miRTarBase - #MIRT068846


—
pre-miRNA Information
pre-miRNA hsa-mir-144   
Genomic Coordinates chr17: 28861533 - 28861618
Description Homo sapiens miR-144 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-144-3p
Sequence 52| UACAGUAUAGAUGAUGUACU |71
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs947719319 4 dbSNP
rs917554219 5 dbSNP
rs1218721253 6 dbSNP
rs760366230 9 dbSNP
rs1293385306 15 dbSNP
rs1463482751 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FNDC3A   
Synonyms FNDC3, HUGO, bA203I16.1, bA203I16.5
Description fibronectin type III domain containing 3A
Transcript NM_001079673   
Other Transcripts NM_014923   
Expression
Putative miRNA Targets on FNDC3A
3'UTR of FNDC3A
(miRNA target sites are highlighted)		 
>FNDC3A|NM_001079673|3'UTR
   1 AAATATAACTTTATTTTTTAACTCTATTACATTTTATTTTGTCATGTACTAAAATTATTTCTGTATTGCTTTTATAAAAA
  81 ACAGTGGCATTTAGCACTGGCATTGAGACTATAGCACATCATTTTTGCCATTTTCAGTGCTTATATTGTTAGGTAGAGGC
 161 TGGCACTTTATTAGAATGCAAGCCACAAAAATATCAATTTTGTTTTTTTTGTTAGGGTGGGTCTTCTTTTTTTCTTTCCC
 241 TCTCTCTTTTTTTAACAAATGCCTTCTTATAGAAAAACTTTCTAAGAGGCAACAATTTAGAATGGATATTTTGACGAATC
 321 GGCATGAGTGTAACAGTGATAACCTGATCTGTTTGTTTTAAAGATTATTACCAAGTGAAAAATTCAGAATGAATAGAATT
 401 TACACTAACATGCTATATAAAATGTTAAAGTCTGATGCTGTGAAAGCAATCTAGTGCTATATTTCTACCTCCTCATTTGT
 481 CTTAATTATTTGGTAAGTGGGATTATGATGAGTAACTGGAGGGGCTTAGAAACAAAAACTGGATGAAAGAGTATGCATGA
 561 AGAAAAGCTTCTTTGATAAATGTGGAGTTCTTCATTATAAATATATATTCATGAATTCACAGATAAGTACTTAAAGAACA
 641 GACAGTTTACTTGGCCTAAAAATATTTTGATGTTTACTCAAAAAGTACCTCTTCAGGTCTTGAGAACATGGAAAAGAATT
 721 GAGTGCTTTTAAATACTTTTTAGAAAGTAATCATAAAAGTAAATTGAATTTCAAACCTATTTGGCTTCTGTTTTGTGAAC
 801 CTTTGAACTATATGTATGTGTATAAGGGTATACACATACATATATGGCATATAACAAGTGTACACATATACACATAACAA
 881 GTGTAGAAGTATATATTACATACATACACTCACTCTGTCTGGTATAGGCTAATTTTGAAGAACTCCCATAAGTTTCTGCT
 961 GCTTCTCCCATAACTGCTGCCACCACCATCAGAATTCATAATCAAACCTAACCTTTTTGTTTGGGGCACCAAATCTGAAG
1041 ACAAAATTAATTTGCACCAGTAAACTTCAAGCTGCTTTCTTTCTTGAAAACTAAACGTTTAACGTATAATGTCTGTTTGG
1121 ATACTGTTCCAAATTGTTGATTGCATGTGGTTAATGTTGCATTAGAGCACTTTGCAATTGCATAATTCATTAATGTTTTG
1201 TGAGCTTGCATTTGTGAGTTATTGGATGATCAGACTGAATTTTGTCAAGTATCACATTGTACATCTTGCCTAGATGTCGA
1281 TGACTGCAAGTAATAATACAGTTTATAATGAAACTATCTACAATTCTTGTTTTAGCACATCTGTTATCCGTAAAACACCT
1361 GTAACTAGCTTTTTTAATTTATTATTTGAATTTTAGGATAGCGAATCACTAATTTTTAGTTGCTGAGGTTGGCATTTTAG
1441 TGATTATTAAGCACTTCTGTCAGTCTTTGAAAAAAGAACGTATTTTTTGTGCTTTGAAGATCTCTGAAGAATTTCTTTTA
1521 TAATAGAATGGGCATGTATTGTAACAGTTTTATGTCAAATGATCTGTGCTGTAGAAAAACATTAACCCTTGTTCAAAAAA
1601 GAAATGGATAAACTTGGCCTTTCTAAGTGGTAAGAATGACCTGTCACTATAATATACTGTATGTTTACATTTTATTTAAA
1681 TTTAATCTCTTATGTATAGGGTGATAACCTTCCCCAGAAACAACAGTGATTGCGATTGTTTTCTAGAAACTTCTTTAAAG
1761 TGCCACATTTGGCAGTACAAATGAGTCTGAGTGTAATAGCCCAGAGATTTATATATAGTTGAATGTCTAAAATGGTAAAA
1841 TGTGCCACTGTGTCAAGTTACAGTGGCTTATGTTTTTCATAGTAATTCAAATGAACTTCCTATTTTTGATAGTAAATGTC
1921 ATTTAATAGTATACTTGCCATTTGAGCCTCACTGCAAAATTAGTGCAGAGGAGAAAACAATTTTTAATGTAATCTTGATT
2001 TTACCTCATATACTGTACATTCCAAAAACTCTAAACTTTTTAAAGATTATAGATACACTACCAAACATATCACCTTAAAA
2081 TTGTATAAGGCTGAATGAACTTCATACAAATGAAAAAAATCTCATAAAAATACATAAACTATGTAGCAAAAGTATCTGTA
2161 AAATCCATGGAAAATAAAAGTTGTATCATTCTTTTTGAGATACGTTTATTGTATTCATATATATTCATTATTTGCTACCT
2241 GTTTAAGAAAGTGAAATGTTATGGTCTCCCCTCTTCCAATGAGCTTAAAACATTTTTCCCAACAGTATATAAATCTTCAA
2321 CATGAGAGGATGTATATTTATTATATAAAGCCCAGTAAAGAATAAAATTAGAAGTTTTATCCTAAAAAAAAAAAAAAAAA
2401 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucAUGUAGUAGAUAUGACAu 5'
            ||| |||  |||||||| 
Target 5' ttTACCTCA--TATACTGTa 3'
 2000 - 2017 162.00 -10.90
2 
miRNA  3' ucAUGUAGUAGA------UAUGACAu 5'
            ||:| ::|||      ||||||| 
Target 5' cgTATAATGTCTGTTTGGATACTGTt 3'
 1103 - 1128 152.00 -10.90
3 
miRNA  3' ucauGUAGUA-GAUAUGACAu 5'
              || :||  |||||||| 
Target 5' ctgtCACTATAATATACTGTa 3'
 1641 - 1661 152.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31546457 25 COSMIC
COSN31557500 50 COSMIC
COSN30127192 82 COSMIC
COSN30164003 122 COSMIC
COSN31609029 277 COSMIC
COSN2515761 476 COSMIC
COSN31523296 567 COSMIC
COSN31595632 1046 COSMIC
COSN31516929 1105 COSMIC
COSN26566349 1116 COSMIC
COSN31597223 1146 COSMIC
COSN18932649 1199 COSMIC
COSN31481445 1236 COSMIC
COSN25082685 1295 COSMIC
COSN14464554 1311 COSMIC
COSN31580040 1448 COSMIC
COSN31521824 1588 COSMIC
COSN8587651 1617 COSMIC
COSN24304763 1648 COSMIC
COSN31607469 1688 COSMIC
COSN6230709 1731 COSMIC
COSN31568888 1820 COSMIC
COSN8130358 1849 COSMIC
COSN26562104 1919 COSMIC
COSN31482803 1951 COSMIC
COSN29249782 2021 COSMIC
COSN15006944 2062 COSMIC
COSN8593838 2094 COSMIC
COSN8593839 2096 COSMIC
COSN28688976 2104 COSMIC
COSN31585357 2122 COSMIC
COSN19155495 2144 COSMIC
COSN31522068 2260 COSMIC
rs78036026 1685 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1352851534 7 dbSNP
rs754451177 8 dbSNP
rs746098463 10 dbSNP
rs772277972 14 dbSNP
rs1367455621 21 dbSNP
rs755482378 22 dbSNP
rs1280453915 23 dbSNP
rs947974623 27 dbSNP
rs1319640403 29 dbSNP
rs774943742 31 dbSNP
rs752421160 35 dbSNP
rs758426536 41 dbSNP
rs1207503223 42 dbSNP
rs1271776135 45 dbSNP
rs779419790 49 dbSNP
rs761663370 51 dbSNP
rs1279046863 54 dbSNP
rs1044957591 66 dbSNP
rs1184089044 76 dbSNP
rs1369983115 86 dbSNP
rs561250772 92 dbSNP
rs531786813 96 dbSNP
rs755930983 97 dbSNP
rs938667583 103 dbSNP
rs141788700 104 dbSNP
rs1219355608 114 dbSNP
rs1354841343 116 dbSNP
rs1385943836 117 dbSNP
rs1301326907 118 dbSNP
rs763683040 129 dbSNP
rs909674962 130 dbSNP
rs1360166735 131 dbSNP
rs941196120 137 dbSNP
rs1039951496 140 dbSNP
rs1334814639 146 dbSNP
rs899709177 149 dbSNP
rs1171935668 152 dbSNP
rs933918579 153 dbSNP
rs1453987293 156 dbSNP
rs1317702727 160 dbSNP
rs891891994 165 dbSNP
rs963420582 167 dbSNP
rs1484014221 172 dbSNP
rs9535168 175 dbSNP
rs1237880575 178 dbSNP
rs973523712 180 dbSNP
rs1051735486 187 dbSNP
rs1010293810 195 dbSNP
rs1238772932 196 dbSNP
rs1310648375 198 dbSNP
rs1230293265 201 dbSNP
rs1031087734 203 dbSNP
rs77866027 206 dbSNP
rs1445043930 208 dbSNP
rs1402824089 220 dbSNP
rs532174503 221 dbSNP
rs547592739 222 dbSNP
rs904691561 225 dbSNP
rs969641100 227 dbSNP
rs565767256 235 dbSNP
rs982759311 238 dbSNP
rs568674154 240 dbSNP
rs1417158126 246 dbSNP
rs1239776593 247 dbSNP
rs200960754 247 dbSNP
rs1467959697 249 dbSNP
rs1263800547 258 dbSNP
rs1223909842 262 dbSNP
rs1322342414 268 dbSNP
rs1283829747 274 dbSNP
rs1018930008 286 dbSNP
rs951049667 287 dbSNP
rs186906470 290 dbSNP
rs1440869158 302 dbSNP
rs1473712091 316 dbSNP
rs536127930 317 dbSNP
rs1174459340 321 dbSNP
rs1025278980 322 dbSNP
rs951142210 325 dbSNP
rs1157750544 328 dbSNP
rs1417469366 328 dbSNP
rs1381995116 331 dbSNP
rs983794404 333 dbSNP
rs975248445 337 dbSNP
rs1394929784 349 dbSNP
rs921108875 368 dbSNP
rs1391227755 376 dbSNP
rs1488886129 378 dbSNP
rs909758174 384 dbSNP
rs1241581785 400 dbSNP
rs1214778768 403 dbSNP
rs1356082650 416 dbSNP
rs947880529 417 dbSNP
rs1286956934 425 dbSNP
rs1337864007 431 dbSNP
rs1234046234 433 dbSNP
rs980740999 437 dbSNP
rs933866919 441 dbSNP
rs1229860348 448 dbSNP
rs756758602 450 dbSNP
rs1397796904 452 dbSNP
rs924560425 452 dbSNP
rs1322298090 468 dbSNP
rs535301563 470 dbSNP
rs1158828227 489 dbSNP
rs1257732913 489 dbSNP
rs1465361190 491 dbSNP
rs1224480451 498 dbSNP
rs1375715718 502 dbSNP
rs1178215375 505 dbSNP
rs1433680195 508 dbSNP
rs1057444163 509 dbSNP
rs1191631627 513 dbSNP
rs1195113042 513 dbSNP
rs1489282407 522 dbSNP
rs745399063 524 dbSNP
rs891765097 525 dbSNP
rs946154064 526 dbSNP
rs1483878733 530 dbSNP
rs554486537 542 dbSNP
rs1258124876 543 dbSNP
rs1234665780 547 dbSNP
rs185674639 549 dbSNP
rs1216281292 552 dbSNP
rs1341759710 557 dbSNP
rs572757939 584 dbSNP
rs1428855274 588 dbSNP
rs1011422790 596 dbSNP
rs1480827437 610 dbSNP
rs1043157229 612 dbSNP
rs376342091 614 dbSNP
rs905342356 623 dbSNP
rs1399858541 628 dbSNP
rs1371355320 629 dbSNP
rs1304334070 638 dbSNP
rs1466322345 641 dbSNP
rs1399482350 642 dbSNP
rs1168374939 644 dbSNP
rs536650112 647 dbSNP
rs1187180929 651 dbSNP
rs1299178467 657 dbSNP
rs540207663 662 dbSNP
rs558326667 672 dbSNP
rs1258750986 687 dbSNP
rs1201420723 690 dbSNP
rs1480483656 691 dbSNP
rs1403479519 699 dbSNP
rs1300984927 700 dbSNP
rs1319455756 701 dbSNP
rs1018421025 706 dbSNP
rs951640245 709 dbSNP
rs1344447560 712 dbSNP
rs1386897258 717 dbSNP
rs1003794967 719 dbSNP
rs1314367784 720 dbSNP
rs1396402533 727 dbSNP
rs116786152 744 dbSNP
rs962462452 748 dbSNP
rs1226618227 754 dbSNP
rs975554230 771 dbSNP
rs1401185699 784 dbSNP
rs1251799372 798 dbSNP
rs1456424673 808 dbSNP
rs1370444637 811 dbSNP
rs1188441410 813 dbSNP
rs1344125363 815 dbSNP
rs921045444 817 dbSNP
rs1236714668 821 dbSNP
rs1268510370 834 dbSNP
rs998413752 835 dbSNP
rs955379841 837 dbSNP
rs1025734126 838 dbSNP
rs1208747145 840 dbSNP
rs1353573240 845 dbSNP
rs1266846345 848 dbSNP
rs1427934797 849 dbSNP
rs924486755 851 dbSNP
rs1171803237 853 dbSNP
rs1448960013 868 dbSNP
rs1377601218 870 dbSNP
rs1322762293 874 dbSNP
rs951048024 878 dbSNP
rs1423180901 883 dbSNP
rs1052408259 886 dbSNP
rs1419301218 902 dbSNP
rs369395212 907 dbSNP
rs573153514 907 dbSNP
rs1005291498 910 dbSNP
rs545241790 917 dbSNP
rs1366535452 920 dbSNP
rs946763691 920 dbSNP
rs1458098454 922 dbSNP
rs1294860042 923 dbSNP
rs549057635 949 dbSNP
rs1449439681 950 dbSNP
rs969216593 962 dbSNP
rs1268826936 970 dbSNP
rs1222835442 971 dbSNP
rs981029435 974 dbSNP
rs927788051 975 dbSNP
rs1242084251 976 dbSNP
rs757703826 979 dbSNP
rs568650781 989 dbSNP
rs988075715 991 dbSNP
rs1274190592 992 dbSNP
rs1434192198 1008 dbSNP
rs1332954292 1014 dbSNP
rs1367241806 1019 dbSNP
rs572711808 1020 dbSNP
rs1324245104 1022 dbSNP
rs913271700 1024 dbSNP
rs1243613256 1026 dbSNP
rs769193411 1040 dbSNP
rs1003632847 1060 dbSNP
rs776962963 1072 dbSNP
rs1300210115 1076 dbSNP
rs147082856 1079 dbSNP
rs946018259 1097 dbSNP
rs887336576 1098 dbSNP
rs561571118 1104 dbSNP
rs926047086 1105 dbSNP
rs1199552413 1114 dbSNP
rs78025430 1114 dbSNP
rs1487650070 1118 dbSNP
rs189741268 1123 dbSNP
rs962672341 1127 dbSNP
rs996563638 1128 dbSNP
rs1028481100 1136 dbSNP
rs1218260884 1143 dbSNP
rs1040283126 1147 dbSNP
rs769902663 1149 dbSNP
rs1447435824 1153 dbSNP
rs1485622902 1155 dbSNP
rs1187155668 1161 dbSNP
rs1277625613 1169 dbSNP
rs565208632 1174 dbSNP
rs901301039 1177 dbSNP
rs1250499443 1181 dbSNP
rs1283788380 1182 dbSNP
rs998882403 1183 dbSNP
rs1443352905 1184 dbSNP
rs986610369 1185 dbSNP
rs181754801 1191 dbSNP
rs1386259959 1194 dbSNP
rs1400820521 1196 dbSNP
rs1031523865 1201 dbSNP
rs1407419988 1210 dbSNP
rs1416481724 1223 dbSNP
rs1403567709 1226 dbSNP
rs1477214549 1228 dbSNP
rs1420833339 1241 dbSNP
rs1195457563 1250 dbSNP
rs1475517937 1256 dbSNP
rs186856704 1259 dbSNP
rs990049303 1264 dbSNP
rs1443870540 1269 dbSNP
rs914535493 1271 dbSNP
rs1047295130 1277 dbSNP
rs886801999 1280 dbSNP
rs1280150163 1281 dbSNP
rs1215422779 1288 dbSNP
rs980804928 1292 dbSNP
rs926661470 1297 dbSNP
rs1450360597 1306 dbSNP
rs939456152 1311 dbSNP
rs1331342466 1316 dbSNP
rs1314224725 1318 dbSNP
rs559115300 1319 dbSNP
rs1056529079 1323 dbSNP
rs1397549557 1324 dbSNP
rs1172229442 1339 dbSNP
rs1409988905 1341 dbSNP
rs529882817 1347 dbSNP
rs1229817273 1348 dbSNP
rs1473693681 1350 dbSNP
rs548032080 1351 dbSNP
rs1316538398 1370 dbSNP
rs1016529943 1376 dbSNP
rs1259870362 1382 dbSNP
rs1270132466 1385 dbSNP
rs1459988567 1391 dbSNP
rs969122111 1402 dbSNP
rs1288003132 1403 dbSNP
rs1001923676 1404 dbSNP
rs1360691842 1409 dbSNP
rs1203646155 1410 dbSNP
rs1444971939 1413 dbSNP
rs773105921 1414 dbSNP
rs1299181143 1420 dbSNP
rs1442304946 1426 dbSNP
rs1348789896 1428 dbSNP
rs192150799 1435 dbSNP
rs1473999533 1441 dbSNP
rs767316364 1447 dbSNP
rs898780169 1450 dbSNP
rs988494271 1451 dbSNP
rs1385679861 1466 dbSNP
rs996879094 1470 dbSNP
rs1437539415 1474 dbSNP
rs1239954735 1475 dbSNP
rs1027989888 1477 dbSNP
rs1175825679 1479 dbSNP
rs577239904 1480 dbSNP
rs775424569 1481 dbSNP
rs978771497 1482 dbSNP
rs536613348 1486 dbSNP
rs1413551184 1490 dbSNP
rs1467763830 1514 dbSNP
rs1007969805 1516 dbSNP
rs147757881 1516 dbSNP
rs1336078910 1523 dbSNP
rs1219142951 1525 dbSNP
rs1366346364 1529 dbSNP
rs1291256793 1530 dbSNP
rs1406205733 1530 dbSNP
rs1359641421 1536 dbSNP
rs942781361 1538 dbSNP
rs1297136300 1539 dbSNP
rs760437005 1541 dbSNP
rs1365323361 1544 dbSNP
rs990035151 1554 dbSNP
rs1021927804 1558 dbSNP
rs1193011607 1559 dbSNP
rs922795612 1564 dbSNP
rs981156577 1565 dbSNP
rs934161485 1581 dbSNP
rs1489508810 1587 dbSNP
rs779810539 1588 dbSNP
rs1210078863 1589 dbSNP
rs1310990538 1592 dbSNP
rs183278796 1593 dbSNP
rs1229253062 1607 dbSNP
rs1290427322 1608 dbSNP
rs1224833958 1617 dbSNP
rs1345524438 1619 dbSNP
rs376305028 1619 dbSNP
rs532381183 1620 dbSNP
rs748473685 1623 dbSNP
rs1289200796 1640 dbSNP
rs1465314511 1647 dbSNP
rs1357370671 1659 dbSNP
rs1280008843 1674 dbSNP
rs78036026 1685 dbSNP
rs904855882 1686 dbSNP
rs1202988347 1688 dbSNP
rs1422992764 1690 dbSNP
rs898702534 1690 dbSNP
rs1430488367 1694 dbSNP
rs1002398732 1699 dbSNP
rs1232666548 1702 dbSNP
rs1482449252 1703 dbSNP
rs1481130376 1707 dbSNP
rs932934270 1709 dbSNP
rs761723751 1712 dbSNP
rs1204860477 1717 dbSNP
rs1182526435 1722 dbSNP
rs73184694 1732 dbSNP
rs896335149 1734 dbSNP
rs572625526 1735 dbSNP
rs756804734 1739 dbSNP
rs890778785 1740 dbSNP
rs1295770628 1744 dbSNP
rs1395238719 1754 dbSNP
rs1376690588 1761 dbSNP
rs1338683836 1771 dbSNP
rs1416136292 1771 dbSNP
rs1399694699 1773 dbSNP
rs1168660443 1774 dbSNP
rs1463548134 1776 dbSNP
rs1007938676 1780 dbSNP
rs1422506111 1785 dbSNP
rs1020772733 1790 dbSNP
rs967966401 1791 dbSNP
rs1184808893 1794 dbSNP
rs563499934 1804 dbSNP
rs1457688999 1807 dbSNP
rs1168154713 1817 dbSNP
rs536847806 1828 dbSNP
rs1196220828 1841 dbSNP
rs1340772834 1842 dbSNP
rs1251593223 1843 dbSNP
rs891559702 1846 dbSNP
rs1319756031 1848 dbSNP
rs764950388 1849 dbSNP
rs1410200896 1854 dbSNP
rs1011785594 1855 dbSNP
rs1376091932 1856 dbSNP
rs1329154837 1869 dbSNP
rs1393219206 1872 dbSNP
rs1310127048 1875 dbSNP
rs964070605 1884 dbSNP
rs1162950763 1888 dbSNP
rs562642690 1891 dbSNP
rs970350399 1895 dbSNP
rs1164649182 1901 dbSNP
rs1001445609 1909 dbSNP
rs757949321 1920 dbSNP
rs780685853 1923 dbSNP
rs922690464 1926 dbSNP
rs1035594053 1942 dbSNP
rs1347130510 1947 dbSNP
rs1184591074 1959 dbSNP
rs1439103030 1966 dbSNP
rs747560422 1974 dbSNP
rs141093889 1975 dbSNP
rs1489738103 1982 dbSNP
rs1293432182 1995 dbSNP
rs1343402363 1998 dbSNP
rs1207705763 1999 dbSNP
rs1352628206 2001 dbSNP
rs1253589930 2003 dbSNP
rs1241085709 2005 dbSNP
rs1336484578 2006 dbSNP
rs992151219 2016 dbSNP
rs777596182 2017 dbSNP
rs1385117606 2019 dbSNP
rs1489734840 2031 dbSNP
rs908680690 2040 dbSNP
rs1303913609 2042 dbSNP
rs1197676937 2046 dbSNP
rs184888601 2049 dbSNP
rs1340879552 2055 dbSNP
rs1038582822 2059 dbSNP
rs367568346 2062 dbSNP
rs1160850947 2071 dbSNP
rs372270169 2075 dbSNP
rs1377519515 2086 dbSNP
rs1197577058 2088 dbSNP
rs1270602491 2096 dbSNP
rs1056511386 2102 dbSNP
rs961484907 2113 dbSNP
rs1487874184 2115 dbSNP
rs1281860587 2120 dbSNP
rs1430219319 2120 dbSNP
rs1170273761 2121 dbSNP
rs1206871152 2121 dbSNP
rs543790123 2125 dbSNP
rs1363438447 2132 dbSNP
rs1351354111 2133 dbSNP
rs896250238 2135 dbSNP
rs974621380 2136 dbSNP
rs755392320 2142 dbSNP
rs1324381532 2147 dbSNP
rs1332965633 2159 dbSNP
rs1400893214 2171 dbSNP
rs565269171 2177 dbSNP
rs932839440 2182 dbSNP
rs1050009049 2184 dbSNP
rs1320726212 2192 dbSNP
rs1428718325 2204 dbSNP
rs577212031 2205 dbSNP
rs1292869026 2207 dbSNP
rs1430772464 2212 dbSNP
rs541515222 2222 dbSNP
rs1199760266 2223 dbSNP
rs1366531604 2224 dbSNP
rs943653261 2225 dbSNP
rs1052773820 2234 dbSNP
rs891528378 2239 dbSNP
rs1011338690 2245 dbSNP
rs1043226321 2245 dbSNP
rs1325810320 2251 dbSNP
rs1263796210 2262 dbSNP
rs559420932 2263 dbSNP
rs529796028 2271 dbSNP
rs1272088101 2275 dbSNP
rs1431937157 2279 dbSNP
rs530150260 2280 dbSNP
rs1332836314 2285 dbSNP
rs1471231311 2286 dbSNP
rs1208888329 2287 dbSNP
rs547995332 2290 dbSNP
rs1035561553 2299 dbSNP
rs903685227 2305 dbSNP
rs1407712797 2307 dbSNP
rs1176567645 2308 dbSNP
rs781727270 2311 dbSNP
rs1464608053 2320 dbSNP
rs1416970195 2321 dbSNP
rs1290138027 2331 dbSNP
rs1169224590 2335 dbSNP
rs189695831 2350 dbSNP
rs1190367002 2351 dbSNP
rs1230048881 2355 dbSNP
rs1181719706 2361 dbSNP
rs1017508206 2369 dbSNP
rs530810548 2379 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000492622.2 | 3UTR | UAAUCUUGAUUUUACCUCAUAUACUGUACAUUCCAAAAACUCUAAACUUUUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.632 1.4e-3 0.719 1.8e-4 20 Click to see details
GSE28544 Breast cancer -0.574 1.7e-3 -0.365 4.0e-2 24 Click to see details
GSE28260 Renal cortex and medulla 0.622 1.2e-2 0.533 3.0e-2 13 Click to see details
GSE19783 ER- ER- breast cancer -0.237 1.8e-2 -0.251 1.3e-2 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.392 2.6e-2 -0.543 2.5e-3 25 Click to see details
GSE27834 Pluripotent stem cells 0.445 4.2e-2 0.368 8.0e-2 16 Click to see details
GSE21849 B cell lymphoma -0.298 5.8e-2 0.036 4.3e-1 29 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.764 6.6e-2 -0.600 1.4e-1 5 Click to see details
GSE21687 Ependynoma primary tumors 0.186 7.1e-2 0.032 4.0e-1 64 Click to see details
GSE17498 Multiple myeloma 0.221 8.5e-2 0.255 5.6e-2 40 Click to see details
GSE38226 Liver fibrosis 0.301 9.2e-2 0.235 1.5e-1 21 Click to see details
GSE21032 Prostate cancer 0.144 9.7e-2 0.121 1.4e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.292 1.1e-1 0.304 9.6e-2 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.201 1.8e-1 0.122 2.9e-1 23 Click to see details
GSE19536 Breast cancer -0.075 2.3e-1 -0.109 1.4e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.148 2.4e-1 0.227 1.4e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.075 2.4e-1 0.006 4.8e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.116 2.6e-1 -0.152 2.0e-1 32 Click to see details
GSE17306 Multiple myeloma -0.077 3.0e-1 0.160 1.4e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.048 4.1e-1 -0.098 3.2e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.02 4.8e-1 -0.042 4.5e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.817 0 0.717 0.01 9 Click to see details
HNSC -0.283 0.03 -0.284 0.03 42 Click to see details
PRAD 0.254 0.04 0.184 0.11 48 Click to see details
UCEC 0.402 0.05 0.249 0.16 18 Click to see details
ESCA 0.472 0.07 0.127 0.35 11 Click to see details
KIRC 0.159 0.1 0.155 0.1 68 Click to see details
PAAD -0.774 0.11 -1.000 0.5 4 Click to see details
BRCA -0.119 0.16 -0.107 0.18 74 Click to see details
KIRP -0.157 0.2 -0.118 0.26 32 Click to see details
BLCA -0.226 0.2 -0.285 0.14 16 Click to see details
THCA -0.104 0.22 -0.103 0.22 59 Click to see details
PCPG 0.731 0.24 0.500 0.33 3 Click to see details
LUAD -0.15 0.32 -0.112 0.36 12 Click to see details
KICH -0.081 0.35 -0.005 0.49 25 Click to see details
LIHC -0.043 0.38 -0.025 0.43 49 Click to see details
LUSC 0.039 0.41 0.001 0.5 38 Click to see details
CESC -0.177 0.44 -0.500 0.33 3 Click to see details
STAD -0.005 0.49 0.111 0.27 32 Click to see details
STAD -0.005 0.49 0.111 0.27 32 Click to see details
STAD -0.005 0.49 0.111 0.27 32 Click to see details
204 hsa-miR-144-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003058 PLAG1 PLAG1 zinc finger 2 1
MIRT005523 FGG fibrinogen gamma chain 2 1
MIRT005529 FGA fibrinogen alpha chain 2 1
MIRT005530 FGB fibrinogen beta chain 2 1
MIRT005869 NOTCH1 notch 1 4 2
MIRT006114 TGFB1 transforming growth factor beta 1 4 1
MIRT006872 MTOR mechanistic target of rapamycin kinase 7 3
MIRT007190 PTEN phosphatase and tensin homolog 3 1
MIRT007310 NFE2L2 nuclear factor, erythroid 2 like 2 1 1
MIRT053494 ZFX zinc finger protein, X-linked 6 5
MIRT054058 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054851 TTN titin 3 1
MIRT057677 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT065418 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT066720 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT066784 ARID1A AT-rich interaction domain 1A 2 2
MIRT067387 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 4
MIRT068846 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT069645 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT069657 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT071717 CCNK cyclin K 2 2
MIRT073564 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT080720 ZCCHC2 zinc finger CCHC-type containing 2 2 4
MIRT090617 PLS1 plastin 1 2 2
MIRT097062 TNPO1 transportin 1 2 4
MIRT102618 UBN2 ubinuclein 2 2 4
MIRT118769 FAM217B family with sequence similarity 217 member B 2 6
MIRT147282 KPNA2 karyopherin subunit alpha 2 2 10
MIRT159513 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT196438 TAOK1 TAO kinase 1 2 2
MIRT211238 FGF2 fibroblast growth factor 2 2 2
MIRT220422 MKLN1 muskelin 1 2 2
MIRT223668 FZD6 frizzled class receptor 6 2 6
MIRT223805 OXR1 oxidation resistance 1 2 2
MIRT238585 NLN neurolysin 2 2
MIRT238652 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT247188 BTG2 BTG anti-proliferation factor 2 2 6
MIRT249185 AKIRIN1 akirin 1 2 8
MIRT252653 LSM14A LSM14A, mRNA processing body assembly factor 2 4
MIRT305624 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT315671 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 6
MIRT366555 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT403294 ZNF207 zinc finger protein 207 2 2
MIRT405966 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT437437 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 5 1
MIRT438343 MET MET proto-oncogene, receptor tyrosine kinase 5 1
MIRT444395 ZNF480 zinc finger protein 480 2 2
MIRT445255 SEMA5A semaphorin 5A 2 2
MIRT445309 MLANA melan-A 2 2
MIRT449020 ANKRD12 ankyrin repeat domain 12 2 2
MIRT452136 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT459438 PPIC peptidylprolyl isomerase C 2 2
MIRT460471 MMS22L MMS22 like, DNA repair protein 2 2
MIRT461294 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT462948 ZNF800 zinc finger protein 800 2 12
MIRT463489 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT463846 WRN Werner syndrome RecQ like helicase 2 2
MIRT466183 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466882 STX16 syntaxin 16 2 2
MIRT468156 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468259 SFXN4 sideroflexin 4 2 2
MIRT469660 RAC1 Rac family small GTPase 1 2 10
MIRT470040 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT470552 COASY Coenzyme A synthase 2 2
MIRT472208 NGFRAP1 brain expressed X-linked 3 2 4
MIRT472555 NACC1 nucleus accumbens associated 1 2 4
MIRT473462 MCL1 MCL1, BCL2 family apoptosis regulator 2 2
MIRT473925 LYSMD3 LysM domain containing 3 2 4
MIRT474068 LMNB2 lamin B2 2 2
MIRT475079 ITSN2 intersectin 2 2 4
MIRT475286 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475570 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT477516 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478464 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478920 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479338 CERK ceramide kinase 2 2
MIRT480578 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480915 BCL2L11 BCL2 like 11 4 3
MIRT481532 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT481681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT481724 APPBP2 amyloid beta precursor protein binding protein 2 2 6
MIRT481938 ANKRD11 ankyrin repeat domain 11 2 12
MIRT487099 C2orf44 WD repeat and coiled coil containing 2 2
MIRT489294 RBM8A RNA binding motif protein 8A 2 8
MIRT492255 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493268 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT494770 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT496257 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497713 ZNF645 zinc finger protein 645 2 2
MIRT498027 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT499292 TSPYL1 TSPY like 1 2 2
MIRT500105 SLC46A3 solute carrier family 46 member 3 2 2
MIRT501020 SPATA2 spermatogenesis associated 2 2 6
MIRT501816 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502296 GNG12 G protein subunit gamma 12 2 6
MIRT502493 FAM122B family with sequence similarity 122B 2 8
MIRT503948 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT504266 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504370 ARID1B AT-rich interaction domain 1B 2 6
MIRT505125 YOD1 YOD1 deubiquitinase 2 4
MIRT506052 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT506481 MYO5A myosin VA 2 6
MIRT506967 HOXA10 homeobox A10 2 6
MIRT507728 CLIC4 chloride intracellular channel 4 2 4
MIRT513081 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513570 FKBP14 FK506 binding protein 14 2 2
MIRT513631 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513692 RNF111 ring finger protein 111 2 2
MIRT513764 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT520786 TBX18 T-box 18 2 4
MIRT523402 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525719 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT527750 NANOGNB NANOG neighbor homeobox 2 2
MIRT532823 ZNF827 zinc finger protein 827 2 2
MIRT534603 RORA RAR related orphan receptor A 2 2
MIRT535762 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536346 LEFTY1 left-right determination factor 1 2 2
MIRT543081 APP amyloid beta precursor protein 2 2
MIRT544064 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545424 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546238 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT546324 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547361 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547539 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548062 GOLGA7 golgin A7 2 2
MIRT549248 ATXN1L ataxin 1 like 2 4
MIRT549250 ATXN1 ataxin 1 2 2
MIRT549467 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549937 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT551489 TMEM192 transmembrane protein 192 2 4
MIRT552564 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553688 TFAP4 transcription factor AP-4 2 4
MIRT553951 STAMBP STAM binding protein 2 2
MIRT554163 SLC7A2 solute carrier family 7 member 2 2 4
MIRT554477 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554918 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555003 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555109 PURB purine rich element binding protein B 2 2
MIRT555445 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555535 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556092 MORC3 MORC family CW-type zinc finger 3 2 2
MIRT556571 LIFR LIF receptor alpha 2 2
MIRT556936 INO80D INO80 complex subunit D 2 4
MIRT558176 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT558368 DIDO1 death inducer-obliterator 1 2 4
MIRT558464 DCUN1D1 defective in cullin neddylation 1 domain containing 1 2 2
MIRT559236 BICD2 BICD cargo adaptor 2 2 4
MIRT560099 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560725 ZNF749 zinc finger protein 749 2 2
MIRT561142 SPAG1 sperm associated antigen 1 2 2
MIRT561721 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562484 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT562681 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT564997 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565068 USP25 ubiquitin specific peptidase 25 2 2
MIRT565184 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565946 RREB1 ras responsive element binding protein 1 2 2
MIRT566315 POU2F1 POU class 2 homeobox 1 2 2
MIRT566435 PHF3 PHD finger protein 3 2 2
MIRT566485 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566612 NR3C1 nuclear receptor subfamily 3 group C member 1 4 2
MIRT566761 MOB4 MOB family member 4, phocein 2 2
MIRT566867 LRRC1 leucine rich repeat containing 1 2 2
MIRT567232 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT567245 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567292 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT568426 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT570705 FAM69A family with sequence similarity 69 member A 2 2
MIRT570931 ZNF284 zinc finger protein 284 2 2
MIRT571631 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT571647 SIX4 SIX homeobox 4 2 2
MIRT574274 ZNF350 zinc finger protein 350 2 2
MIRT574304 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574614 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT574843 CADM1 cell adhesion molecule 1 2 2
MIRT608128 TSC22D2 TSC22 domain family member 2 2 2
MIRT648849 WNT7A Wnt family member 7A 2 2
MIRT687559 MLEC malectin 2 2
MIRT696548 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697517 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701146 PANK1 pantothenate kinase 1 2 2
MIRT704284 DENND5B DENN domain containing 5B 2 2
MIRT704541 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT707687 GPR50 G protein-coupled receptor 50 2 2
MIRT707810 TSPAN6 tetraspanin 6 2 2
MIRT710019 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712705 TEX9 testis expressed 9 2 2
MIRT731264 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT731606 SMAD4 SMAD family member 4 1 1
MIRT731688 MAP3K8 mitogen-activated protein kinase kinase kinase 8 3 1
MIRT731796 ZEB1 zinc finger E-box binding homeobox 1 3 1
MIRT731798 ZEB2 zinc finger E-box binding homeobox 2 3 1
MIRT732183 PTGS2 prostaglandin-endoperoxide synthase 2 3 1
MIRT732711 ADAM10 ADAM metallopeptidase domain 10 4 0
MIRT732936 HGF hepatocyte growth factor 1 0
MIRT733214 TLR2 toll like receptor 2 2 0
MIRT734500 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
MIRT734637 RPE ribulose-5-phosphate-3-epimerase 2 0
MIRT735650 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 0
MIRT736975 BCL6 B-cell CLL/lymphoma 6 3 0
MIRT737058 FBXW7 F-box and WD repeat domain containing 7 3 0
MIRT737435 CLK3 CDC like kinase 3 2 0
MIRT755765 FOXO1 forkhead box O1 3 1
MIRT755949 ONECUT2 one cut homeobox 2 7 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-144 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-144 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-144 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-144 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-144 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-144 XMD8-92 NULL 46843772 Microarray pancreatic ductal adenocarcinoma cell 24880079 2014 up-regulated
miR-144 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-144 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-144 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-144 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-144 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miR-144 Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 up-regulated
miR-144 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-144 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-144 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-144-3p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-144-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-144-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-144-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229, U251, LN18）
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Prostate Cancer tissue and cell line (PC-3, LNCap)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved resistant Low Cervical Cancer tissue
hsa-miR-144-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (SN12-PM6, 786-O)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Anaplastic Thyroid Cancer tissue
hsa-miR-144-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-144-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-144-3p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive Low Neuroblastoma cell line (SH-SY5Y, SK-N-SH)
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Neuroblastoma cell line (SK-N-SH, IMR-32)
hsa-miR-144-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-144-3p Pazopanib 10113978 NSC752782 approved sensitive Low Renal Cell Cancer tissue
hsa-miR-144-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-144-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-144-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-144-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-144-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-144-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-144-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-144-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-144-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission