miRTarBase - #MIRT069282


—
pre-miRNA Information
pre-miRNA hsa-mir-1277   
Genomic Coordinates chrX: 118386394 - 118386471
Synonyms MIRN1277, hsa-mir-1277, MIR1277
Description Homo sapiens miR-1277 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1277-5p
Sequence 8| AAAUAUAUAUAUAUAUGUACGUAU |31
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 15 X + 118386415 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746499482 2 dbSNP
rs770518695 2 dbSNP
rs1198178052 3 dbSNP
rs781269752 6 dbSNP
rs746163811 8 dbSNP
rs1190574471 13 dbSNP
rs1170658098 19 dbSNP
rs776234383 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HSP90AA1   
Synonyms EL52, HEL-S-65p, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp103, Hsp89, Hsp90, LAP-2, LAP2
Description heat shock protein 90 alpha family class A member 1
Transcript NM_001017963   
Other Transcripts NM_005348   
Expression
Putative miRNA Targets on HSP90AA1
3'UTR of HSP90AA1
(miRNA target sites are highlighted)		 
>HSP90AA1|NM_001017963|3'UTR
   1 TCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTAT
  81 TTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCT
 161 GTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACG
 241 TGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGAC
 321 CAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTT
 401 TGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGG
 481 AAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATC
 561 GTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGT
 641 AACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAG
 721 TGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGC
 801 ATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCAT
 881 GAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTA
 961 ATTCCTTGGCCTTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaUGCAUGUA-UAUAUAUAUAUAAa 5'
            :||| ||| |  || ||:|:|| 
Target 5' ctGCGTCCATGAGTTACATGTGTTc 3'
 871 - 895 134.00 -9.40
2 
miRNA  3' uaUGCAUGUAUAUAUAUA-UAUAAa 5'
            |||||::||   | || ||:|| 
Target 5' agACGTATGTA---ACATGATGTTa 3'
 250 - 271 119.00 -7.00
3 
miRNA  3' uaUGCAUG-U----AUAUAUAUAUAUAAa 5'
            |:|||| |    | || | ||| :|| 
Target 5' gcATGTACTAGTCCTCTAGAAATAGGTTa 3'
 433 - 461 112.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN508680 20 COSMIC
COSN31547687 31 COSMIC
COSN30488128 47 COSMIC
COSN5746133 64 COSMIC
COSN30121940 101 COSMIC
COSN30168907 107 COSMIC
COSN23530744 132 COSMIC
COSN22901869 135 COSMIC
COSN31537635 142 COSMIC
COSN22025006 151 COSMIC
COSN28822922 178 COSMIC
COSN31586258 181 COSMIC
COSN31961039 245 COSMIC
COSN17447622 264 COSMIC
COSN20111696 275 COSMIC
COSN14451687 577 COSMIC
COSN7429126 965 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs546002924 1 dbSNP
rs780659343 2 dbSNP
rs750719586 3 dbSNP
rs532698679 4 dbSNP
rs757476486 10 dbSNP
rs972436676 11 dbSNP
rs1353423079 13 dbSNP
rs202202735 16 dbSNP
rs764120109 18 dbSNP
rs1329326877 19 dbSNP
rs1351743545 22 dbSNP
rs758432856 22 dbSNP
rs143088106 23 dbSNP
rs777775631 23 dbSNP
rs766242959 24 dbSNP
rs377540509 29 dbSNP
rs760463855 30 dbSNP
rs772944294 36 dbSNP
rs1220800393 37 dbSNP
rs767323889 38 dbSNP
rs1279269265 39 dbSNP
rs1416319789 40 dbSNP
rs112417493 41 dbSNP
rs35798224 43 dbSNP
rs748749956 44 dbSNP
rs1451713672 45 dbSNP
rs776145818 46 dbSNP
rs770491788 49 dbSNP
rs1244857785 50 dbSNP
rs1489247388 51 dbSNP
rs1194027193 56 dbSNP
rs1422668859 56 dbSNP
rs1477608573 57 dbSNP
rs776902863 57 dbSNP
rs1223006118 60 dbSNP
rs963863592 62 dbSNP
rs1019449876 63 dbSNP
rs1323001409 67 dbSNP
rs1008106440 68 dbSNP
rs373854012 72 dbSNP
rs1032129043 75 dbSNP
rs1402404388 75 dbSNP
rs979357162 78 dbSNP
rs1227880643 79 dbSNP
rs1356638592 80 dbSNP
rs966655171 83 dbSNP
rs903132894 84 dbSNP
rs1020266388 89 dbSNP
rs765372871 92 dbSNP
rs1191280796 97 dbSNP
rs1239384871 99 dbSNP
rs1473268819 99 dbSNP
rs1366707721 103 dbSNP
rs965739818 105 dbSNP
rs1019738497 111 dbSNP
rs1006970711 114 dbSNP
rs1293920868 118 dbSNP
rs554591656 119 dbSNP
rs893192002 120 dbSNP
rs116145388 122 dbSNP
rs1340631966 123 dbSNP
rs1157696958 124 dbSNP
rs1446849553 133 dbSNP
rs937454923 137 dbSNP
rs907379409 138 dbSNP
rs1281908470 139 dbSNP
rs1355308477 141 dbSNP
rs1240742947 142 dbSNP
rs555748267 146 dbSNP
rs940947200 148 dbSNP
rs908141653 149 dbSNP
rs1443161593 150 dbSNP
rs1431778524 153 dbSNP
rs1267048104 159 dbSNP
rs982454298 159 dbSNP
rs1441676435 161 dbSNP
rs538999062 163 dbSNP
rs1452266256 167 dbSNP
rs897421259 167 dbSNP
rs930984794 168 dbSNP
rs575335984 172 dbSNP
rs1174615081 173 dbSNP
rs186085934 175 dbSNP
rs919661551 182 dbSNP
rs538361947 186 dbSNP
rs1470179024 188 dbSNP
rs963812142 193 dbSNP
rs762176778 195 dbSNP
rs949105975 197 dbSNP
rs564969774 202 dbSNP
rs1307943075 206 dbSNP
rs1262692509 207 dbSNP
rs55980776 210 dbSNP
rs369711643 214 dbSNP
rs1200061307 218 dbSNP
rs1261439921 220 dbSNP
rs1199279351 228 dbSNP
rs1301633887 228 dbSNP
rs1237657508 229 dbSNP
rs1020634331 230 dbSNP
rs149051840 231 dbSNP
rs146487565 233 dbSNP
rs1174759532 236 dbSNP
rs567256737 239 dbSNP
rs1330025431 240 dbSNP
rs1465826045 240 dbSNP
rs979242729 242 dbSNP
rs375492660 243 dbSNP
rs1301947350 246 dbSNP
rs1330470783 249 dbSNP
rs1230737854 252 dbSNP
rs1435146685 253 dbSNP
rs1034401938 254 dbSNP
rs1320196687 255 dbSNP
rs1312334929 256 dbSNP
rs1219535666 260 dbSNP
rs1257495711 263 dbSNP
rs1479720757 266 dbSNP
rs1170318513 267 dbSNP
rs966922324 269 dbSNP
rs1465175695 273 dbSNP
rs200220551 275 dbSNP
rs397773688 277 dbSNP
rs1377859953 278 dbSNP
rs72520876 279 dbSNP
rs1169603641 280 dbSNP
rs1491132162 280 dbSNP
rs3831488 280 dbSNP
rs397717863 280 dbSNP
rs767388978 280 dbSNP
rs913843293 284 dbSNP
rs976391279 287 dbSNP
rs1293637739 290 dbSNP
rs1001614054 292 dbSNP
rs11547511 294 dbSNP
rs907328376 297 dbSNP
rs1045911909 299 dbSNP
rs2298878 304 dbSNP
rs531569646 305 dbSNP
rs569173401 307 dbSNP
rs1306003236 309 dbSNP
rs954116788 311 dbSNP
rs1465763962 312 dbSNP
rs1266116967 313 dbSNP
rs775842618 315 dbSNP
rs1049795723 316 dbSNP
rs1220981865 316 dbSNP
rs1265790545 323 dbSNP
rs1488846223 326 dbSNP
rs1192454265 331 dbSNP
rs1259179287 332 dbSNP
rs930954268 332 dbSNP
rs1164797766 335 dbSNP
rs1367442420 336 dbSNP
rs1422660414 336 dbSNP
rs115690563 337 dbSNP
rs1483014788 343 dbSNP
rs1256870615 348 dbSNP
rs761876180 352 dbSNP
rs1360053308 354 dbSNP
rs897299238 355 dbSNP
rs1339846410 362 dbSNP
rs1296748815 363 dbSNP
rs1039378197 375 dbSNP
rs942451252 376 dbSNP
rs182139510 378 dbSNP
rs1331563005 380 dbSNP
rs144076402 383 dbSNP
rs1402470925 385 dbSNP
rs540861447 388 dbSNP
rs1054722296 389 dbSNP
rs937644602 390 dbSNP
rs1436946262 393 dbSNP
rs776894543 395 dbSNP
rs1156601083 396 dbSNP
rs1058078 401 dbSNP
rs945257076 405 dbSNP
rs879155627 408 dbSNP
rs1450568020 410 dbSNP
rs1405413219 411 dbSNP
rs1450478753 415 dbSNP
rs1375297812 416 dbSNP
rs1311560692 417 dbSNP
rs1378223517 418 dbSNP
rs913716905 422 dbSNP
rs976063707 424 dbSNP
rs957342013 426 dbSNP
rs1262067450 427 dbSNP
rs1459724917 431 dbSNP
rs1423386202 436 dbSNP
rs1257081139 439 dbSNP
rs1034346315 440 dbSNP
rs1175483573 442 dbSNP
rs1426971092 443 dbSNP
rs1001561838 445 dbSNP
rs1273600149 446 dbSNP
rs11547531 447 dbSNP
rs544933619 448 dbSNP
rs1005030045 449 dbSNP
rs1468441475 451 dbSNP
rs886610297 454 dbSNP
rs879027014 458 dbSNP
rs568538336 472 dbSNP
rs548709077 476 dbSNP
rs1401207536 477 dbSNP
rs995489817 478 dbSNP
rs900803204 480 dbSNP
rs1039331239 485 dbSNP
rs1297006094 486 dbSNP
rs1027097628 487 dbSNP
rs1370386298 487 dbSNP
rs1340608264 491 dbSNP
rs1294624119 492 dbSNP
rs942382721 492 dbSNP
rs912289152 495 dbSNP
rs974551065 496 dbSNP
rs1051288917 499 dbSNP
rs1202329277 508 dbSNP
rs945865634 512 dbSNP
rs1488785290 515 dbSNP
rs913046868 520 dbSNP
rs1410934768 521 dbSNP
rs1399250865 530 dbSNP
rs1162015542 531 dbSNP
rs1479576222 532 dbSNP
rs1173144665 537 dbSNP
rs575140426 541 dbSNP
rs1369081693 544 dbSNP
rs957253629 545 dbSNP
rs927225724 550 dbSNP
rs773910133 554 dbSNP
rs1302913721 557 dbSNP
rs191117771 558 dbSNP
rs186290063 559 dbSNP
rs1024355329 560 dbSNP
rs1212258045 561 dbSNP
rs35754658 561 dbSNP
rs1291412008 567 dbSNP
rs190137720 569 dbSNP
rs1266467374 584 dbSNP
rs1489176904 587 dbSNP
rs11547545 588 dbSNP
rs1242872836 592 dbSNP
rs1475209490 593 dbSNP
rs1166171432 595 dbSNP
rs1287615290 604 dbSNP
rs536071141 606 dbSNP
rs546245419 607 dbSNP
rs1364084023 609 dbSNP
rs1421854434 610 dbSNP
rs900734541 611 dbSNP
rs549111987 614 dbSNP
rs1017830031 616 dbSNP
rs1006472514 617 dbSNP
rs944491130 622 dbSNP
rs890799015 624 dbSNP
rs1355801856 627 dbSNP
rs1216982125 631 dbSNP
rs986030355 633 dbSNP
rs749124836 634 dbSNP
rs945781979 638 dbSNP
rs777749650 640 dbSNP
rs1054680467 641 dbSNP
rs1383887422 645 dbSNP
rs1288661133 649 dbSNP
rs149779281 651 dbSNP
rs935835621 653 dbSNP
rs1384779216 656 dbSNP
rs1398560878 662 dbSNP
rs1335834188 663 dbSNP
rs556803066 666 dbSNP
rs769688719 667 dbSNP
rs1183755168 668 dbSNP
rs1260637479 669 dbSNP
rs1378942161 670 dbSNP
rs1240856653 671 dbSNP
rs1278737743 675 dbSNP
rs34287031 676 dbSNP
rs1386664750 678 dbSNP
rs1002401794 679 dbSNP
rs1203044984 681 dbSNP
rs903568400 686 dbSNP
rs1395860299 687 dbSNP
rs1022379107 688 dbSNP
rs1183212938 697 dbSNP
rs1363559122 704 dbSNP
rs569231446 705 dbSNP
rs1468875883 706 dbSNP
rs983512336 709 dbSNP
rs1429470820 710 dbSNP
rs1468979357 716 dbSNP
rs1334102642 720 dbSNP
rs34767631 722 dbSNP
rs368736722 722 dbSNP
rs1328158532 723 dbSNP
rs552328672 729 dbSNP
rs1235098050 733 dbSNP
rs1275228329 735 dbSNP
rs780982911 743 dbSNP
rs115514898 744 dbSNP
rs1261300689 746 dbSNP
rs1232153544 754 dbSNP
rs566878846 755 dbSNP
rs1459180578 757 dbSNP
rs1244729499 764 dbSNP
rs1196474596 767 dbSNP
rs1250378727 770 dbSNP
rs888941210 773 dbSNP
rs930546203 778 dbSNP
rs973518262 781 dbSNP
rs1197916169 785 dbSNP
rs1452055796 786 dbSNP
rs964850714 787 dbSNP
rs1017777546 790 dbSNP
rs1462008221 791 dbSNP
rs1166842352 795 dbSNP
rs1206274819 795 dbSNP
rs1009094575 798 dbSNP
rs1327906907 799 dbSNP
rs547136209 801 dbSNP
rs974489235 803 dbSNP
rs1404541790 804 dbSNP
rs1281556881 806 dbSNP
rs1228160069 813 dbSNP
rs186947478 813 dbSNP
rs1029722383 814 dbSNP
rs1009931307 818 dbSNP
rs891513223 820 dbSNP
rs1212219445 821 dbSNP
rs1054231685 824 dbSNP
rs181396530 827 dbSNP
rs940009092 828 dbSNP
rs1197744022 829 dbSNP
rs1059623 831 dbSNP
rs992190538 832 dbSNP
rs905704357 833 dbSNP
rs1289448295 836 dbSNP
rs1191778444 839 dbSNP
rs1370902525 843 dbSNP
rs189791627 846 dbSNP
rs1436221466 853 dbSNP
rs1372359989 859 dbSNP
rs1364905750 860 dbSNP
rs926789577 861 dbSNP
rs150605311 865 dbSNP
rs917198702 869 dbSNP
rs1432964490 870 dbSNP
rs1387937390 872 dbSNP
rs544715118 874 dbSNP
rs372342215 875 dbSNP
rs1324800159 879 dbSNP
rs780168650 879 dbSNP
rs1423344436 883 dbSNP
rs1293077935 887 dbSNP
rs572874004 888 dbSNP
rs1177181687 891 dbSNP
rs558996333 896 dbSNP
rs1288624852 902 dbSNP
rs956379016 906 dbSNP
rs542330350 908 dbSNP
rs1008645480 909 dbSNP
rs1183698911 915 dbSNP
rs1396774555 915 dbSNP
rs888993336 916 dbSNP
rs1442717782 923 dbSNP
rs973465918 923 dbSNP
rs964798636 924 dbSNP
rs1454472143 926 dbSNP
rs1050255038 927 dbSNP
rs1383105807 934 dbSNP
rs754032436 935 dbSNP
rs1315826081 936 dbSNP
rs994639505 942 dbSNP
rs1059629 944 dbSNP
rs987621599 950 dbSNP
rs1238804112 951 dbSNP
rs1258536401 953 dbSNP
rs184420805 957 dbSNP
rs745651687 957 dbSNP
rs1459921956 961 dbSNP
rs139925232 964 dbSNP
rs1010296681 965 dbSNP
rs376414746 969 dbSNP
rs1156708658 970 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3320.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3320.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAUAUUAAAAAGUCUGUAUGGCAUGACAACUACUUUAAGGGGAAGAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000216281.8 | 3UTR | UACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000216281.8 | 3UTR | ACUUACCUGUUCAGUACUCUACAAUUCCUCUGAUAAUAUAUUUUCAAGGAUGUUUUUCUUUAUUUUUGUUAAUAUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
619 hsa-miR-1277-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056754 ARID5B AT-rich interaction domain 5B 2 4
MIRT061744 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT061749 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT064112 ERGIC2 ERGIC and golgi 2 2 2
MIRT064651 YAF2 YY1 associated factor 2 2 4
MIRT064836 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT067662 ZIC5 Zic family member 5 2 6
MIRT069282 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 6
MIRT070956 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT071145 NUMB NUMB, endocytic adaptor protein 2 2
MIRT074785 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 6
MIRT075264 SNTB2 syntrophin beta 2 2 4
MIRT075446 PSMD7 proteasome 26S subunit, non-ATPase 7 2 6
MIRT076212 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT084669 BTG3 BTG anti-proliferation factor 3 2 6
MIRT087151 HIC2 HIC ZBTB transcriptional repressor 2 2 6
MIRT088873 FOXN2 forkhead box N2 2 12
MIRT093119 SLC7A11 solute carrier family 7 member 11 2 10
MIRT096246 CANX calnexin 2 2
MIRT097122 TNPO1 transportin 1 2 2
MIRT097389 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT100756 VEGFA vascular endothelial growth factor A 2 4
MIRT100865 CD2AP CD2 associated protein 2 4
MIRT101318 FAM135A family with sequence similarity 135 member A 2 2
MIRT103531 HOXA9 homeobox A9 2 2
MIRT105845 DDHD2 DDHD domain containing 2 2 2
MIRT111511 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT113092 CCND2 cyclin D2 2 4
MIRT116209 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT117356 TGIF1 TGFB induced factor homeobox 1 2 4
MIRT122389 RGMB repulsive guidance molecule family member b 2 4
MIRT126100 USP6NL USP6 N-terminal like 2 10
MIRT163363 PRKCD protein kinase C delta 2 4
MIRT163466 WNT5A Wnt family member 5A 2 4
MIRT164377 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT181785 UHMK1 U2AF homology motif kinase 1 2 4
MIRT182290 POU2F1 POU class 2 homeobox 1 2 2
MIRT193652 RORA RAR related orphan receptor A 2 4
MIRT198842 C18ORF25 chromosome 18 open reading frame 25 2 2
MIRT201466 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT214454 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT223276 TRIM4 tripartite motif containing 4 2 2
MIRT225132 KAT6A lysine acetyltransferase 6A 2 6
MIRT225924 SNX16 sorting nexin 16 2 6
MIRT227867 NFIB nuclear factor I B 2 6
MIRT229421 ZNF275 zinc finger protein 275 2 4
MIRT243203 SERTAD2 SERTA domain containing 2 2 2
MIRT265715 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT267012 ZDHHC5 zinc finger DHHC-type containing 5 2 6
MIRT269383 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT270184 UNG uracil DNA glycosylase 2 6
MIRT271867 ZNF678 zinc finger protein 678 2 2
MIRT273689 HOXC4 homeobox C4 2 8
MIRT274714 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT276556 AKAP11 A-kinase anchoring protein 11 2 2
MIRT277062 NDFIP2 Nedd4 family interacting protein 2 2 4
MIRT277511 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT277911 RBM23 RNA binding motif protein 23 2 4
MIRT282601 IGF1R insulin like growth factor 1 receptor 2 2
MIRT287614 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT296120 TP53RK TP53 regulating kinase 2 4
MIRT297070 NCK2 NCK adaptor protein 2 2 2
MIRT301453 DDX17 DEAD-box helicase 17 2 2
MIRT302777 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT303262 FBXO48 F-box protein 48 2 4
MIRT308605 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT311040 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT312331 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT312420 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT313989 TPPP tubulin polymerization promoting protein 2 6
MIRT316901 ATXN1 ataxin 1 2 2
MIRT316955 QKI QKI, KH domain containing RNA binding 2 2
MIRT317931 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT323683 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT327651 ZXDA zinc finger, X-linked, duplicated A 2 8
MIRT330640 CDK1 cyclin dependent kinase 1 2 2
MIRT331299 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT338170 SP1 Sp1 transcription factor 2 6
MIRT359188 F2RL1 F2R like trypsin receptor 1 2 6
MIRT359673 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 4
MIRT362977 CASD1 CAS1 domain containing 1 2 4
MIRT366901 NONO non-POU domain containing octamer binding 2 2
MIRT379801 APOOL apolipoprotein O like 2 6
MIRT395177 ZNF609 zinc finger protein 609 2 2
MIRT403410 RPS7 ribosomal protein S7 2 2
MIRT408867 BACH2 BTB domain and CNC homolog 2 2 8
MIRT441400 SOX5 SRY-box 5 2 8
MIRT441513 AKR1D1 aldo-keto reductase family 1 member D1 2 2
MIRT441661 COCH cochlin 2 2
MIRT441785 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT441968 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT442041 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442718 TNKS tankyrase 2 2
MIRT443365 CSRP1 cysteine and glycine rich protein 1 2 2
MIRT443403 HMX3 H6 family homeobox 3 2 2
MIRT443422 LIN28B lin-28 homolog B 2 4
MIRT443458 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT444783 ECE1 endothelin converting enzyme 1 2 2
MIRT444794 TMEM251 transmembrane protein 251 2 2
MIRT444829 POLR1B RNA polymerase I subunit B 2 2
MIRT445040 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT445146 KLHL23 kelch like family member 23 2 8
MIRT445904 TBX18 T-box 18 2 6
MIRT446322 GM2A GM2 ganglioside activator 2 2
MIRT446772 ATAD5 ATPase family, AAA domain containing 5 2 2
MIRT446996 UBXN2A UBX domain protein 2A 2 2
MIRT447326 ZSCAN21 zinc finger and SCAN domain containing 21 2 2
MIRT447435 FER FER tyrosine kinase 2 2
MIRT447732 DGKH diacylglycerol kinase eta 2 4
MIRT447885 ERI1 exoribonuclease 1 2 2
MIRT448972 CADM2 cell adhesion molecule 2 2 2
MIRT450008 SLC16A6 solute carrier family 16 member 6 2 4
MIRT450383 GUF1 GUF1 homolog, GTPase 2 2
MIRT450752 POLI DNA polymerase iota 2 2
MIRT454744 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 2 2
MIRT456101 MB21D1 Mab-21 domain containing 1 2 6
MIRT460169 CCL16 C-C motif chemokine ligand 16 2 2
MIRT466574 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466700 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT467423 SNTB1 syntrophin beta 1 2 4
MIRT467733 SLC38A1 solute carrier family 38 member 1 2 2
MIRT469922 PTPRJ protein tyrosine phosphatase, receptor type J 2 8
MIRT470039 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT472972 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT475057 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT475180 INSIG2 insulin induced gene 2 2 6
MIRT477509 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT480614 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT480943 BBX BBX, HMG-box containing 2 8
MIRT481533 ARL5B ADP ribosylation factor like GTPase 5B 2 8
MIRT485089 SLC30A1 solute carrier family 30 member 1 2 4
MIRT496317 GCK glucokinase 2 6
MIRT496323 DOCK9 dedicator of cytokinesis 9 2 2
MIRT497792 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT499299 KCNK1 potassium two pore domain channel subfamily K member 1 2 10
MIRT503233 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 10
MIRT503290 XRCC3 X-ray repair cross complementing 3 2 6
MIRT503330 TET2 tet methylcytosine dioxygenase 2 2 10
MIRT503384 ASB11 ankyrin repeat and SOCS box containing 11 2 4
MIRT503397 C11orf74 chromosome 11 open reading frame 74 2 4
MIRT503520 USP51 ubiquitin specific peptidase 51 2 6
MIRT503575 BTBD19 BTB domain containing 19 2 6
MIRT503697 CTLA4 cytotoxic T-lymphocyte associated protein 4 2 8
MIRT503739 GPATCH11 G-patch domain containing 11 2 10
MIRT503813 CARF calcium responsive transcription factor 2 8
MIRT503835 NCAM2 neural cell adhesion molecule 2 2 6
MIRT503857 CSMD1 CUB and Sushi multiple domains 1 2 4
MIRT503891 ELF2 E74 like ETS transcription factor 2 2 6
MIRT503975 C4orf29 abhydrolase domain containing 18 2 10
MIRT504025 CEP104 centrosomal protein 104 2 4
MIRT504134 RAB3B RAB3B, member RAS oncogene family 2 14
MIRT504249 FAM26E calcium homeostasis modulator family member 5 2 8
MIRT504250 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 10
MIRT504298 ZNF318 zinc finger protein 318 2 6
MIRT504343 COPS8 COP9 signalosome subunit 8 2 6
MIRT504357 VCAM1 vascular cell adhesion molecule 1 2 8
MIRT504385 SLC24A2 solute carrier family 24 member 2 2 6
MIRT504454 MIPOL1 mirror-image polydactyly 1 2 6
MIRT504520 BVES blood vessel epicardial substance 2 6
MIRT504582 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 6
MIRT504583 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 2 6
MIRT504607 MMADHC methylmalonic aciduria and homocystinuria, cblD type 2 6
MIRT504659 CYGB cytoglobin 2 4
MIRT504719 PLEKHA6 pleckstrin homology domain containing A6 2 10
MIRT504730 DGKG diacylglycerol kinase gamma 2 10
MIRT504732 GSK3B glycogen synthase kinase 3 beta 2 8
MIRT504770 CLEC2D C-type lectin domain family 2 member D 2 4
MIRT504818 HOXD10 homeobox D10 2 8
MIRT504862 VAMP4 vesicle associated membrane protein 4 2 6
MIRT504925 IMPG2 interphotoreceptor matrix proteoglycan 2 2 10
MIRT504929 CA12 carbonic anhydrase 12 2 6
MIRT505093 ZBED3 zinc finger BED-type containing 3 2 6
MIRT505175 WDR76 WD repeat domain 76 2 4
MIRT505259 RPS27A ribosomal protein S27a 2 6
MIRT505431 TBPL1 TATA-box binding protein like 1 2 8
MIRT505521 SPATA2 spermatogenesis associated 2 2 10
MIRT505743 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT505762 SEC23IP SEC23 interacting protein 2 6
MIRT506023 PUM1 pumilio RNA binding family member 1 2 6
MIRT506055 PPP4R2 protein phosphatase 4 regulatory subunit 2 2 8
MIRT506141 PLEKHA3 pleckstrin homology domain containing A3 2 6
MIRT506169 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 6
MIRT506303 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506404 NRF1 nuclear respiratory factor 1 2 4
MIRT506473 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 6
MIRT506551 MON1B MON1 homolog B, secretory trafficking associated 2 4
MIRT506612 MARCH6 membrane associated ring-CH-type finger 6 2 10
MIRT506723 LPAR3 lysophosphatidic acid receptor 3 2 10
MIRT506734 LMTK2 lemur tyrosine kinase 2 2 8
MIRT506902 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 6
MIRT507175 G3BP2 G3BP stress granule assembly factor 2 2 2
MIRT507399 EMC7 ER membrane protein complex subunit 7 2 8
MIRT507476 E2F8 E2F transcription factor 8 2 6
MIRT507618 CSRNP3 cysteine and serine rich nuclear protein 3 2 8
MIRT507635 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT507831 CD55 CD55 molecule (Cromer blood group) 2 4
MIRT508102 AMER1 APC membrane recruitment protein 1 2 12
MIRT508195 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 8
MIRT508255 CD226 CD226 molecule 2 8
MIRT508276 ADCYAP1 adenylate cyclase activating polypeptide 1 2 10
MIRT508325 CCDC38 coiled-coil domain containing 38 2 6
MIRT508364 ITPRIPL1 inositol 1,4,5-trisphosphate receptor interacting protein-like 1 2 10
MIRT508419 MYBL1 MYB proto-oncogene like 1 2 6
MIRT508438 ZNF608 zinc finger protein 608 2 4
MIRT508458 SHOX2 short stature homeobox 2 2 6
MIRT508532 RPP14 ribonuclease P/MRP subunit p14 2 6
MIRT508580 ZNF516 zinc finger protein 516 2 6
MIRT508596 CREB1 cAMP responsive element binding protein 1 2 6
MIRT508630 EIF2B1 eukaryotic translation initiation factor 2B subunit alpha 2 8
MIRT508637 RPL23A ribosomal protein L23a 2 6
MIRT508673 TBX20 T-box 20 2 6
MIRT508679 ENTHD1 ENTH domain containing 1 2 6
MIRT508694 NRIP1 nuclear receptor interacting protein 1 2 8
MIRT508764 ETV6 ETS variant 6 2 8
MIRT508781 CDKL1 cyclin dependent kinase like 1 2 10
MIRT508796 NTRK3 neurotrophic receptor tyrosine kinase 3 2 4
MIRT508841 TMCO1 transmembrane and coiled-coil domains 1 2 4
MIRT508970 MLLT3 MLLT3, super elongation complex subunit 2 6
MIRT508985 DCLRE1C DNA cross-link repair 1C 2 6
MIRT508990 TNFRSF9 TNF receptor superfamily member 9 2 6
MIRT509015 CUL2 cullin 2 2 10
MIRT509021 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 6
MIRT509040 AKAP2 A-kinase anchoring protein 2 2 6
MIRT509076 RABGAP1 RAB GTPase activating protein 1 2 8
MIRT509152 SLC25A27 solute carrier family 25 member 27 2 8
MIRT509176 EFHC1 EF-hand domain containing 1 2 4
MIRT509177 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 2 6
MIRT509180 TSPAN2 tetraspanin 2 2 6
MIRT509220 PYHIN1 pyrin and HIN domain family member 1 2 10
MIRT509241 OTX1 orthodenticle homeobox 1 2 6
MIRT509261 SUCNR1 succinate receptor 1 2 10
MIRT509437 SRP72 signal recognition particle 72 2 10
MIRT509443 POU2F2 POU class 2 homeobox 2 2 6
MIRT509464 TRIM2 tripartite motif containing 2 2 4
MIRT509482 LARP1 La ribonucleoprotein domain family member 1 2 10
MIRT509539 RSBN1L round spermatid basic protein 1 like 2 6
MIRT509604 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 6
MIRT509701 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 4
MIRT509759 KIAA2018 upstream transcription factor family member 3 2 6
MIRT509816 SULT1B1 sulfotransferase family 1B member 1 2 8
MIRT509822 GTPBP2 GTP binding protein 2 2 6
MIRT509829 TACR3 tachykinin receptor 3 2 4
MIRT509916 WDR92 WD repeat domain 92 2 2
MIRT509951 ITGA1 integrin subunit alpha 1 2 6
MIRT509956 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 4
MIRT509972 CRIM1 cysteine rich transmembrane BMP regulator 1 2 4
MIRT509983 GTF2H1 general transcription factor IIH subunit 1 2 4
MIRT509998 ARID3A AT-rich interaction domain 3A 2 8
MIRT510049 LRP6 LDL receptor related protein 6 2 12
MIRT510123 COL8A1 collagen type VIII alpha 1 chain 2 8
MIRT510132 C2orf49 chromosome 2 open reading frame 49 2 8
MIRT510170 STARD8 StAR related lipid transfer domain containing 8 2 10
MIRT510207 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 11
MIRT510239 TNFSF9 TNF superfamily member 9 2 6
MIRT510240 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 6
MIRT510262 DDX55 DEAD-box helicase 55 2 10
MIRT510448 ZFHX3 zinc finger homeobox 3 2 6
MIRT510480 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 10
MIRT510676 STRN striatin 2 8
MIRT510707 SPPL2A signal peptide peptidase like 2A 2 8
MIRT510805 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 10
MIRT510830 RTN4RL1 reticulon 4 receptor like 1 2 6
MIRT510839 RCAN2 regulator of calcineurin 2 2 6
MIRT510884 RAB5B RAB5B, member RAS oncogene family 2 6
MIRT510900 PURG purine rich element binding protein G 2 6
MIRT510929 PRRX1 paired related homeobox 1 2 4
MIRT510930 PROX1 prospero homeobox 1 2 6
MIRT510994 PCBP2 poly(rC) binding protein 2 2 8
MIRT511002 PAQR3 progestin and adipoQ receptor family member 3 2 6
MIRT511065 NPTN neuroplastin 2 4
MIRT511117 NDST1 N-deacetylase and N-sulfotransferase 1 2 6
MIRT511128 NABP1 nucleic acid binding protein 1 2 8
MIRT511164 MBNL3 muscleblind like splicing regulator 3 2 6
MIRT511173 MARCKS myristoylated alanine rich protein kinase C substrate 2 6
MIRT511191 MAP3K12 mitogen-activated protein kinase kinase kinase 12 2 6
MIRT511222 KPNA4 karyopherin subunit alpha 4 2 4
MIRT511327 KIAA1522 KIAA1522 2 4
MIRT511352 KHSRP KH-type splicing regulatory protein 2 4
MIRT511362 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 4
MIRT511363 IL6ST interleukin 6 signal transducer 2 4
MIRT511369 IKZF4 IKAROS family zinc finger 4 2 6
MIRT511415 HSPA13 heat shock protein family A (Hsp70) member 13 2 4
MIRT511496 HMGXB4 HMG-box containing 4 2 6
MIRT511516 HMGB2 high mobility group box 2 2 4
MIRT511675 HIST1H3B histone cluster 1 H3 family member b 2 8
MIRT511919 FKBP14 FK506 binding protein 14 2 4
MIRT511954 EVI5 ecotropic viral integration site 5 2 6
MIRT511998 DUSP7 dual specificity phosphatase 7 2 4
MIRT512006 DTX4 deltex E3 ubiquitin ligase 4 2 10
MIRT512073 DDX6 DEAD-box helicase 6 2 6
MIRT512150 CFL2 cofilin 2 2 4
MIRT512220 BMP2K BMP2 inducible kinase 2 8
MIRT512266 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 6
MIRT512308 ADCY9 adenylate cyclase 9 2 8
MIRT512335 ABI2 abl interactor 2 2 4
MIRT512713 ZNF134 zinc finger protein 134 2 6
MIRT513001 TRPM6 transient receptor potential cation channel subfamily M member 6 2 4
MIRT514082 MGAT4C MGAT4 family member C 2 4
MIRT514214 LRRC63 leucine rich repeat containing 63 2 4
MIRT514231 EPOR erythropoietin receptor 2 4
MIRT514443 C15orf59 chromosome 15 open reading frame 59 2 10
MIRT514455 KARS lysyl-tRNA synthetase 2 2
MIRT514647 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 2 2
MIRT514703 PHEX phosphate regulating endopeptidase homolog X-linked 2 10
MIRT514751 ACER3 alkaline ceramidase 3 2 8
MIRT514817 TSNARE1 t-SNARE domain containing 1 2 8
MIRT514943 GPR141 G protein-coupled receptor 141 2 2
MIRT515313 SLC35E3 solute carrier family 35 member E3 2 6
MIRT515398 ARHGAP21 Rho GTPase activating protein 21 2 4
MIRT515399 WDR72 WD repeat domain 72 2 6
MIRT515518 CCT4 chaperonin containing TCP1 subunit 4 2 4
MIRT515547 KRT222 keratin 222 2 4
MIRT515610 WDR17 WD repeat domain 17 2 2
MIRT515644 MYBPC1 myosin binding protein C, slow type 2 2
MIRT515776 NLGN4X neuroligin 4, X-linked 2 6
MIRT515823 FOCAD focadhesin 2 2
MIRT515850 AJAP1 adherens junctions associated protein 1 2 6
MIRT515864 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 2 2
MIRT515868 PLXDC2 plexin domain containing 2 2 4
MIRT515883 FAM182B family with sequence similarity 182 member B 2 8
MIRT515976 C9orf156 tRNA methyltransferase O 2 4
MIRT515982 AR androgen receptor 2 8
MIRT516292 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 6
MIRT516498 GLRX2 glutaredoxin 2 2 6
MIRT516688 ZNF675 zinc finger protein 675 2 6
MIRT516704 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 6
MIRT516763 POT1 protection of telomeres 1 2 4
MIRT516941 SLC35F6 solute carrier family 35 member F6 2 8
MIRT517039 ZC3H6 zinc finger CCCH-type containing 6 2 8
MIRT517149 VHLL VHL like 2 6
MIRT517318 ZNF347 zinc finger protein 347 2 6
MIRT517349 NLRP9 NLR family pyrin domain containing 9 2 4
MIRT517501 GRID1 glutamate ionotropic receptor delta type subunit 1 2 6
MIRT517503 KCNK12 potassium two pore domain channel subfamily K member 12 2 4
MIRT517548 ABCF1 ATP binding cassette subfamily F member 1 2 8
MIRT517563 VENTX VENT homeobox 2 4
MIRT517622 C10orf67 chromosome 10 open reading frame 67 2 4
MIRT517695 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 4
MIRT517897 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT518123 XKR6 XK related 6 2 10
MIRT518154 TMEM133 transmembrane protein 133 2 2
MIRT518234 SCIN scinderin 2 6
MIRT518440 FRRS1 ferric chelate reductase 1 2 10
MIRT518505 DEPTOR DEP domain containing MTOR interacting protein 2 6
MIRT518615 CAPN5 calpain 5 2 6
MIRT518652 SLC2A12 solute carrier family 2 member 12 2 6
MIRT518665 CLVS2 clavesin 2 2 4
MIRT518704 TNIP1 TNFAIP3 interacting protein 1 2 4
MIRT518763 IFNAR1 interferon alpha and beta receptor subunit 1 2 6
MIRT518808 AKAP8 A-kinase anchoring protein 8 2 4
MIRT518881 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 6
MIRT519032 AGPS alkylglycerone phosphate synthase 2 8
MIRT519154 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 4
MIRT519161 CD180 CD180 molecule 2 4
MIRT519350 OBFC1 STN1, CST complex subunit 2 4
MIRT519570 SEMA3F semaphorin 3F 2 6
MIRT519722 ZNF512B zinc finger protein 512B 2 4
MIRT519800 ZMYM2 zinc finger MYM-type containing 2 2 4
MIRT519926 ZER1 zyg-11 related cell cycle regulator 2 6
MIRT520000 ZBTB20 zinc finger and BTB domain containing 20 2 4
MIRT520001 ZBTB16 zinc finger and BTB domain containing 16 2 6
MIRT520101 XRN1 5'-3' exoribonuclease 1 2 4
MIRT520214 WASL Wiskott-Aldrich syndrome like 2 6
MIRT520465 TRIM23 tripartite motif containing 23 2 8
MIRT520478 TRIM13 tripartite motif containing 13 2 8
MIRT520752 THSD7A thrombospondin type 1 domain containing 7A 2 4
MIRT520826 SYPL1 synaptophysin like 1 2 6
MIRT520837 SYP synaptophysin 2 4
MIRT521035 SLC30A4 solute carrier family 30 member 4 2 8
MIRT521122 SIPA1L3 signal induced proliferation associated 1 like 3 2 8
MIRT521257 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT521413 RC3H1 ring finger and CCCH-type domains 1 2 10
MIRT521424 RBBP9 RB binding protein 9, serine hydrolase 2 2
MIRT521652 PRKD3 protein kinase D3 2 2
MIRT521783 PPARGC1A PPARG coactivator 1 alpha 2 10
MIRT521862 PLRG1 pleiotropic regulator 1 2 4
MIRT521878 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 4
MIRT521895 PIAS1 protein inhibitor of activated STAT 1 2 4
MIRT521921 PHIP pleckstrin homology domain interacting protein 2 6
MIRT521937 PHF8 PHD finger protein 8 2 10
MIRT521975 PHACTR2 phosphatase and actin regulator 2 2 10
MIRT521980 PEX5L peroxisomal biogenesis factor 5 like 2 8
MIRT521990 PER1 period circadian clock 1 2 2
MIRT521993 PDCD10 programmed cell death 10 2 6
MIRT522008 PCGF2 polycomb group ring finger 2 2 6
MIRT522029 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 4
MIRT522076 OCIAD2 OCIA domain containing 2 2 2
MIRT522256 NLK nemo like kinase 2 2
MIRT522310 NFIC nuclear factor I C 2 6
MIRT522389 MYADM myeloid associated differentiation marker 2 6
MIRT522465 MMP16 matrix metallopeptidase 16 2 4
MIRT522563 MBTD1 mbt domain containing 1 2 8
MIRT522662 MAN1A2 mannosidase alpha class 1A member 2 2 6
MIRT522735 LRP8 LDL receptor related protein 8 2 4
MIRT522758 LDLR low density lipoprotein receptor 2 6
MIRT522823 KLHL9 kelch like family member 9 2 6
MIRT522835 KLF7 Kruppel like factor 7 2 4
MIRT522838 KIAA2022 neurite extension and migration factor 2 4
MIRT522889 KCNN3 potassium calcium-activated channel subfamily N member 3 2 10
MIRT523039 IGF1 insulin like growth factor 1 2 4
MIRT523143 HOXA11 homeobox A11 2 6
MIRT523374 GSR glutathione-disulfide reductase 2 4
MIRT523384 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 6
MIRT523394 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523403 GRAMD1B GRAM domain containing 1B 2 4
MIRT523601 FZD5 frizzled class receptor 5 2 4
MIRT523742 FBXO9 F-box protein 9 2 4
MIRT523805 FAM19A1 family with sequence similarity 19 member A1, C-C motif chemokine like 2 4
MIRT523881 EPHA5 EPH receptor A5 2 4
MIRT524021 DOCK4 dedicator of cytokinesis 4 2 4
MIRT524094 DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 2 4
MIRT524219 DDI2 DNA damage inducible 1 homolog 2 2 6
MIRT524225 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT524415 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT524468 CHRM3 cholinergic receptor muscarinic 3 2 4
MIRT524537 CDCA4 cell division cycle associated 4 2 2
MIRT524653 C1orf50 chromosome 1 open reading frame 50 2 10
MIRT524724 BRI3BP BRI3 binding protein 2 4
MIRT524752 BMP2 bone morphogenetic protein 2 2 8
MIRT524824 ARSJ arylsulfatase family member J 2 4
MIRT524892 ANKRD44 ankyrin repeat domain 44 2 6
MIRT524911 AMD1 adenosylmethionine decarboxylase 1 2 4
MIRT525016 ABHD13 abhydrolase domain containing 13 2 6
MIRT525212 C19orf12 chromosome 19 open reading frame 12 2 2
MIRT525506 ZNF878 zinc finger protein 878 2 2
MIRT527077 ABCC4 ATP binding cassette subfamily C member 4 2 2
MIRT527139 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT528412 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT528423 CERCAM cerebral endothelial cell adhesion molecule 2 10
MIRT529200 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT530012 ZFP42 ZFP42 zinc finger protein 2 2
MIRT530093 SHISA2 shisa family member 2 2 2
MIRT530180 ZBED2 zinc finger BED-type containing 2 2 2
MIRT534715 RFX7 regulatory factor X7 2 2
MIRT537011 GTF2A1 general transcription factor IIA subunit 1 2 4
MIRT537414 FBXO47 F-box protein 47 2 2
MIRT538277 CTGF connective tissue growth factor 2 6
MIRT538396 CREBRF CREB3 regulatory factor 2 4
MIRT538936 BMPR1A bone morphogenetic protein receptor type 1A 2 6
MIRT540652 NLRP8 NLR family pyrin domain containing 8 2 4
MIRT541074 SAMD12 sterile alpha motif domain containing 12 2 6
MIRT541694 TTC39B tetratricopeptide repeat domain 39B 2 4
MIRT541833 CDON cell adhesion associated, oncogene regulated 2 6
MIRT542101 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT542158 ROCK2 Rho associated coiled-coil containing protein kinase 2 2 6
MIRT542173 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT542213 IRS1 insulin receptor substrate 1 2 4
MIRT542877 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT542911 HSBP1 heat shock factor binding protein 1 2 2
MIRT543035 BCORL1 BCL6 corepressor like 1 2 4
MIRT543105 ZNF556 zinc finger protein 556 2 8
MIRT543651 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT543705 XKR9 XK related 9 2 2
MIRT543983 OSBP2 oxysterol binding protein 2 2 4
MIRT544136 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT544309 TAGLN2 transgelin 2 2 2
MIRT544531 SPPL3 signal peptide peptidase like 3 2 2
MIRT544881 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT545007 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT545132 ANXA5 annexin A5 2 2
MIRT545277 ZNF551 zinc finger protein 551 2 2
MIRT545616 SSPN sarcospan 2 4
MIRT545864 ZNF264 zinc finger protein 264 2 2
MIRT546367 SYF2 SYF2 pre-mRNA splicing factor 2 2
MIRT546390 STOX2 storkhead box 2 2 4
MIRT546967 PRR14L proline rich 14 like 2 2
MIRT548061 GOLGA7 golgin A7 2 2
MIRT548216 FKBP1A FK506 binding protein 1A 2 2
MIRT548412 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT548640 DAPK1 death associated protein kinase 1 2 2
MIRT549237 ATXN3 ataxin 3 2 4
MIRT549293 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT549483 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549626 PELP1 proline, glutamate and leucine rich protein 1 2 4
MIRT549733 NUP37 nucleoporin 37 2 2
MIRT549743 RHCG Rh family C glycoprotein 2 2
MIRT549776 FAR2 fatty acyl-CoA reductase 2 2 2
MIRT550261 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT550271 GNL3 G protein nucleolar 3 2 4
MIRT550282 APOL6 apolipoprotein L6 2 4
MIRT550327 SMAD9 SMAD family member 9 2 2
MIRT550387 TBX4 T-box 4 2 6
MIRT550524 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT550545 MYZAP myocardial zonula adherens protein 2 2
MIRT550747 OPN5 opsin 5 2 2
MIRT550785 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 4
MIRT551090 DDX52 DExD-box helicase 52 2 2
MIRT551169 ATP7A ATPase copper transporting alpha 2 2
MIRT551368 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551423 GIMAP7 GTPase, IMAP family member 7 2 2
MIRT551476 RASSF6 Ras association domain family member 6 2 2
MIRT551808 C4orf33 chromosome 4 open reading frame 33 2 6
MIRT551885 EPHA1 EPH receptor A1 2 2
MIRT552065 RAB11FIP3 RAB11 family interacting protein 3 2 6
MIRT552235 SART3 squamous cell carcinoma antigen recognized by T-cells 3 2 2
MIRT552370 ZNF562 zinc finger protein 562 2 4
MIRT552539 ZHX3 zinc fingers and homeoboxes 3 2 4
MIRT552960 VGLL2 vestigial like family member 2 2 4
MIRT553319 TSPAN14 tetraspanin 14 2 2
MIRT553409 TRIB1 tribbles pseudokinase 1 2 4
MIRT553412 TRAF5 TNF receptor associated factor 5 2 2
MIRT553646 TIMM10 translocase of inner mitochondrial membrane 10 2 4
MIRT554631 RPL37 ribosomal protein L37 2 2
MIRT554945 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT556252 MARCH3 membrane associated ring-CH-type finger 3 2 2
MIRT556610 LDOC1L retrotransposon Gag like 6 2 4
MIRT556781 KLF6 Kruppel like factor 6 2 2
MIRT557190 HOOK1 hook microtubule tethering protein 1 2 6
MIRT557308 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 2
MIRT557608 GNB1 G protein subunit beta 1 2 2
MIRT557748 FUBP1 far upstream element binding protein 1 2 2
MIRT557790 FREM2 FRAS1 related extracellular matrix protein 2 2 4
MIRT557800 FOXP1 forkhead box P1 2 2
MIRT557924 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT557984 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT558078 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 4
MIRT558298 DUSP8 dual specificity phosphatase 8 2 2
MIRT558657 CNKSR3 CNKSR family member 3 2 2
MIRT558969 CALML4 calmodulin like 4 2 2
MIRT559005 CA8 carbonic anhydrase 8 2 2
MIRT559150 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559218 BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 2 4
MIRT559581 AP1AR adaptor related protein complex 1 associated regulatory protein 2 2
MIRT559957 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT560110 ZNF557 zinc finger protein 557 2 2
MIRT560190 SPRTN SprT-like N-terminal domain 2 2
MIRT560727 ZNF529 zinc finger protein 529 2 6
MIRT561880 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT563155 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT563187 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT563634 ZNF460 zinc finger protein 460 2 2
MIRT563716 SVIP small VCP interacting protein 2 4
MIRT563786 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 2 2
MIRT564003 CCL11 C-C motif chemokine ligand 11 2 2
MIRT564568 CCDC80 coiled-coil domain containing 80 2 2
MIRT564583 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT564935 XPOT exportin for tRNA 2 2
MIRT565873 NHS NHS actin remodeling regulator 2 2
MIRT566550 PANK3 pantothenate kinase 3 2 2
MIRT566809 MB21D2 Mab-21 domain containing 2 2 2
MIRT566812 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT567134 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT567150 INO80D INO80 complex subunit D 2 2
MIRT567656 EXOC8 exocyst complex component 8 2 2
MIRT572158 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT572398 CCDC14 coiled-coil domain containing 14 2 2
MIRT574305 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574499 RPS15A ribosomal protein S15a 2 2
MIRT574501 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT576690 Pck1 phosphoenolpyruvate carboxykinase 1, cytosolic 2 6
MIRT607460 PCK1 phosphoenolpyruvate carboxykinase 1 2 9
MIRT608644 ACVR2B activin A receptor type 2B 2 6
MIRT609458 DHX36 DEAH-box helicase 36 2 6
MIRT612169 EMC3 ER membrane protein complex subunit 3 2 2
MIRT612703 NSUN3 NOP2/Sun RNA methyltransferase family member 3 2 2
MIRT613828 LANCL3 LanC like 3 2 4
MIRT614148 CEP97 centrosomal protein 97 2 6
MIRT614555 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 4
MIRT615290 C20orf194 chromosome 20 open reading frame 194 2 2
MIRT615694 NEGR1 neuronal growth regulator 1 2 2
MIRT615832 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 2 2
MIRT616824 KYNU kynureninase 2 6
MIRT622177 SLITRK4 SLIT and NTRK like family member 4 2 2
MIRT624734 ANTXR2 anthrax toxin receptor 2 2 2
MIRT634544 MPP6 membrane palmitoylated protein 6 2 6
MIRT647765 RNF168 ring finger protein 168 2 2
MIRT655886 TSPAN1 tetraspanin 1 2 4
MIRT686847 SLC6A5 solute carrier family 6 member 5 2 4
MIRT687504 NECAB1 N-terminal EF-hand calcium binding protein 1 2 2
MIRT695331 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT697028 EPDR1 ependymin related 1 2 2
MIRT702306 L1CAM L1 cell adhesion molecule 2 4
MIRT706763 PRRC2C proline rich coiled-coil 2C 2 2
MIRT706881 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT706948 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT707038 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT707081 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT707129 IKZF2 IKAROS family zinc finger 2 2 2
MIRT707163 CNTNAP5 contactin associated protein like 5 2 2
MIRT707216 STAM signal transducing adaptor molecule 2 2
MIRT707264 SIK3 SIK family kinase 3 2 2
MIRT707266 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT707280 NBPF10 NBPF member 10 2 2
MIRT707298 ARHGEF11 Rho guanine nucleotide exchange factor 11 2 2
MIRT707329 PCDH7 protocadherin 7 2 2
MIRT707344 MFAP5 microfibril associated protein 5 2 2
MIRT707392 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT707434 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT707524 HHIP hedgehog interacting protein 2 2
MIRT707535 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT707553 IGFBP1 insulin like growth factor binding protein 1 2 2
MIRT707758 ZMAT3 zinc finger matrin-type 3 2 2
MIRT707764 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT707779 WDR12 WD repeat domain 12 2 2
MIRT707782 UNK unkempt family zinc finger 2 2
MIRT707791 TTYH3 tweety family member 3 2 2
MIRT707811 TMEM178B transmembrane protein 178B 2 2
MIRT707849 TAOK1 TAO kinase 1 2 2
MIRT707851 STYX serine/threonine/tyrosine interacting protein 2 2
MIRT707868 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT707871 SNRK SNF related kinase 2 2
MIRT707885 SLC45A4 solute carrier family 45 member 4 2 2
MIRT707901 SLC25A12 solute carrier family 25 member 12 2 2
MIRT707924 PRIMA1 proline rich membrane anchor 1 2 2
MIRT708017 NR2C2 nuclear receptor subfamily 2 group C member 2 2 2
MIRT708037 MED28 mediator complex subunit 28 2 2
MIRT708042 MCAM melanoma cell adhesion molecule 2 2
MIRT708054 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT708088 KIAA1671 KIAA1671 2 2
MIRT708110 HERPUD2 HERPUD family member 2 2 2
MIRT708114 GREB1L growth regulation by estrogen in breast cancer 1 like 2 2
MIRT708154 CADM1 cell adhesion molecule 1 2 2
MIRT708167 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT708176 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT708225 ADD2 adducin 2 2 2
MIRT711911 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT716128 RPL24 ribosomal protein L24 2 2
MIRT719160 FMNL2 formin like 2 2 2
MIRT725009 ZPBP zona pellucida binding protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1277 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1277-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1277-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1277-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1277-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-1277-5p Palbociclib 5330286 NSC758247 approved sensitive cell line (T47D)
hsa-miR-1277-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission