
rs779701256 46 dbSNP
rs749314984 48 dbSNP
rs763339228 51 dbSNP
rs2274383 52 dbSNP
rs1033603321 70 dbSNP
rs1311959554 72 dbSNP
rs1034197441 78 dbSNP
rs1220659744 81 dbSNP
rs895554417 82 dbSNP
rs1277667782 83 dbSNP
rs1380559333 84 dbSNP
rs532618312 108 dbSNP
rs957930846 110 dbSNP
rs1304505234 119 dbSNP
rs1466421405 123 dbSNP
rs1358332980 124 dbSNP
rs1173877169 137 dbSNP
rs1466884103 147 dbSNP
rs1411621399 149 dbSNP
rs1291465450 161 dbSNP
rs1426163607 175 dbSNP
rs990203768 181 dbSNP
rs1354882405 188 dbSNP
rs1022025420 189 dbSNP
rs1182945708 192 dbSNP
rs1014444815 203 dbSNP
rs1241659889 215 dbSNP
rs1200856954 216 dbSNP
rs545912527 221 dbSNP
rs1019947291 222 dbSNP
rs1257586866 222 dbSNP
rs1234045390 223 dbSNP
rs967483150 247 dbSNP
rs978459904 251 dbSNP
rs1381890843 264 dbSNP
rs1305995088 291 dbSNP
rs1448635419 296 dbSNP
rs1033641707 297 dbSNP
rs953650402 301 dbSNP
rs755608016 304 dbSNP
rs1204179830 305 dbSNP
rs1252287747 316 dbSNP
rs967515432 318 dbSNP
rs1460085272 319 dbSNP
rs1369661362 325 dbSNP
rs977925040 327 dbSNP
rs1209327226 342 dbSNP
rs1257479720 343 dbSNP
rs754352473 351 dbSNP
rs1423764775 366 dbSNP
rs1180900886 368 dbSNP
rs1188118347 376 dbSNP
rs1237878567 381 dbSNP
rs1194270255 383 dbSNP
rs1489536232 383 dbSNP
rs1266135619 384 dbSNP
rs9576710 389 dbSNP
rs565027174 393 dbSNP
rs1169437264 404 dbSNP
rs944788315 411 dbSNP
rs1377357107 412 dbSNP
rs972590895 421 dbSNP
rs1327815130 425 dbSNP
rs1389297973 430 dbSNP
rs919356259 445 dbSNP
rs1293635647 447 dbSNP
rs1423378833 451 dbSNP
rs752061788 454 dbSNP
rs75207304 458 dbSNP
rs1160955662 460 dbSNP
rs921552657 463 dbSNP
rs757815807 464 dbSNP
rs1310966220 469 dbSNP
rs931554886 479 dbSNP
rs1435164389 496 dbSNP
rs143290715 498 dbSNP
rs567493876 507 dbSNP
rs567080935 511 dbSNP
rs1489876606 522 dbSNP
rs1415410445 526 dbSNP
rs939677650 527 dbSNP
rs1046181471 536 dbSNP
rs888335105 537 dbSNP
rs183568802 554 dbSNP
rs73169477 555 dbSNP
rs1332465486 560 dbSNP
rs1344718263 566 dbSNP
rs1033508108 567 dbSNP
rs893744550 583 dbSNP
rs186760962 597 dbSNP
rs1020839290 608 dbSNP
rs757845518 620 dbSNP
rs967803478 624 dbSNP
rs1300646675 625 dbSNP
rs977355753 633 dbSNP
rs375335487 634 dbSNP
rs1384824721 641 dbSNP
rs1013998093 646 dbSNP
rs1467850998 651 dbSNP
rs1019667016 658 dbSNP
rs558232286 664 dbSNP
rs1378486053 665 dbSNP
rs1020421477 678 dbSNP
rs1198962777 679 dbSNP
rs569392016 682 dbSNP
rs965426401 694 dbSNP
rs1194413431 695 dbSNP
rs1000248347 705 dbSNP
rs1283386360 706 dbSNP
rs1203174684 707 dbSNP
rs1220131023 717 dbSNP
rs1346839959 719 dbSNP
rs975592353 722 dbSNP
rs921415935 723 dbSNP
rs931611700 727 dbSNP
rs1279580129 739 dbSNP
rs984796496 741 dbSNP
rs1032654328 748 dbSNP
rs370077667 749 dbSNP
rs939689796 762 dbSNP
rs1176039463 763 dbSNP
rs1468451008 780 dbSNP
rs538096581 782 dbSNP
rs1019060499 783 dbSNP
rs1171477868 790 dbSNP
rs1241500242 793 dbSNP
rs1190927230 794 dbSNP
rs966146534 797 dbSNP
rs1451097846 802 dbSNP
rs972259404 812 dbSNP
rs1256625667 814 dbSNP
rs1202758735 818 dbSNP
rs777424109 822 dbSNP
rs1218773911 823 dbSNP
rs746624975 824 dbSNP
rs151263266 825 dbSNP
rs770670916 832 dbSNP
rs1054992176 844 dbSNP
rs985183242 845 dbSNP
rs1341540426 848 dbSNP
rs1336520013 861 dbSNP
rs1450823779 862 dbSNP
rs926639352 865 dbSNP
rs1332276294 867 dbSNP
rs1336194122 868 dbSNP
rs1343484440 874 dbSNP
rs1165029908 876 dbSNP
rs937233980 885 dbSNP
rs1385719531 890 dbSNP
rs1430153445 897 dbSNP
rs893642496 901 dbSNP
rs1239695270 912 dbSNP
rs917172455 913 dbSNP
rs1041562868 914 dbSNP
rs1270299575 914 dbSNP
rs949887740 914 dbSNP
rs1314888285 920 dbSNP
rs902905990 920 dbSNP
rs1303138421 924 dbSNP
rs1349183393 926 dbSNP
rs1221458661 930 dbSNP
rs1282831742 934 dbSNP
rs1310312236 934 dbSNP
rs999969796 934 dbSNP
rs1054044514 939 dbSNP
rs1010717656 940 dbSNP
rs1042701732 946 dbSNP
rs902397027 955 dbSNP
rs539075550 957 dbSNP
rs35462854 961 dbSNP
rs1162847996 962 dbSNP
rs1248193822 965 dbSNP
rs1381915847 970 dbSNP
rs1007185315 973 dbSNP
rs540937479 977 dbSNP
rs1469335853 980 dbSNP
rs1230751395 982 dbSNP
rs554181202 986 dbSNP
rs1191468572 994 dbSNP
rs781429655 1000 dbSNP
rs1490365628 1012 dbSNP
rs879770100 1015 dbSNP
rs17059064 1030 dbSNP
rs1220861157 1034 dbSNP
rs1356349717 1036 dbSNP
rs1454585865 1037 dbSNP
rs546280615 1041 dbSNP
rs780261916 1042 dbSNP
rs1174216042 1045 dbSNP
rs966333744 1047 dbSNP
rs1371478648 1052 dbSNP
rs191471106 1056 dbSNP
rs1405785505 1063 dbSNP
rs1437364463 1064 dbSNP
rs1344930887 1066 dbSNP
rs1302526844 1068 dbSNP
rs754288303 1068 dbSNP
rs994049291 1070 dbSNP
rs1026507459 1072 dbSNP
rs1019570542 1074 dbSNP
rs984906915 1076 dbSNP
rs965457672 1084 dbSNP
rs996874873 1085 dbSNP
rs1267526047 1088 dbSNP
rs1196603851 1103 dbSNP
rs1325594772 1104 dbSNP
rs959320441 1110 dbSNP
rs1372156145 1120 dbSNP
rs11384181 1122 dbSNP
rs1491019531 1122 dbSNP
rs200635456 1122 dbSNP
rs572582129 1122 dbSNP
rs879037644 1122 dbSNP
rs370624700 1137 dbSNP
rs79133621 1137 dbSNP
rs1439103762 1138 dbSNP
rs1278293860 1140 dbSNP
rs913803224 1145 dbSNP
rs1429844908 1146 dbSNP
rs1222635666 1150 dbSNP
rs1177849653 1152 dbSNP
rs945271628 1155 dbSNP
rs1330708618 1158 dbSNP
rs1211410376 1159 dbSNP
rs1272196662 1160 dbSNP
rs1451962951 1162 dbSNP
rs781015786 1168 dbSNP
rs530731960 1174 dbSNP
rs952994483 1180 dbSNP
rs917141180 1195 dbSNP
rs950014522 1198 dbSNP
rs1263133865 1200 dbSNP
rs1186414402 1204 dbSNP
rs1182940728 1205 dbSNP
rs1041921392 1218 dbSNP
rs745847326 1220 dbSNP
rs984271180 1227 dbSNP
rs1239605637 1241 dbSNP
rs1204664654 1258 dbSNP
rs1459989807 1259 dbSNP
rs908820977 1260 dbSNP
rs935748893 1265 dbSNP
rs1220607113 1268 dbSNP
rs1395583565 1269 dbSNP
rs1308144222 1270 dbSNP
rs1296250995 1273 dbSNP
rs1407427176 1277 dbSNP
rs1359713918 1290 dbSNP
rs544101499 1291 dbSNP
rs1327269317 1295 dbSNP
rs1354419700 1297 dbSNP
rs961647662 1300 dbSNP
rs1054096481 1309 dbSNP
rs888874458 1310 dbSNP
rs1046230335 1312 dbSNP
rs927770148 1314 dbSNP
rs938784201 1320 dbSNP
rs1007152753 1326 dbSNP
rs1466769670 1330 dbSNP
rs1040035639 1331 dbSNP
rs1169075856 1334 dbSNP
rs1230993886 1336 dbSNP
rs1427294481 1339 dbSNP
rs902075356 1340 dbSNP
rs1184605160 1341 dbSNP
rs1444384433 1344 dbSNP
rs1292279593 1349 dbSNP
rs981795026 1351 dbSNP
rs561218744 1368 dbSNP
rs769763780 1369 dbSNP
rs1202475699 1384 dbSNP
rs1270663754 1391 dbSNP
rs1305709781 1396 dbSNP
rs952285043 1402 dbSNP
rs1054898997 1407 dbSNP
rs1437114195 1423 dbSNP
rs775499527 1427 dbSNP
rs117121350 1428 dbSNP
rs959455517 1433 dbSNP
rs1042218653 1454 dbSNP
rs546510737 1455 dbSNP
rs1297111651 1456 dbSNP
rs140349297 1462 dbSNP
rs367894148 1467 dbSNP
rs1369215918 1476 dbSNP
rs977407390 1477 dbSNP
rs901195694 1485 dbSNP
rs1419926520 1495 dbSNP
rs924528171 1498 dbSNP
rs1175617774 1529 dbSNP
rs1489505924 1536 dbSNP
rs1293917529 1548 dbSNP
rs996763149 1553 dbSNP
rs9576711 1559 dbSNP
rs1289364293 1565 dbSNP
rs771817054 1567 dbSNP
rs952818980 1567 dbSNP
rs568906408 1574 dbSNP
rs544202662 1579 dbSNP
rs1305832784 1587 dbSNP
rs531430744 1598 dbSNP
rs943146747 1606 dbSNP
rs538419190 1611 dbSNP
rs554831044 1615 dbSNP
rs929546026 1617 dbSNP
rs1364206601 1621 dbSNP
rs1047935864 1625 dbSNP
rs773014960 1628 dbSNP
rs773612583 1630 dbSNP
rs1157159060 1633 dbSNP
rs982372196 1640 dbSNP
rs1269723606 1646 dbSNP
rs1198737288 1651 dbSNP
rs760929312 1656 dbSNP
rs1490167833 1663 dbSNP
rs1266618296 1677 dbSNP
rs568661575 1679 dbSNP
rs1206732229 1680 dbSNP
rs928177112 1681 dbSNP
rs534449576 1682 dbSNP
rs959030694 1693 dbSNP
rs1484650489 1694 dbSNP
rs990468293 1696 dbSNP
rs60068247 1699 dbSNP
rs554516299 1711 dbSNP
rs895212630 1716 dbSNP
rs1256995390 1719 dbSNP
rs1390642714 1724 dbSNP
rs915011501 1730 dbSNP
rs766712108 1745 dbSNP
rs375313442 1761 dbSNP
rs1013704331 1766 dbSNP
rs1191279137 1775 dbSNP
rs1471096933 1775 dbSNP
rs1241805760 1776 dbSNP
rs1450477733 1780 dbSNP
rs1170884548 1783 dbSNP
rs1025385654 1787 dbSNP
rs558833473 1788 dbSNP
rs1375923432 1791 dbSNP
rs546269989 1792 dbSNP
rs1434665255 1797 dbSNP
rs1195199860 1805 dbSNP
rs556669291 1806 dbSNP
rs754227443 1807 dbSNP
rs1447413904 1812 dbSNP
rs183984647 1814 dbSNP
rs545084334 1816 dbSNP
rs1462378772 1825 dbSNP
rs1263312788 1842 dbSNP
rs1397316932 1845 dbSNP
rs944515185 1848 dbSNP
rs1325555846 1852 dbSNP
rs1031560338 1854 dbSNP
rs1040288574 1856 dbSNP
rs1228827986 1869 dbSNP
rs900392449 1871 dbSNP
rs932688105 1873 dbSNP
rs1345598830 1880 dbSNP
rs1233440635 1881 dbSNP
rs989924496 1890 dbSNP
rs1049748009 1901 dbSNP
rs1468334982 1902 dbSNP
rs1398697864 1905 dbSNP
rs943115468 1906 dbSNP
rs975896473 1909 dbSNP
rs1261221224 1914 dbSNP
rs866311585 1917 dbSNP
rs1465526244 1918 dbSNP
rs564871679 1919 dbSNP
rs370521733 1937 dbSNP
rs888551661 1938 dbSNP
rs1274546492 1943 dbSNP
rs1005619376 1945 dbSNP
rs1195807315 1955 dbSNP
rs1200170103 1964 dbSNP
rs1379937677 1965 dbSNP
rs1467125735 1968 dbSNP
rs1248709086 1972 dbSNP
rs1268924755 1972 dbSNP
rs1016064252 1973 dbSNP
rs1383946957 1978 dbSNP
rs1314686643 1979 dbSNP
rs560889139 1986 dbSNP
rs1156307051 1992 dbSNP
rs897344577 2001 dbSNP
rs928951642 2005 dbSNP
rs1047862161 2006 dbSNP
rs755344404 2011 dbSNP
rs1003672910 2014 dbSNP
rs1166609096 2016 dbSNP
rs1426370722 2017 dbSNP
rs1035280496 2023 dbSNP
rs942281702 2026 dbSNP
rs1055284605 2027 dbSNP
rs1234201591 2036 dbSNP
rs959604985 2049 dbSNP
rs1386066077 2053 dbSNP
rs990934137 2054 dbSNP
rs1332765998 2058 dbSNP
rs759753512 2059 dbSNP
rs1260242628 2060 dbSNP
rs1273153807 2064 dbSNP
rs1330041963 2072 dbSNP
rs1225337710 2083 dbSNP
rs1210788539 2084 dbSNP
rs1013766940 2085 dbSNP
rs1244153091 2092 dbSNP
rs1025027201 2099 dbSNP
rs1280344438 2100 dbSNP
rs1021943766 2101 dbSNP
rs1468307080 2107 dbSNP
rs765785367 2111 dbSNP
rs1366048594 2135 dbSNP
rs999510955 2136 dbSNP
rs968231795 2155 dbSNP
rs1409796055 2160 dbSNP
rs1158754417 2163 dbSNP
rs1210879311 2169 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aaggguacgggauAUGGAGa 5'
                       |||||| 
Target 5' ccuaacauuugucUACCUCa 3'
 		14 - 33
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 387921.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aaggguacgggauAUGGAGa 5'
                       |||||| 
Target 5' ccuaacauuugucUACCUCa 3'
 		14 - 33
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000470258.1 | 3UTR | AACUCAACUUAUUCCUAACAUUUGUCUACCUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000470258.1 | 3UTR | AACUCAACUUAUUCCUAACAUUUGUCUACCUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000470258.1 | 3UTR | AACUCAACUUAUUCCUAACAUUUGUCUACCUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.437 1.9e-2 -0.225 1.5e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.273 9.3e-2 0.324 5.7e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.404 9.6e-2 0.629 1.4e-2 12 Click to see details
GSE28544 Breast cancer 0.269 1.0e-1 0.559 2.3e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.305 1.6e-1 0.302 1.6e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.216 1.8e-1 0.248 1.5e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.185 1.9e-1 -0.195 1.8e-1 24 Click to see details
GSE19783 ER- ER- breast cancer 0.095 2.0e-1 0.113 1.6e-1 79 Click to see details
GSE14794 Lymphoblastoid cells 0.088 2.0e-1 0.122 1.3e-1 90 Click to see details
GSE21032 Prostate cancer -0.09 2.1e-1 -0.049 3.3e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.132 2.4e-1 -0.178 1.6e-1 32 Click to see details
GSE38226 Liver fibrosis 0.15 2.6e-1 0.019 4.7e-1 21 Click to see details
GSE19536 Breast cancer 0.062 2.7e-1 0.067 2.5e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.115 2.9e-1 0.355 4.1e-2 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.458 3.5e-1 0.500 3.3e-1 3 Click to see details
GSE19783 ER+ ER+ breast cancer 0.076 3.8e-1 0.032 4.5e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.038 3.8e-1 0.002 4.9e-1 64 Click to see details
GSE17306 Multiple myeloma -0.016 4.6e-1 0.003 4.9e-1 49 Click to see details
GSE21849 B cell lymphoma -0.013 4.7e-1 -0.026 4.5e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.013 4.8e-1 -0.038 4.4e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
BRCA -0.654 0.08 -0.371 0.23 6 Click to see details
187 hsa-miR-202-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016613 MYCN MYCN proto-oncogene, bHLH transcription factor 1 1
MIRT053565 GLI1 GLI family zinc finger 1 3 1
MIRT063201 ADIPOR2 adiponectin receptor 2 2 2
MIRT067406 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068548 NHLRC3 NHL repeat containing 3 2 6
MIRT080404 ONECUT2 one cut homeobox 2 2 2
MIRT118591 STK4 serine/threonine kinase 4 2 2
MIRT123324 CALU calumenin 2 2
MIRT191784 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT194243 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT252856 ZNF526 zinc finger protein 526 2 4
MIRT268844 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT273603 SP1 Sp1 transcription factor 2 2
MIRT363747 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT437760 HAS2 hyaluronan synthase 2 1 1
MIRT437971 LRP6 LDL receptor related protein 6 3 1
MIRT438223 ARL5A ADP ribosylation factor like GTPase 5A 2 1
MIRT442013 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445652 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT448241 ZNF774 zinc finger protein 774 2 2
MIRT452085 NUCB2 nucleobindin 2 2 2
MIRT454158 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454273 FXN frataxin 2 2
MIRT455669 GLO1 glyoxalase I 2 2
MIRT458010 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458272 FUT10 fucosyltransferase 10 2 2
MIRT463411 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463655 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT465107 TSC22D2 TSC22 domain family member 2 2 4
MIRT470409 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470662 POLR2D RNA polymerase II subunit D 2 4
MIRT470842 PLXND1 plexin D1 2 2
MIRT471411 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471519 PCGF3 polycomb group ring finger 3 2 6
MIRT472668 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT473124 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT474252 LATS2 large tumor suppressor kinase 2 2 2
MIRT474485 KLHDC8B kelch domain containing 8B 2 2
MIRT474753 KIAA0930 KIAA0930 2 2
MIRT474899 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT476815 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT477669 EFHD2 EF-hand domain family member D2 2 2
MIRT477739 EDN1 endothelin 1 2 2
MIRT479745 CCND1 cyclin D1 2 2
MIRT480332 C5orf51 chromosome 5 open reading frame 51 2 10
MIRT481188 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481228 ATXN7L3 ataxin 7 like 3 2 2
MIRT481357 ATG9A autophagy related 9A 2 2
MIRT481645 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT485486 IGF1R insulin like growth factor 1 receptor 2 8
MIRT490467 ABT1 activator of basal transcription 1 2 8
MIRT492050 TNFSF9 TNF superfamily member 9 2 2
MIRT492621 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT494680 ARID3A AT-rich interaction domain 3A 2 2
MIRT497868 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498111 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT498793 MDM2 MDM2 proto-oncogene 2 2
MIRT499342 RAB25 RAB25, member RAS oncogene family 2 2
MIRT499398 PLCG2 phospholipase C gamma 2 2 4
MIRT499646 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT500805 THBS1 thrombospondin 1 2 3
MIRT501194 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501225 SEMA4C semaphorin 4C 2 6
MIRT501317 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501341 RNF44 ring finger protein 44 2 4
MIRT501381 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501683 PDE12 phosphodiesterase 12 2 8
MIRT501923 MDM4 MDM4, p53 regulator 2 2
MIRT501933 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502118 KMT2D lysine methyltransferase 2D 2 4
MIRT502260 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT502766 CLDN12 claudin 12 2 6
MIRT502831 CELF1 CUGBP Elav-like family member 1 2 2
MIRT505007 ZNF644 zinc finger protein 644 2 2
MIRT505571 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506930 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507238 FIGN fidgetin, microtubule severing factor 2 8
MIRT507680 COIL coilin 2 6
MIRT508394 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508658 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508925 AK4 adenylate kinase 4 2 4
MIRT510382 ZNF566 zinc finger protein 566 2 6
MIRT511379 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512738 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT516076 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT520035 YOD1 YOD1 deubiquitinase 2 6
MIRT521379 RDX radixin 2 4
MIRT523609 FZD9 frizzled class receptor 9 2 4
MIRT523970 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524100 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525720 SOD2 superoxide dismutase 2 2 2
MIRT529720 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533174 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536371 LEFTY1 left-right determination factor 1 2 2
MIRT541383 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT542687 SALL3 spalt like transcription factor 3 2 2
MIRT543861 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545380 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545851 ZNF264 zinc finger protein 264 2 4
MIRT545877 ZNF200 zinc finger protein 200 2 4
MIRT546322 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546645 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT547363 MSI2 musashi RNA binding protein 2 2 2
MIRT547564 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547828 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT548258 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548331 EPHA4 EPH receptor A4 2 2
MIRT548526 DUSP1 dual specificity phosphatase 1 2 2
MIRT549016 CBX5 chromobox 5 2 2
MIRT549200 BEND4 BEN domain containing 4 2 4
MIRT549756 ZNF611 zinc finger protein 611 2 6
MIRT549792 KIAA0391 KIAA0391 2 2
MIRT549840 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550720 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550891 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551276 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551311 GSG2 histone H3 associated protein kinase 2 6
MIRT551925 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552403 ZNF460 zinc finger protein 460 2 4
MIRT552463 ZNF280B zinc finger protein 280B 2 2
MIRT555533 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555692 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT555697 PDZD8 PDZ domain containing 8 2 2
MIRT556036 MXD1 MAX dimerization protein 1 2 2
MIRT556264 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT557366 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557947 FAM222B family with sequence similarity 222 member B 2 2
MIRT558792 CDV3 CDV3 homolog 2 2
MIRT561769 PEG10 paternally expressed 10 2 2
MIRT564395 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565223 TRIM71 tripartite motif containing 71 2 2
MIRT565437 SURF4 surfeit 4 2 2
MIRT566494 PBX2P1 PBX homeobox 2 pseudogene 1 2 2
MIRT566511 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567315 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT567708 E2F6 E2F transcription factor 6 2 2
MIRT568320 BACH1 BTB domain and CNC homolog 1 2 2
MIRT568644 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569491 THYN1 thymocyte nuclear protein 1 2 2
MIRT573813 TGOLN2 trans-golgi network protein 2 2 2
MIRT574356 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574744 GOLGA4 golgin A4 2 2
MIRT576071 Poteg POTE ankyrin domain family, member G 2 2
MIRT576789 Thbs1 thrombospondin 1 2 3
MIRT616363 RWDD1 RWD domain containing 1 2 2
MIRT642387 ZNF556 zinc finger protein 556 2 2
MIRT650257 ARHGAP22 Rho GTPase activating protein 22 2 2
MIRT680512 PRIM2 DNA primase subunit 2 2 2
MIRT680540 ZNF584 zinc finger protein 584 2 2
MIRT680831 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681264 RFC2 replication factor C subunit 2 2 2
MIRT681352 BRI3BP BRI3 binding protein 2 2
MIRT681499 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681529 ZNF738 zinc finger protein 738 2 2
MIRT681651 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681755 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681790 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681935 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682095 ITGA3 integrin subunit alpha 3 2 4
MIRT682174 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682231 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682378 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682589 CPA4 carboxypeptidase A4 2 2
MIRT682633 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689320 FPR1 formyl peptide receptor 1 2 2
MIRT689723 ATXN2 ataxin 2 2 2
MIRT691029 ZNF799 zinc finger protein 799 2 2
MIRT691928 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694877 ZNF417 zinc finger protein 417 2 2
MIRT695248 ZNF443 zinc finger protein 443 2 2
MIRT701422 NHLRC2 NHL repeat containing 2 2 2
MIRT701992 MIER3 MIER family member 3 2 2
MIRT702477 KIAA1328 KIAA1328 2 2
MIRT702701 IPO9 importin 9 2 2
MIRT704022 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT712363 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT712448 KHNYN KH and NYN domain containing 2 2
MIRT713513 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731769 PDCD4 programmed cell death 4 3 1
MIRT733048 TLR4 toll like receptor 4 1 0
MIRT733831 BDNF brain derived neurotrophic factor 3 0
MIRT737334 HK2 hexokinase 2 3 0
MIRT756084 MMP11 matrix metallopeptidase 11 3 1
MIRT756086 FN1 fibronectin 1 2 1
MIRT756087 COL6A1 collagen type VI alpha 1 chain 2 1
MIRT756088 COL6A2 collagen type VI alpha 2 chain 2 1
MIRT756089 COL6A3 collagen type VI alpha 3 chain 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-202 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 up-regulated
miR-202 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-202 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-202 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-202 4-hydroxynonenal NULL 5283344 Quantitative real-time PCR human leukemic HL-60 cell 19022373 2009 down-regulated
miR-202-3p (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-202 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-202-3p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-202-3p (2Z)-N-(2,4-dimethylphenyl)-3-(6-nitro-3-oxo-4H-quinoxalin-2-yl)-2-[(2-pyridin-1-ium-1-ylacetyl)hydrazinylidene]propanamide 5918855 NSC649808 sensitive
hsa-miR-202-3p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-202-3p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-202-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-methyl- 261066 NSC92937 sensitive
hsa-miR-202-3p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-202-3p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-202-3p 2-methylolivacinium acetate 5458752 NSC336003 resistant
hsa-miR-202-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-202-3p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-202-3p 3-iodoacetamido-benzoic acid ethyl ester 398530 NSC708445 sensitive
hsa-miR-202-3p 3,4,8-trimethyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381508 NSC668264 sensitive
hsa-miR-202-3p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-202-3p 6-(aziridin-1-yl)-7-methoxy-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazole-5,8-dione 383842 NSC672472 sensitive
hsa-miR-202-3p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-202-3p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-202-3p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-202-3p 8-azadenosine 251928 NSC72961 sensitive
hsa-miR-202-3p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-202-3p 9-methoxy-2-methylellipticinium iodide 3086380 NSC155693 resistant
hsa-miR-202-3p Antineoplastic-651590 6369039 NSC651590 sensitive
hsa-miR-202-3p Basic fuchsin 12447 NSC10466 resistant
hsa-miR-202-3p Eh00008 354026 NSC603974 sensitive
hsa-miR-202-3p Go-y103 1352182 NSC677240 sensitive
hsa-miR-202-3p Incarnal 131851 NSC648322 sensitive
hsa-miR-202-3p Kahalide f 9898671 NSC668814 resistant
hsa-miR-202-3p Kuc110490n 377410 NSC658853 sensitive
hsa-miR-202-3p M-232 403374 NSC718170 sensitive
hsa-miR-202-3p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-202-3p Methanesulfonate;2,3,8,9,12-pentamethoxy-5-methylbenzo[c]phenanthridin-5-ium 21144847 NSC344688 resistant
hsa-miR-202-3p Methyl (1S,4S)-6,11-dioxo-4-[3,4,5-triacetyloxy-6-(acetyloxymethyl)oxan-2-yl]oxy-1,4-dihydropyridazino[1,2-b]phthalazine-1-carboxylate 385569 NSC676858 sensitive
hsa-miR-202-3p Mp 317 16683647 NSC30916 sensitive
hsa-miR-202-3p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-202-3p P-fuchsin 11292 NSC10460 resistant
hsa-miR-202-3p Prumycin 5458561 NSC278619 resistant
hsa-miR-202-3p Stl338719 393017 NSC694265 resistant
hsa-miR-202-3p Tributyrin 6050 NSC661583 sensitive
hsa-miR-202-3p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-202-3p Xnivbtjmwlisex-djkkodmxsa-n 9571538 NSC681776 resistant
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-202-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (HS-5)
hsa-miR-202-3p Doxorubicin 31703 NSC123127 approved resistant Low Osteosarcoma cell line (U-2-OS, G293)
hsa-miR-202-3p Doxorubicin 31703 NSC123127 approved resistant Low Osteosarcoma cell line (U-2-OS, G293)
hsa-miR-202-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (U-266)
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line
hsa-miR-202-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-202-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-202-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-202-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-202-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (NCI-H441, A549)
hsa-miR-202-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-202-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-202-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-202-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-202-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-202-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-202-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission