>ZFYVE21|NM_024071|3'UTR
   1 CTCTACGTGGGGCTGAGCTTGGAGTACGTGTGGTCACCAGGACTGAGTCGCTTGGAACAGCAGAGCCTGCTCCTTGCGTA
  81 CCACAGGGATTAATCCTGCTTGTGCTGGGAAATGCAACTCACTCATGTATTTGGAGAAACAGGAGTGTTCACTTATCTAG
 161 TGCAATATGTTCACAGTTTATTAATGCTTTAAACAGCTTCATGTTTTAGAATTTGTGTATTGTCAATACTTAATTGGGGG
 241 TGGGAGAGACTGAGCTACACTACTGCTAAACTATTTTTAGCATAATATATACCATTTTTATGAGTTCGCAGGTCTACTAG
 321 AAGGTTCTGGCCCATCAATATTCATTTCATTTAATTCTTCCACAGAACCAGTTTGGGCAGTAGGAACTCAGGCTTCTGGT
 401 CTGCAGTGGAGCCTGTTCGCCTCTAATAGCCAGTTTACAGCACTTGCCTTAGCCTGTTTCACAGACTTGTCCACTTACCT
 481 TGTCACTAATTTGGGGCTTCTGGGCTGTGAGTGATCCTTTGATACTTCACCAAGGGGAACGTGGGGGCTTTGTGTTTTGT
 561 ACTTTTCACTCACTATTTCACTTTATTAAGATGACTGTACAGCAATTTGTATATAAAGCTTATGATTAAAAACTATTTTG
 641 AACATACGGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuUAGGACCAAGACAGG-GAGUGAUc 5' :|::| || || |:| ||||||| Target 5' gtGTTTT-GTACTTTTCACTCACTAt 3'	552 - 576	162.00	-12.60
2	miRNA 3' cuUAGGAC---CAAGAC-----AGG--GAGUGAuc 5' |||||| || ||| | | |||||| Target 5' taATCCTGCTTGTGCTGGGAAATGCAACTCACTca 3'	91 - 125	141.00	-17.20
3	miRNA 3' cuUAGGACCAAG-------ACAGG---------GAGUGAUc 5' | |||| ||| ||||| |||||| Target 5' ttAGCCTGTTTCACAGACTTGTCCACTTACCTTGTCACTAa 3'	449 - 489	123.00	-16.51

Mutant ID	Mutant Position	Mutant Source
COSN164793	2	COSMIC
COSN30491707	11	COSMIC
COSN30517255	16	COSMIC
COSN30473267	23	COSMIC
COSN26602641	31	COSMIC
COSN13572718	47	COSMIC
COSN27005712	80	COSMIC
COSN24998162	92	COSMIC
COSN19693336	106	COSMIC
COSN20111734	142	COSMIC
COSN28528724	166	COSMIC
COSN31609321	184	COSMIC
COSN20077984	199	COSMIC
COSN24295424	226	COSMIC
COSN31483389	269	COSMIC
COSN30120513	308	COSMIC
COSN31530696	317	COSMIC
COSN30540312	321	COSMIC
COSN31533973	364	COSMIC
COSN1638546	426	COSMIC
COSN31538884	534	COSMIC
COSN22358693	586	COSMIC
COSN29333348	636	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs780441491	1	dbSNP
rs2295146	2	dbSNP
rs774395784	4	dbSNP
rs762276886	6	dbSNP
rs767751377	7	dbSNP
rs566285060	8	dbSNP
rs535176908	12	dbSNP
rs1208422668	13	dbSNP
rs968510369	16	dbSNP
rs1264432464	17	dbSNP
rs747251034	17	dbSNP
rs1331917494	20	dbSNP
rs766922840	22	dbSNP
rs113873376	25	dbSNP
rs768935839	27	dbSNP
rs907618430	28	dbSNP
rs754491974	29	dbSNP
rs1468275969	33	dbSNP
rs1176178543	35	dbSNP
rs1034041103	38	dbSNP
rs774196171	39	dbSNP
rs1473246950	42	dbSNP
rs1174224316	45	dbSNP
rs768646317	48	dbSNP
rs571350084	50	dbSNP
rs758266464	51	dbSNP
rs1281471941	54	dbSNP
rs1289625276	55	dbSNP
rs916912179	61	dbSNP
rs1228127268	66	dbSNP
rs905667686	78	dbSNP
rs1337512806	79	dbSNP
rs1001333883	86	dbSNP
rs536676598	97	dbSNP
rs1197382587	99	dbSNP
rs1057409341	102	dbSNP
rs895754680	106	dbSNP
rs1013990246	108	dbSNP
rs1262898193	117	dbSNP
rs1020986453	122	dbSNP
rs1450507436	123	dbSNP
rs966781220	124	dbSNP
rs150670962	126	dbSNP
rs972959108	128	dbSNP
rs1032436165	135	dbSNP
rs143367739	137	dbSNP
rs777799245	137	dbSNP
rs1231014914	144	dbSNP
rs1295996777	153	dbSNP
rs974957551	153	dbSNP
rs573896256	157	dbSNP
rs955014102	161	dbSNP
rs1048527730	166	dbSNP
rs1181116321	172	dbSNP
rs138869791	174	dbSNP
rs983516828	187	dbSNP
rs1171288773	191	dbSNP
rs1462876841	192	dbSNP
rs1162660903	196	dbSNP
rs552803888	199	dbSNP
rs781143078	202	dbSNP
rs911269450	202	dbSNP
rs1389983892	211	dbSNP
rs1410558855	213	dbSNP
rs1477079605	214	dbSNP
rs1260519753	217	dbSNP
rs572721479	218	dbSNP
rs544768785	222	dbSNP
rs941704979	223	dbSNP
rs8548	226	dbSNP
rs1334140765	227	dbSNP
rs771031911	227	dbSNP
rs112502838	236	dbSNP
rs774491958	237	dbSNP
rs1344175116	241	dbSNP
rs1056991868	246	dbSNP
rs1220220266	251	dbSNP
rs1357756481	260	dbSNP
rs895712516	261	dbSNP
rs946024220	269	dbSNP
rs578027707	272	dbSNP
rs1034072253	280	dbSNP
rs902481271	286	dbSNP
rs759820189	288	dbSNP
rs1333966995	290	dbSNP
rs149377639	291	dbSNP
rs1340721914	293	dbSNP
rs1423394276	294	dbSNP
rs111730222	309	dbSNP
rs867257673	313	dbSNP
rs1369875209	317	dbSNP
rs1274516239	328	dbSNP
rs1435627101	331	dbSNP
rs1441392966	331	dbSNP
rs961722105	332	dbSNP
rs972993343	337	dbSNP
rs529230471	339	dbSNP
rs1257833631	342	dbSNP
rs1358734537	344	dbSNP
rs918819299	354	dbSNP
rs1244082680	358	dbSNP
rs564171822	365	dbSNP
rs1312046571	369	dbSNP
rs1445243855	370	dbSNP
rs952859417	376	dbSNP
rs1476050547	377	dbSNP
rs775993328	385	dbSNP
rs1326955539	386	dbSNP
rs900612256	387	dbSNP
rs1392410409	389	dbSNP
rs984253796	396	dbSNP
rs1058080	397	dbSNP
rs996736402	412	dbSNP
rs1030534662	413	dbSNP
rs955128211	419	dbSNP
rs1394407664	420	dbSNP
rs1429265597	425	dbSNP
rs1313681796	428	dbSNP
rs983683958	428	dbSNP
rs1453126686	430	dbSNP
rs1377555507	435	dbSNP
rs1413279231	437	dbSNP
rs367637650	439	dbSNP
rs1327471548	446	dbSNP
rs761059448	448	dbSNP
rs962988959	452	dbSNP
rs973063833	456	dbSNP
rs1041122324	461	dbSNP
rs1248565519	467	dbSNP
rs1304880035	470	dbSNP
rs1329711376	473	dbSNP
rs1438975565	473	dbSNP
rs1230243888	477	dbSNP
rs922608167	480	dbSNP
rs1360819216	483	dbSNP
rs1159931565	486	dbSNP
rs946029977	494	dbSNP
rs1268996943	497	dbSNP
rs1191710430	505	dbSNP
rs1041621933	506	dbSNP
rs904416777	508	dbSNP
rs927030836	514	dbSNP
rs1447766165	524	dbSNP
rs1055590294	527	dbSNP
rs937138614	534	dbSNP
rs1280534367	535	dbSNP
rs993066626	538	dbSNP
rs543345247	541	dbSNP
rs1014446583	542	dbSNP
rs1432019214	548	dbSNP
rs1340731303	549	dbSNP
rs1198450590	553	dbSNP
rs1024026173	554	dbSNP
rs560054899	566	dbSNP
rs962032253	566	dbSNP
rs993123757	570	dbSNP
rs1255238523	574	dbSNP
rs1447427372	576	dbSNP
rs755629019	592	dbSNP
rs1371306301	596	dbSNP
rs1423024363	598	dbSNP
rs45614733	600	dbSNP
rs1041627310	603	dbSNP
rs750264981	608	dbSNP
rs1174370357	610	dbSNP
rs180907718	612	dbSNP
rs571414009	616	dbSNP
rs984354961	618	dbSNP
rs936637896	624	dbSNP
rs1212389117	625	dbSNP
rs1441193304	627	dbSNP
rs1302544699	634	dbSNP
rs764841028	639	dbSNP
rs1320452165	642	dbSNP
rs749983911	643	dbSNP
rs1386124466	646	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.